Myotilin ismutatedinlimbgirdlemuscular dystrophy 1A

Size: px
Start display at page:

Download "Myotilin ismutatedinlimbgirdlemuscular dystrophy 1A"

Transcription

1 2000 Oxford University Press Human Molecular Genetics, 2000, Vol. 9, No Myotilin ismutatedinlimbgirdlemuscular dystrophy 1A Michael A. Hauser +,, Stephen K. Horrigan 1,+, Paula Salmikangas 2,+,UdanaM.Torian, Kristi D. Viles, Ria Dancel, Richard W. Tim, Anu Taivainen 2, Luria Bartoloni 1, James M. Gilchrist 3, Jeffrey M. Stajich, P. Craig Gaskell, John R. Gilbert, Jeffrey M. Vance, Margaret A. Pericak-Vance, Olli Carpen 2, Carol A. Westbrook 1 and Marcy C. Speer Department of Medicine, Section of Medical Genetics, Duke University Medical Center, DUMC 3445, Durham, NC , USA, 1 University of Illinois at Chicago, Chicago, IL, USA, 2 University of Helsinki, Helsinki, Finland and 3 Rhode Island Hospital, Providence, RI, USA Received 1 May 2000; Revised and Accepted 26 June 2000 We have identified a mutation in the myotilin gene in a large North American family of German descent expressing an autosomal dominant form of limb girdle muscular dystrophy (LGMD1A). We have previously mapped this gene to 5q31. Symptoms of this adult onset disease are progressive weakness of the hip and shoulder girdles, as well as a distinctive dysarthric pattern of speech. Muscle of affected individuals shows degeneration of myofibers, variations in fiber size, fiber splitting, centrally located myonuclei and a large number of autophagic vesicles. Affected muscle also exhibits disorganization and streaming of the Z- line similar to that seen in nemaline myopathy. We have identified a C450T missense mutation in the myotilin gene that is predicted to result in the conversion of residue 57 from threonine to isoleucine. This mutation has not been found in 396 control chromosomes. The mutant allele is transcribed and normal levels of correctly localized myotilin protein are seen in LGMD1A muscle. Myotilin is a sarcomeric protein that binds to α-actinin and is localized in the Z-line. The observed missense mutation does not disrupt binding to α-actinin. INTRODUCTION Limb girdle muscular dystrophy (LGMD) encompasses a clinically diverse group of disorders often characterized by proximal muscle weakness, elevated serum creatine kinase values and absent or reduced deep tendon reflexes. Both dominant (LGMD1) and recessive (LGMD2) forms have been reported. A number of the recessive limb girdle dystrophies are caused by mutations in the dystrophin-associated glycoproteins that make up the large multiprotein complex on the sarcolemmal membrane (1). Among the dominant forms, five have been mapped: LGMD1A to 5q31 (2); LGMD1B to 1q11 21 (3); LGMD1D to 6q23 (4); LGMD1E to 7q (5); and vocal cord and pharyngeal weakness with autosomal dominant distal myopathy (VCPDM) to 5q (6). Mutations in caveolin 3 have been described in LGMD1C (7,8) and mutations in the lamin A/C gene have been identified in autosomal dominant Emory Dreyfus muscular dystrophy (9). We have previously reported the only known pedigree in which autosomal dominant limb girdle muscular dystrophy 1A (LGMD1A) is segregating (10). This pedigree was linked to 5q (11), within a 2 Mb interval bounded by D5S479 and D5S594 (2,12,13). Individuals affected with LGMD1A exhibit proximal leg and arm weakness with a mean age at onset of 27 years, later progressing to include distal weakness. Approximately half of the affected individuals exhibit a distinctive nasal, dysarthric pattern of speech. Tightened heel chords and reduced knee and elbow deep tendon reflexes are frequently seen, although nerve conduction studies are normal (10). Creatine kinase levels are elevated, ranging from 1.6- to 9-fold higher than the normal limit of 120 IU/l for males and 80 IU/l for females. EMG changes indicative of primary myopathy are observed. We describe here the identification in this family of a mutation in the myotilin gene, which encodes a 498 amino acid polypeptide with a molecular weight of 57 kda (14). Myotilin is a sarcomeric protein that binds to α-actinin and is associated with the Z-line. Its C-terminus contains two Ig domains homologous to the Z-disk-associated Iglike domains 7 and 8 of the giant muscle protein titin. In contrast, the N-terminus is unique and contains no known structural domains. Other features are a 23 amino acid hydrophobic stretch (residues 57 79) and a region of high serine content between residues 28 and 124 (27 of 96 residues). RESULTS Positional identification of the myotilin mutation Analysis of the previously identified 2 Mb candidate interval for LGMD1A revealed 28 apparently unique expressed sequence tags (ESTs). The EST AA was investigated as a candidate gene because it is contained in UNIGENE cluster 84665, which is composed almost exclusively of skeletal + These authors contributed equally to this work To whom correspondence should be addressed. Tel: ; Fax: ;

2 2142 Human Molecular Genetics, 2000, Vol. 9, No. 14 Table 1. Intronic primers used to amplify and sequence myotilin exons Oligonucleotide Sequence Position relative to exon 1F GCAAGCACATCAGATGTCACTG 88 1R CAATTACATCAGATCAAGTGTCC F GCACATCAGATCTGAAAGATGTC 82 2R GGAATGAGACTGTAAGGTCAC F CTAGTAGTACTAAGTGGTAAACTC 99 3R CCAAGAGGTGATTTCATGCAGA F CTATGCTTCTTTGAAGTTCTGAC 102 4R TGTGACGTTGTGTATCCAGGTA F GTAGTATGTTAGTGCACTGTAC 174 5R GGTCATCTTCTCAGACATTAG F GATGGCTAAACTATATTTGTGC 78 6R CTTGTCCATTGTACGTACTGC F CGCAAACCCACTCAGATAC 110 7R ATGGACATTCCAATAGGTTGT F CATTAGAGTTTAGAATTCTGAATGG 186 8R TTAGTGGAATCTGGCTTACTG F GGACAGATTGAAGAGCAGAG 199 9R GTTCTAACCAAATTGGTCACAC F GTGTGACCAATTTGGTTAGAAC 59 10R GTGAGCTTCACACTGTTCTAG +113 Figure 1. Myotilin mutation associated with LGMD1A. (a) Chromatogram showing an individual affected with LGMD1A. One allele exhibits a C T mutation at position 450 of the myotilin gene, resulting in a Thr57Ile substitution. (b) SSCP analysis of a 279 bp PCR product from a normal control individual (lane 1) and an LGMD1A patient (lane 2). (c) A schematic diagram showing the serine-rich region (red box) containing a hydrophobic stretch (black box) and the two titin-like Ig domains. The vertical line shows the location of the Thr57Ile substitution. muscle-derived ESTs. A P1-derived artificial chromosome (PAC) clone 38I10 (GenBank accession no. AC004820) was identified that contained ESTs AA and AA from this UNIGENE cluster. Comparison of the sequence of these ESTs to the known sequence of PAC 38I10 allowed putative intron exon boundaries to be identified. Intronic primers were designed and exons were amplified from the genomic DNA of two affected and two control individuals. Sequence analysis identified a C T missensemutationin affected individuals. Using the predicted exonic sequence around this mutation as probe, 19 cdna clones were isolated from a human skeletal muscle cdna library, sequenced and assembled into a full-length 2244 bp cdna. At this time it became apparent that the positionally identified gene is identical to a gene termed myotilin (GenBank accession no. AF144477) independently isolated through a yeast two-hybrid screen to identify novel cytoskeletal components (14). This gene has also been investigated as a possible tumor suppressor (15). The primer pairs in Table 1 were used to amplify each of the 10 myotilin exons from genomic DNA of two LGMD1A patients and two controls. Sequence analysis of these genomic PCR products demonstrated a C450 T missense mutation in exon 2 of affected individuals (Fig. 1a), which is predicted to convert residue 57 from threonine to isoleucine (T57I). This portion of exon 2 was amplified from 69 affected individuals and 194 unaffected family members and subjected to single strand conformation polymorphism (SSCP) analysis (Fig. 1b). The mutation segregates perfectly with the disease-associated haplotype. Eight clinically asymptomatic (normal examination, normal creatine kinase) individuals in the pedigree carry the disease-associated haplotype and the mutation. All of these individuals were last examined at ages well below the average age at onset for disease in the pedigree (27.1 ± 8.5 years); therefore, it is probable that these individuals will become symptomatic on subsequent evaluation. This mutation has not been detected in 396 control chromosomes of Caucasian North American origin. It was also not detected in an additional 200 chromosomes of Finnish origin and 60 chromosomes of Japanese origin. A single nucleotide polymorphism (1875G/A; NCBI SNP ID rs4288) in the 3 - untranslated region is present in both normal and affected individuals and appears to be phenotypically silent. Individuals affected with LGMD1A do not display any defects in splicing of the only observed skeletal musclespecific myotilin transcript. The splice donor and acceptor regions bounding each exon were sequenced and no mutations were found. Further, a series of overlapping reverse transcription polymerase chain reaction (RT PCR) products

3 Human Molecular Genetics, 2000, Vol. 9, No Figure 2. Muscle of an LGMDIA patient exhibiting multiple myopathic features. (a) Section of deltoid muscle showing variations in fiber size, fiber splitting, central nuclei and fibrosis. No inflammatory infiltrate is seen. (b) Arrows indicate fibers containing rimmed vacuoles. (c) Electron microscopic analysis showing these vacuoles to be autophagic vesicles. (d) Z-line streaming characteristic of LGMDIA muscle. crossing all splice junctions was amplified from LGMD1A and control muscle RNA and no disease-specific splicing defects were detected (data not shown). Patient histological findings A biopsy was performed on the deltoid muscle of a 36-year-old, moderately affected individual. Hematoxylin and eosin stained sections showed degeneration of myofibers, variations in fiber size, fiber splitting and large numbers of centrally located myonulei (Fig. 2a). Affected muscle also exhibits interstitial fibrosis and extensive fatty infiltration late in the disease course, although there is no evidence of inflammatory cell infiltrate. ATPase staining showed some pseudogrouping due to fiber splitting, but there was no evidence for selective myopathic involvement of specific fiber types or for any alteration in the relative numbers of fiber types. The dystrophin-associated glycoprotein complex is intact in LGMD1A muscle (data not shown). There are large numbers of rimmed vacuoles (Fig. 2b), which on electron microscopic analysis appear to be autophagic vesicles, with no evidence of any amyloid material (Fig. 2c). The presence of a large number of vacuoles is sufficiently characteristic to warrant a molecular analysis of the myotilin gene in patients with unlinked myopathies. There are no abnormal accumulations of glycogen and no abnormalities of mitochondria or the tubular systems are observed. LGMD1A muscle also exhibits patches of striking Z-line irregularity (Fig. 2d). Although such Z-line streaming is a relatively non-specific feature present in many myopathic disorders and can sometimes be seen even in presumably normal, asymptomatic muscle, the extent and severity of streaming seen in LGMD1A muscle is very unusual. These Z-line abnormalities are entirely consistent with myotilin s interaction with α-actinin and its localization near the Z-line. Localization and expression level of myotilin protein To determine whether the T57I missense mutation alters the localization of myotilin protein, frozen sections of LGMD1A and control muscle were stained with antibody to myotilin (Fig. 3a). The normal pattern of sarcomeric staining was seen in both samples and there was no evidence of ectopic expression or of abnormal accumulation of myotilin protein in affected muscle. Further, western blot analysis of patient and control samples Figure 3. Immunocytochemical staining and western blot analysis of LGMD1A muscle. (a) Cryosections of muscle tissue stained with myotilin antibody showing periodic Z-line staining. LGMD1A muscle shows normal localization of myotilin, with no evidence of ectopic staining or deposits. (b) Western blot of control (lane 1) and LGMD1A (lane 2) muscle demonstrating comparable overall intensity of the recognized protein bands. The 57 kda band corresponds to monomeric myotilin and the 110 kda band apparently represents a dimer. The 75 kda band present in the LGMD1A muscle is often seen in control samples, although at a variable intensity. showed that the overall level of myotilin expression was normal in patient muscle (Fig. 3b). Patient muscle (Fig. 3b, lane 2) displayed a prominent immunoreactive band migrating at 75 kda, but this band was also seen in control muscle (lane 1). The intensity of this band varied among different control muscle extracts. No alternatively spliced myotilin transcripts have been identified in skeletal muscle that could encode a protein of this size and it may correspond to myotilin protein that has been posttranslationally modified. The antibody used in these experiments does not distinguish between normal and mutant myotilin protein. Although there is insufficient patient tissue available to allow the direct detection of mutant protein, the presence of mutant myotilin transcript can be detected. Patient RNA was reverse transcribed and PCR amplified with primers flanking the mutation. This RT PCR product was cloned and individual clones were analyzed

4 2144 Human Molecular Genetics, 2000, Vol. 9, No. 14 Figure 4. Yeast two-hybrid analysis of the interaction between myotilin and α- actinin-2. The full-length α-actinin-2 cdna (prey) was co-transformed with partial and full-length myotilin cdnas (bait) into yeast cells. The interaction of target molecules was determined by a β-galactosidase filter assay. A color reaction is an indicator of an interaction. The binding site for α-actinin-2 is located between residues 79 and 150 of myotilin and does not overlap with the site of the T57I mutation. Full-length mutant myotilin retains its ability to bind α-actinin. by denaturing high performance liquid chromatography (DHPLC). The insert of each clone was PCR amplified and mixed with PCR product from wild-type myotilin. After denaturing and reannealing, heteroduplexes were detected by DHPLC. Of the 20 clones tested, 10 (50%) contained the C450 T missense mutation. It is likely that these mutant transcripts are translated into protein. Binding of myotilin to α-actinin Previous studies have demonstrated an interaction between myotilin and α-actinin and suggested that the binding site resides in the N-terminal 150 amino acids of myotilin (14). The yeast two-hybrid method was used to further map the interacting region and to test whether the T57I mutation affects this interaction. Figure 4 shows that wild-type full-length myotilin interacts with α-actinin and further mapping with deletion constructs indicates that the binding site resides between residues 79 and 150, whereas no binding activity was seen with residues Thus, the α-actinin binding site in myotilin is C-terminal to the T57I amino acid substitution. Further, the wild-type and T57I mutant myotilins demonstrate comparable binding to α-actinin, indicating that the T57I missense mutation is not likely to cause muscle pathology by disrupting the binding of myotilin and α-actinin. Thr57 is conserved in murine myotilin Evolutionary conservation of Thr57 would support its importance in the structure and function of myotilin protein. The murine myotilin gene was cloned and sequenced. Two overlapping ESTs corresponding to murine myotilin were identified by searching public sequence databases. Oligonucleotide primers designed from these sequences were used to perform 5 and 3 rapid amplification of cdna ends (RACE) and the products were cloned and sequenced. An alignment of the deduced amino acid sequence of human and murine myotilin is shown in Figure 5. These proteins share 89% identical and 93% similar residues and Thr57 is conserved between the two species. Figure 5. Alignment of human and murine myotilin amino acid sequence. The sequences contain 89% identical and 93% similar residues. Thr57 (grey box), which is mutated in our LGMD1A family, is conserved between the two species. DISCUSSION We have identified a missense mutation in the myotilin gene of LGMD1A patients. This gene encodes a sarcomeric protein that is localized in the Z-disk. The actin-binding protein α- actinin, which cross-links thin filaments into antiparallel bundles in Z-lines, is also localized in the Z-disk and yeast two-hybrid analysis has shown that these two proteins bind to one another (14). Electron microscopic analysis of LGMD1A patient muscle biopsies reveals Z-line abnormalities, including extensive regions of Z-line streaming. This abnormal Z-line material often appears as rod-like bodies, closely resembling the pathognomic rods seen in nemaline myopathy. Mutations in two other sarcomeric proteins that localize to the Z-line have been shown to result in nemaline myopathy: nebulin (NEM2) (16) and α-tropomyosin (NEM1) (17). The latter presents striking parallels with LGMD1A because, not only do both the α-tropomyosin and myotilin proteins bind α-actinin, but also missense mutations in the corresponding genes give rise to autosomal dominant myopathy with disruptions of the Z-line. Mutations in the α-actin gene (ACTA1) also give rise to nemaline myopathy (18). Nemaline-like rods are a relatively non-specific feature and have been found associated with such diverse disorders as mitochondrial myopathy (19,20), rhabdomyoma (21), HIV infection (22), chronic alcoholism (23), central core disease

5 Human Molecular Genetics, 2000, Vol. 9, No (24) and paranoid schizophrenia (25). They have also been induced experimentally in rat muscle by tenotomy (26). However, we have presented evidence that the Z-line streaming observed in the muscles of LGMD1A patients is directly involved in the disease process. We have provided quantitative data showing that the transcript from the mutant myotilin allele is present in the muscle tissue of LGMD1A patients and thus is likely to be translated. We have shown by western analysis that the overall level of myotilin protein is normal in LGMD1A muscle and immunocytochemical staining shows this myotilin to be correctly localized to the Z- line, with no evidence of precipitates or abnormal deposits. Thus, myotilin is localized precisely to the site of the observed myopathic changes and interacts with other proteins localized there, consistent with the observed myotilin defect playing a causative role in the Z-line abnormalities seen in LGMD1A patients. The nemaline myopathies are a heterogeneous group of disorders and include a severe neonatal form that is often fatal during the first year of life, a less severe congenital form and an adult onset form (27 29). The less severe congenital and adult onset forms are non-progressive or slowly progressive (30). Type I muscle fibers tend to predominate, with the disappearance of type IIB (fast glycolytic) fibers and an increase in undifferentiated type IIC fibers (31 33). LGMD1A most closely resembles adult onset nemaline myopathy. Both disorders display Z-line streaming, similar ages at onset and normal or mildly elevated serum creatine kinase levels. However, there are significant differences between the two disorders. Although there is substantial variation among individuals, in general LGMD1A displays a more rapid clinical progression of disease than does adult onset nemaline myopathy. LGMD1A shows no evidence of preferential involvement of specific fiber types and the autophagic vesicles so characteristic of LGMD1A are not found in nemaline myopathy. The precise mechanism by which the T57I mutation in myotilin disrupts the Z-disk is not yet understood and will require better knowledge of the function of myotilin in normal muscle. Because both the expression level and localization of myotilin appear to be normal in LGMD1A muscle, we speculate that the T57I mutant myotilin may perturb the normal structure of the Z-disk. This could be the result of a gain of function or, perhaps more likely, the disruption of an existing protein protein interaction required for normal structure and function of the Z-disk. The yeast two-hybrid experiments presented here would seem to preclude a direct effect on α-actinin binding and suggest that the T57I substitution may interfere with binding of another, as yet unidentified, sarcomeric protein. The identification of additional pedigrees carrying myotilin mutations would provide further insight into possible structure function relationships in the myotilin protein. To date only one other autosomal dominant myopathic pedigree has been linked to 5q: the minimal candidate region for vocal cord and pharyngeal weakness with autosomal dominant distal myopathy (VCPDM) spans 7 cm and contains the myotilin locus (6). Through a combination of RT PCR and sequence analysis of material from several VCPDM patients, splicing and coding defects in the skeletal muscle isoform of myotilin have been excluded as the cause of this disease. We are currently screening a collection of 108 individuals with unlinked limb girdle muscular dystrophy for defects in myotilin and will screen additional samples as they become available. At the same time, we are developing animal models for LGMD1A and are using yeast two-hybrid analysis to define the regions responsible for the binding of myotilin to various muscle proteins, as well as the effects of the T57I mutation on those interactions. These investigations will shed additional light on this interesting and novel protein and its role in normal and diseased muscle. MATERIALS AND METHODS cdna isolation The Clontech (Palo Alto, CA) human skeletal muscle 5 - stretch plus cdna library was plated at a density of clones per 127 mm nylon membrane (Hybond; Amersham, Arlington Heights, IL). Probe was prepared using the primers 5 -CTCCAGATTGCAGCCTCCT-3 (forward) and 5 -TACT- GCTATTGTAATCAGGC-3 (reverse) to amplify genomic DNA, and the resultant 279 bp product was labeled with random primer extension using the Readiprime kit (Amersham). Nineteen positively hybridizing clones were plaquepurified twice before sequencing. The murine myotilin cdna was isolated from the Clontech mouse skeletal muscle Marathon cdna library. Two ESTs (AI and AA422457) corresponding to murine myotilin were identified through a TBLASTN search with the deduced amino acid sequence of human myotilin protein. This sequence wasusedtodesignprimersfor5 RACE (5 -GGTGGAGGGA- TAGCTGAGATCTGGCACTCCAGC-3 ) and3 RACE (5 - GCTGGAGAAGCCACCTTCACAGTGCAGCTGG-3 ). The products were cloned, sequenced and the open reading frame translated. The nucleotide sequence has been submitted to GenBank (accession no. AF230979). SSCP analysis To detect the C450 T mutation, a 279 bp fragment was amplified from genomic DNA using primers 5 -CTCCA- GATTGCAGCCTCCT-3 (forward) and 5 -TACTGCTATT- GTAATCAGGC-3 (reverse) with touchdown cycling conditions of 94 Cfor20s,65 C for 15 s and 72 C for 20 s, with the annealing temperature decreasing 1 C per cycle to a final value of 55 C. After 45 cycles, 2 vol of SSCP stop buffer were added (0.1% xylene cyanol, 0.1% bromophenol blue, 10 mm NaOH, 95% formamide), samples were denatured for 3 min at 94 C and chilled on ice for 5 min. Samples were electrophoresed at 12 W for 3.5 h at room temperature in a 0.5 MDE gel (FMC Bioproducts, Rockland, ME) with 0.6 Tris borate/edta buffer. To detect the G1875 A polymorphism, a 188 bp PCR product was generated using primers 5 -ACAGAAAGATGCTGGGTGG-3 (forward) and 5 GTAGGCTCACAAATCGGAG-3 (reverse). PCR amplification and SSCP was performed as above, except that samples were electrophoresed at 8 W for 2.5 h. Sequence analysis Lymphocytes were isolated from whole blood and genomic DNA extracted using Puregene kits (Gentra Systems, Minneapolis, MN). Genomic PCR products and cdna clones were sequenced using the ABI Prism BigDye terminator kit (Perkin Elmer, Foster City, CA) and a Perkin Elmer ABI 373

6 2146 Human Molecular Genetics, 2000, Vol. 9, No. 14 sequencer or the Amersham Pharmacia Thermo Sequenase labeled primer cycle sequencing kit and a LiCor 4200 Gene Reader sequencer (LiCor, Lincoln, NE). Overlapping sequences were assembled using Sequencher software (Ann Arbor, MI). Histology Muscle tissue was isolated during diagnostic biopsy and frozen in liquid nitrogen-cooled isopentane. Cryosections were stained with hemotoxylin and eosin. For electron microscopy, muscle tissue was fixed in 0.1 M cacodylate-buffered Karnovsky s fixative solution (3% glutaraldehyde and 3% formaldehyde) for 4 h at 4 C, ph 7.4, washed overnight in cacodylate buffer, post-fixed in a buffered solution of 1% osmium tetroxide and dehydrated through a graded ethanol series. Each specimen was propylene oxide embedded in epoxy resin and polymerized for 3 days at 45 C and 1 day at 60 C. Ultra-thin sections were post-stained in 1% uranyl acetate and lead citrate. Immunocytochemical staining Tissue collected during biopsy of the deltoid muscle was snapfrozen in liquid nitrogen-cooled isopentane and 7 µm sections were fixed on glass slides for 5 min with cold acetone. Phosphate-buffered saline (PBS: 0.15 g/l Na 2 HPO 4, 0.2 g/l KH 2 PO 4, 0.2 g/l KCl, 8.0 g/l NaCl, ph 6.85) was used for washing and all subsequent incubations. Sections were blocked for 30 min with 5% goat serum, washed and incubated for60minat roomtemperaturewith32 µg/ml affinity-purified anti-myotilin antibody in 1% goat serum (14). Samples were washed three times for 10 min each in PBS, stained for 30 min at room temperature with 0.4 µg/ml Cy3-conjugated goat antirabbit IgG (H+L) secondary antibody from Amersham Pharmacia, washed three times for 10 min each and mounted with Vectashield (Vector, Burlingame, CA). Western blotting Tissue collected during biopsy of the deltoid muscle was snapfrozen in liquid nitrogen, ground in a mortar and pestle, resuspended in 45 µl of homogenization buffer (1% SDS, 1 mm phenylmethylsulfonyl fluoride, 1 mm benzamidine, 5 mm EGTA, 0.5 µg/ml leupeptin, 0.2 U/ml trasylol) per 50 mg tissue, vortexed for 45 s, boiled for 2 min and centrifuged at g for 3 min to clarify. Protein concentration was measured using the Coomassie Plus Protein Assay Reagent (Pierce, Rockford, IL) and 20 mg of protein extract was electrophoresed on an 8% polyacrylamide gel electrophoresis gel. The gel was electrotransferred to a Bio-Rad (Richmond, CA) Trans Blot Transfer Medium, Pure Nitrocellulose 0.45 µm membrane, blocked with 5% non-fat dry milk + 0.1% Tween 20 in PBS and stained with 1.6 µg/ml anti-myotilin antibody (14) for 60 min at room temperature, washed three times for 10 min each in PBS + 0.1% Tween 20, stained with 0.53 µg/ml Jackson horseradish peroxidase-conjugated goat anti-rabbit secondary antibody, washed three times for 10 min each in PBS + 0.1% Tween 20 and detected with an ECL kit as described by Amersham Pharmacia. Denaturing HPLC analysis of myotilin transcripts To determine the relative amounts of normal and mutant myotilin transcript present in muscle LGMD1A muscle, a 410 bp RT PCR product flanking the observed mutation was amplified from patient muscle RNA using primers 5 - CTCAACAAGGAAGAGCAGAC-3 and 5 -GTTGTAAC- CCTTTGGCCTGG-3. This product was cloned into plasmid ptadv (Clontech) and 20 individual clones were selected for analysis. The insert from each clone was reamplified with the above primers and mixed with the same PCR product amplified from genomic DNA of an unaffected individual in order to allow formation of heteroduplexes. Genomic PCR amplification was performed in a 50 µl volume containing 20 mm Tris HCl ph 8.4, 50 mm KCl, 0.2 mm dntps, 1.5 mm MgCl 2, 0.5 U of Platinum Taq polymerase (Gibco Life Technologies, Grand Island, NY) and 0.20 µm concentrations of each primer. The cycling program started with an initial denaturation step of 2minat92 C. All subsequent denaturation steps were 92 C for 5 s and all elongation steps were 72 C for 45 s. The annealing temperature was decreased by 2 C over 10 cycles from 65 to 57 C. Thirty cycles were done with an annealing temperature of 55 C for 30 s. Heteroduplexes were formed by heating the samples to 95 C for3minandslowlycoolingto 25 C over a period of 40 min. Four microliters of sample was injected into a Transgenomic WAVE DHPLC for separation on a DNasep column at 62 C as described by the manufacturer (Transgenomic, San Jose, CA). Yeast two-hybrid analysis Myotilin cdna constructs encoding amino acid residues 1 78, , (full-length) or 1 498T57L (LGMD1A patient mutation) were cloned into the plexa yeast two-hybrid bait vector (34). Human skeletal muscle α-actinin-2 (amino acids 1 894) was cloned in prey vector pgad10 (Clontech). The bait and prey plasmids were co-transformed into the Saccharomyces cerevisiae L40 reporter strain using a modified lithium acetate protocol. The transformants were plated onto synthetic medium lacking histidine, leucine, tryptophan, uracil and lysine and plates were incubated for 3 days at 30 C. HIS + colonies were grown on synthetic medium lacking leucine and tryptophan, incubated for 3 days at 30 C and assayed for β- galactosidase activity by a filter assay (35) or liquid assay following the Matchmaker protocol (Clontech). ACKNOWLEDGEMENTS We would like to thank Dr Ed Bossen for helpful discussions of muscle pathology. This work was supported by a grant from the Muscular Dystrophy Association (M.C.S. and C.A.W.) and NIH grant NS26630 (M.P.V.). REFERENCES 1. Ozawa, E., Noguchi, S., Mizuno, Y., Hagiwara, Y. and Yoshida, M. (1998) From dystrophinopathy to sarcoglycanopathy: evolution of a concept of muscular dystrophy. Muscle Nerve, 21, Yamaoka, L.H., Westbrook, C.A., Speer, M.C., Gilchrist, J.M., Jabs, E.W., Schweins, E.G., Stajich, J.M., Gaskell, P.C., Roses, A.D. and Pericak-Vance, M.A. (1994) Development of a microsatellite genetic map spanning 5q31-q33 and subsequent placement of the LGMD locus between D5S178 and IL9. Neuromusc. Disord., 4,

7 Human Molecular Genetics, 2000, Vol. 9, No van der Kooi, A.J., van Meegen, M., Ledderhof, T.M., McNally, E.M., De Visser, M. and Bolhuis, P.A. (1997) Genetic localization of a newly recognized autosomal dominant limb-girdle muscular dystrophy with cardiac involvement (LGMD1B) to chromosome 1q Am.J.Hum.Genet., 60, Messina, D.N., Speer, M.C., Pericak-Vance, M.A. and McNally, E.M. (1997) Linkage of familial dilated cardiomyopathy with conduction defect and muscular dystrophy to chromosome 6q23. Am.J.Hum.Genet., 61, Speer, M.C., Vance, J.M., Grubber, J.M., Graham, F.L., Stajich, J.M., Viles, K.D., Rogala, A., McMichael, R., Chutkow, J., Goldsmith, C. et al. (1999) Identification of a new autosomal dominant limb-girdle muscular dystrophy locus on chromosome 7. Am.J.Hum.Genet., 64, Feit, H., Silbergleit, A., Schneider, L.B., Gutierrez, J.A., Fitoussi, R.P., Reyes,C.,Rouleau,G.A.,Brais,B.,Jackson,C.E.,Beckmann,J.S.and Seboun, E. (1998) Vocal cord and pharyngeal weakness with autosomal dominant distal myopathy: clinical description and gene localization to 5q31. Am.J.Hum.Genet., 63, McNally, E.M., de Sa, M., Bonnemann, C.G., Lisanti, M.P., Lidov, H.G.W., Vainzof, M., Passos-Bueno, M.R., Hoffman, E.P., Zatz, M. and Kunkel, L.M. (1998) Caveolin-3 in muscular dystrophy. Hum. Mol. Genet., 7, Minetti, C., Sotiga, F., Bruno, C., Scartezzini, P., Bado, M., Masetti, E., Mazzocco, M., Egeo, A., Donati, M.A., Volonte, D. et al. (1998) Mutations in the caveolin-3 gene cause autosomal dominant limb-girdle muscular dystrophy. Nature Genet., 18, Bonne, G., di Barletta, M.R., Varnous, S., Becane, H., Hammouda, E., Merlini, L., Muntoni, F., Greenberg, C.R., Gary, F., Urtizberea, J.A. et al. (1999) Mutations in the gene encoding lamin A/C cause autosomal dominant Emery Dreifuss muscular dystrophy. Nature Genet., 21, Gilchrist, J.M., Pericak-Vance, M.A., Silverman, L. and Roses, A.D. (1988) Clinical and genetic investigation in autosomal dominant limbgirdle muscular dystrophy. Neurology, 38, Speer, M.C., Yamaoka, L.H., Gilchrist, J.H., Gaskell, C.P., Stajich, J.M., Vance, J.M., Kazantsev, A., Lastra, A.A., Haynes, C.S., Beckmann, J.S. et al. (1992) Confirmation of genetic heterogeneity in limb-girdle muscular dystrophy: linkage of an autosomal dominant form to chromosome 5q. Am.J.Hum.Genet., 50, Bartoloni, L., Horrigan, S.K., Viles, K.D., Gilchrist, J.M., Stajich, J.M., Vance, J.M., Yamaoka, L.H., Pericak-Vance, M.A., Westbrook, C.A. and Speer, M.C. (1998) Use of a CEPH meiotic breakpoint panel to refine the locus of limb-girdle muscular dystrophy type 1A (LGMD1A) to a 2-Mb interval on 5q31. Genomics, 54, Horrigan, S.K., Bartoloni, L., Speer, M.C., Fulton, N., Kravarusic, J., Ramesar, R., Vance, J.M., Yamaoka, L.H. and Westbrook, C.A. (1999) A radiation hybrid breakpoint map of the Acute Myeloid Leukemia (AML) and Limb-Girdle Muscular Dystrophy 1A (LGMD1A) regions of chromosome 5q31 localizing 122 expressed sequences. Genomics, 57, Salmikangas, P., Mykkänen, O.M., Grönholm, M., Heiska, L., Kere, J. and Carpén, O. (1999) Myotilin, a novel sarcomeric protein with two Iglike domains, is encoded by a candidate gene for limb-girdle muscular dystrophy. Hum. Mol. Genet., 8, Godley, L.A., Lai, F., Liu, J., Zhao, N. and Le Beau, M.M. (1999) A novel gene at 5q31 encoding a protein with titin-like features. Genomics, 60, Pelin, K., Hilpelä, P., Donner, K., Sewry, C., Akkari, P.A., Wilton, S.D., Wattanasirichaigoon, D., Bang, M.L., Centner, T., Hanefeld, F. et al. (1999) Mutations in the nebulin gene associated with autosomal recessive nemaline myopathy. Proc. Natl Acad. Sci. USA, 96, Laing, N.G., Wilton, S.D., Akkari, P.A., Dorosz, S., Boundy, K., Kneebone, C., Blumbergs, P., White, S., Watkins, H., Love, D.R. and Haan, E. (1995) A mutation in the alpha tropomyosin gene TPM3 associated with autosomal dominant nemaline myopathy. Nature Genet., 9, Nowak, K.J., Wattanasirichaigoon, D., Goebel, H.H., Wilce, M., Pelin, K., Donner, K., Jacob, R.L., Hübner, C., Oexle, K., Anderson, J.R. et al. (1999) Mutations in the skeletal muscle α-actin gene in patients with actin myopathy and nemaline myopathy. Nature Genet., 23, Kornfeld, M. (1980) Mixed nemaline-mitochondrial myopathy. Acta. Neuropathol. (Berl.), 51, Fukunaga, H., Osame, M. and Igata, A. (1980) A case of nemaline myopathy with ophthalmoplegia and mitochondrial abnormalities. J. Neurol. Sci., 46, Cognog Jr, J.L. and Gonatas, N.K. (1967) Ultrastructure in rhabdomyoma. J. Ultrastruct. Res., 50, Simpson, D.M. and Bender, A.N. (1988) Human immunodeficiency virus-associated myopathy: analysis of 11 patients. Ann. Neurol., 24, Martinez, A.J., Hooshmand, H. and Faris, A.A. (1973) Acute alcoholic myopathy. Enzyme histochemistry and electron microscope findings. J. Neurol. Sci., 20, Telerman-Toppett, N., Gerard, J.M. and Coërs, C. (1973) Central core disease a study of clinically unaffected muscle. J. Neurol. Sci., 19, Meltzer,H.Y., MacBride, E. and Poppei, T.W. (1973) Rod (nemaline) bodies in the skeletal muscle of an acute schizophrenic patient. Neurology, 23, Karpati, G., Carpenter, S. and Eisen, A.A. (1972) Experimental core-like lesions and nemaline rods. A correlative morphological and physiological study. Arch. Neurol., 27, Banker, B.Q. (1986) The congenital myopathies. In Engel, A.G. and Banker,B.Q.(eds),Myology: Basic and Clinical. McGraw-Hill, New York, NY, p Brooke, M.H. (1986) A Clinician s View of Neuromuscular Diseases. Williams and Wilkins, Baltimore, MD. 29. Martinez, B.A. and Lake, B.D. (1987) Childhood nemaline myopathy: a review of clinical presentation in relation to prognosis. Dev. Med. Child. Neurol., 29, North, K.N., Laing, N.G., Wallgren-Pettersson, C. and the ENMC International Consortium on Nemaline Myopathy (1997) Nemaline myopathy: current concepts. J. Med. Genet. 34, Wallgren-Pettersson, C., Rapola, J. and Donner, M. (1988) Pathology of congenital nemaline myopathy: a follow-up study. J. Neurol. Sci., 83, Volpe, P., Damiani, E. and Margreth, A. (1982) A fast to slow change of myosin of nemaline myopathy: electrophoretic and immunologic evidence. Neurology 32, Miike, T., Ohtani, Y., Tamri, H., Ishitsu, T. and Une, Y. (1986) Muscle fiber type transformation in nemaline myopathy and congenital fiber type disproportion. Brain Dev., 8, Vojtek, A., Hollenberg, S. and Cooper, J.A. (1993) Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell, 74, Breeden, L. and Nasmyth, K. (1985) Regulation of the yeast HO gene. Cold Spring Harbor Symp. Quant. Biol., 50,

8 2148 Human Molecular Genetics, 2000, Vol. 9, No. 14

DIAGNOSING CHILDHOOD MUSCULAR DYSTROPHIES

DIAGNOSING CHILDHOOD MUSCULAR DYSTROPHIES DIAGNOSING CHILDHOOD MUSCULAR DYSTROPHIES Extracts from a review article by KN North and KJ Jones: Recent advances in diagnosis of the childhood muscular dystrophies Journal of Paediatrics and Child Health

More information

Becker Muscular Dystrophy

Becker Muscular Dystrophy Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Application Guide... 2

Application Guide... 2 Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

Anti-ATF6 α antibody, mouse monoclonal (1-7)

Anti-ATF6 α antibody, mouse monoclonal (1-7) Anti-ATF6 α antibody, mouse monoclonal (1-7) 73-500 50 ug ATF6 (activating transcription factor 6) is an endoplasmic reticulum (ER) membrane-bound transcription factor activated in response to ER stress.

More information

Western Blotting: Mini-gels

Western Blotting: Mini-gels Western Blotting: Mini-gels Materials a Protein Extraction Buffer (for callus or kernel), Solution Stock Final Volume Tris-HCl ph 80 1 M 200 mm 20 ml NaCl 4 M 100 mm 25 ml Sucrose 2 M 400 mm 20 ml EDTA

More information

Chromatin Immunoprecipitation

Chromatin Immunoprecipitation Chromatin Immunoprecipitation A) Prepare a yeast culture (see the Galactose Induction Protocol for details). 1) Start a small culture (e.g. 2 ml) in YEPD or selective media from a single colony. 2) Spin

More information

Limb girdle muscular dystrophies (LGMDs)

Limb girdle muscular dystrophies (LGMDs) Limb girdle muscular dystrophies (LGMDs) This factsheet is for all people for whom a diagnosis of limb girdle muscular dystrophy (LGMD) has been suggested. This is a complicated subject since there are

More information

Southern Blot Analysis (from Baker lab, university of Florida)

Southern Blot Analysis (from Baker lab, university of Florida) Southern Blot Analysis (from Baker lab, university of Florida) DNA Prep Prepare DNA via your favorite method. You may find a protocol under Mini Yeast Genomic Prep. Restriction Digest 1.Digest DNA with

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Methods for Protein Analysis

Methods for Protein Analysis Methods for Protein Analysis 1. Protein Separation Methods The following is a quick review of some common methods used for protein separation: SDS-PAGE (SDS-polyacrylamide gel electrophoresis) separates

More information

Protein transfer from SDS-PAGE to nitrocellulose membrane using the Trans-Blot SD cell (Western).

Protein transfer from SDS-PAGE to nitrocellulose membrane using the Trans-Blot SD cell (Western). Western Blot SOP Protein transfer from SDS-PAGE to nitrocellulose membrane using the Trans-Blot SD cell (Western). Date: 8/16/05, 10/31/05, 2/6/06 Author: N.Oganesyan, R. Kim Edited by: R. Kim Summary:

More information

Running protein gels and detection of proteins

Running protein gels and detection of proteins Running protein gels and detection of proteins 1. Protein concentration determination using the BIO RAD reagent This assay uses a colour change reaction to give a direct measurement of protein concentration.

More information

Chapter 3 Contd. Western blotting & SDS PAGE

Chapter 3 Contd. Western blotting & SDS PAGE Chapter 3 Contd. Western blotting & SDS PAGE Western Blot Western blots allow investigators to determine the molecular weight of a protein and to measure relative amounts of the protein present in different

More information

Methionine Sulfoxide Immunoblotting Kit

Methionine Sulfoxide Immunoblotting Kit Methionine Sulfoxide Immunoblotting Kit Item No. 600160 Customer Service 800.364.9897 * Technical Support 888.526.5351 www.caymanchem.com TABLE OF CONTENTS GENERAL INFORMATION 3 Materials Supplied 4 Precautions

More information

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of

More information

Design of conditional gene targeting vectors - a recombineering approach

Design of conditional gene targeting vectors - a recombineering approach Recombineering protocol #4 Design of conditional gene targeting vectors - a recombineering approach Søren Warming, Ph.D. The purpose of this protocol is to help you in the gene targeting vector design

More information

In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab)

In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab) In vitro analysis of pri-mirna processing by Drosha-DGCR8 complex (Narry Kim s lab) 1-1. Preparation of radiolabeled pri-mirna transcript The RNA substrate for a cropping reaction can be prepared by in

More information

Lecture 3: Mutations

Lecture 3: Mutations Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between

More information

TECHNICAL BULLETIN. TRI Reagent For processing tissues, cells cultured in monolayer or cell pellets. Catalog Number T9424 Store at room temperature.

TECHNICAL BULLETIN. TRI Reagent For processing tissues, cells cultured in monolayer or cell pellets. Catalog Number T9424 Store at room temperature. TRI Reagent For processing tissues, cells cultured in monolayer or cell pellets Catalog Number T9424 Store at room temperature. TECHNICAL BULLETIN Product Description TRI Reagent is a quick and convenient

More information

Protein Purification and Analysis

Protein Purification and Analysis Protein Purification and Analysis Numbers of genes: Humans ~40,000 genes Yeast ~6000 genes Bacteria ~3000 genes Solubility of proteins important for purification: 60-80% soluble, 20-40% membrane Some proteins

More information

ab185916 Hi-Fi cdna Synthesis Kit

ab185916 Hi-Fi cdna Synthesis Kit ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1

More information

ISOLATION AND PROPERTIES OF SECRETORY GRANULES FROM RAT ISLETS OF LANGERHANS. II. Ultrastructure of the Beta Granule

ISOLATION AND PROPERTIES OF SECRETORY GRANULES FROM RAT ISLETS OF LANGERHANS. II. Ultrastructure of the Beta Granule ISOLATION AND PROPERTIES OF SECRETORY GRANULES FROM RAT ISLETS OF LANGERHANS II Ultrastructure of the Beta Granule MARIE H GREIDER, S L HOWELL, and P E LACY From the Department of Pathology, Washington

More information

PNA BRAF Mutation Detection Kit

PNA BRAF Mutation Detection Kit - PNA BRAF Mutation Detection Kit Catalog Number KA2102 50 tests/kit Version: 01 Intended for research use only www.abnova.com Introduction and Background Intended use The PNA BRAF Mutation Detection Kit

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

Human Genome Organization: An Update. Genome Organization: An Update

Human Genome Organization: An Update. Genome Organization: An Update Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion

More information

First Strand cdna Synthesis

First Strand cdna Synthesis 380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences

More information

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Chapter 9 Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Q&A Interferons are species specific, so that interferons to be used in humans must be produced in human cells. Can you think

More information

Classic Immunoprecipitation

Classic Immunoprecipitation 292PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Classic Immunoprecipitation Utilizes Protein A/G Agarose for Antibody Binding (Cat.

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

Genomic DNA Extraction Kit INSTRUCTION MANUAL

Genomic DNA Extraction Kit INSTRUCTION MANUAL Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

Pharmaceutical Biotechnology. Recombinant DNA technology Western blotting and SDS-PAGE

Pharmaceutical Biotechnology. Recombinant DNA technology Western blotting and SDS-PAGE Pharmaceutical Biotechnology Recombinant DNA technology Western blotting and SDS-PAGE Recombinant DNA Technology Protein Synthesis Western Blot Western blots allow investigators to determine the molecular

More information

RNA and Protein Synthesis

RNA and Protein Synthesis Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic

More information

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne

Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne Sanger Sequencing and Quality Assurance Zbigniew Rudzki Department of Pathology University of Melbourne Sanger DNA sequencing The era of DNA sequencing essentially started with the publication of the enzymatic

More information

Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides

Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides Polyacrylamide gel electrophoresis (PAGE) and subsequent analyses are common tools in biochemistry and molecular biology. This Application

More information

Neuromuscular diseases

Neuromuscular diseases Neuromuscular diseases Spinal muscular atrophy - SMA characterized by degeneration of the anterior horn cells in the spinal cord and motor nuclei in the lower brainstem. SMA type 1, is also known as Werdnig-

More information

Western Blotting. USA: proteintech@ptglab.com UK & Europe: europe@ptglab.com China: service@ptglab.com. www.ptglab.com

Western Blotting. USA: proteintech@ptglab.com UK & Europe: europe@ptglab.com China: service@ptglab.com. www.ptglab.com Western Blotting All steps are carried out at room temperature unless otherwise indicated. Recipes for all solutions highlighted bold are included at the end of the protocol. SDS-PAGE 1. Construct an SDS-PAGE

More information

CompleteⅡ 1st strand cdna Synthesis Kit

CompleteⅡ 1st strand cdna Synthesis Kit Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS

STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS THESIS SUBMITTED FOR THE DEGREB OF DOCTOR OF PHILOSOPHY (SCIENCE) OF THE UNIVERSITY OF CALCUTTA 1996 NRISINHA DE, M.Sc DEPARTMENT OF BIOCHEMISTRY

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name sorbin and SH3 domain containing 2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SORBS2 Human Arg and c-abl represent the mammalian

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

PrimeSTAR HS DNA Polymerase

PrimeSTAR HS DNA Polymerase Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

WESTERN BLOTTING TIPS AND TROUBLESHOOTING GUIDE TROUBLESHOOTING GUIDE

WESTERN BLOTTING TIPS AND TROUBLESHOOTING GUIDE TROUBLESHOOTING GUIDE WESTERN BLOTTING TIPS AND TROUBLESHOOTING GUIDE TIPS FOR SUCCESSFUL WESTERB BLOTS TROUBLESHOOTING GUIDE 1. Suboptimal protein transfer. This is the most common complaint with western blotting and could

More information

竞 争 性 分 析 Epitope Mapping 实 验 方 法

竞 争 性 分 析 Epitope Mapping 实 验 方 法 竞 争 性 分 析 Epitope Mapping 实 验 方 法 ABSTRACT The simplest way to determine whether two monoclonal antibodies bind to distinct sites on a protein antigen is to carry out a competition assay. The assay can

More information

Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus

Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus Introduction Protein extraction from tissues and cultured cells is the first step for many biochemical and analytical

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Hepatitis B Virus Genemer Mix

Hepatitis B Virus Genemer Mix Product Manual Hepatitis B Virus Genemer Mix Primer Pair for amplification of HBV Specific DNA Fragment Includes Internal Negative Control Primers and Template Catalog No.: 60-2007-12 Store at 20 o C For

More information

PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,

PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Supplemental Text/Tables PCR Amplification and Sequencing PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Foster City, CA). Each PCR reaction contained 20 ng genomic

More information

THE His Tag Antibody, mab, Mouse

THE His Tag Antibody, mab, Mouse THE His Tag Antibody, mab, Mouse Cat. No. A00186 Technical Manual No. TM0243 Update date 01052011 I Description.... 1 II Key Features. 2 III Storage 2 IV Applications.... 2 V Examples - ELISA..... 2 VI

More information

Genetics Lecture Notes 7.03 2005. Lectures 1 2

Genetics Lecture Notes 7.03 2005. Lectures 1 2 Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

STANDARD OPERATING PROCEDURE

STANDARD OPERATING PROCEDURE STANDARD OPERATING PROCEDURE Title: Evaluation using Western Blot SOP#: M-103 Version #: 1 Author: R. Saul Date Approved: Feb. 5, 2009 Date Modified: 1. PURPOSE The purpose of this document is to describe

More information

RevertAid Premium First Strand cdna Synthesis Kit

RevertAid Premium First Strand cdna Synthesis Kit RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

Sickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes

Sickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes Protein Structure Polypeptide: Protein: Therefore: Example: Single chain of amino acids 1 or more polypeptide chains All polypeptides are proteins Some proteins contain >1 polypeptide Hemoglobin (O 2 binding

More information

Muscle Physiology and the. Pathology of Muscular Dystrophy

Muscle Physiology and the. Pathology of Muscular Dystrophy Muscle Physiology and the Pathology of Muscular Dystrophy Angela Tompkins February 23, 2010 Everglades University Biology 1 Muscle Physiology and the Pathology of Muscular Dystrophy Humans are able to

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a

Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a Optimal Conditions for F(ab ) 2 Antibody Fragment Production from Mouse IgG2a Ryan S. Stowers, 1 Jacqueline A. Callihan, 2 James D. Bryers 2 1 Department of Bioengineering, Clemson University, Clemson,

More information

MUTATION, DNA REPAIR AND CANCER

MUTATION, DNA REPAIR AND CANCER MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful

More information

Chapter 20: Biotechnology

Chapter 20: Biotechnology Name Period The AP Biology exam has reached into this chapter for essay questions on a regular basis over the past 15 years. Student responses show that biotechnology is a difficult topic. This chapter

More information

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory.

STANDARD 2 Students will demonstrate appropriate safety procedures and equipment use in the laboratory. BIOTECHNOLOGY Levels: 11-12 Units of Credit: 1.0 CIP Code: 51.1201 Prerequisite: Biology or Chemistry Skill Certificates: #708 COURSE DESCRIPTION is an exploratory course designed to create an awareness

More information

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR

Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR BioTechniques 25:415-419 (September 1998) ABSTRACT The determination of unknown DNA sequences around

More information

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.

1. Molecular computation uses molecules to represent information and molecular processes to implement information processing. Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,

More information

PROTOCOL 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 www.mitosciences.com

PROTOCOL 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 www.mitosciences.com PROTOCOL Western Blotting Transfer and Detection Procedure 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 02-11 DESCRIPTION Western Blotting Transfer and Detection Procedure ADDITIONAL MATERIALS REQUIRED

More information

Biological Sciences Initiative. Human Genome

Biological Sciences Initiative. Human Genome Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.

More information

DNA and Forensic Science

DNA and Forensic Science DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief

More information

Genomes and SNPs in Malaria and Sickle Cell Anemia

Genomes and SNPs in Malaria and Sickle Cell Anemia Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing

More information

MRI and proteomic studies in normal and

MRI and proteomic studies in normal and MRI and proteomic studies in normal and pathological muscles. Isabel ILLA. Catedrática Medicina de la Universitat Autònoma de Barcelona. Chief Neuromuscular Diseases Unit. Hospital Santa Creu i Sant Pau.

More information

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,

More information

Investigating the role of a Cryptosporidium parum apyrase in infection

Investigating the role of a Cryptosporidium parum apyrase in infection Investigating the role of a Cryptosporidium parum apyrase in infection David Riccardi and Patricio Manque Abstract This project attempted to characterize the function of a Cryptosporidium parvum apyrase

More information

MagExtractor -Genome-

MagExtractor -Genome- Instruction manual MagExtractor-Genome-0810 F0981K MagExtractor -Genome- NPK-101 100 preparations Store at 4 C Contents [1] Introduction [2] Components [3] Materials required [4] Protocol 1. Purification

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

ECL Western Blotting Substrate INSTRUCTIONS FOR USE OF PRODUCTS W1001 AND W1015.

ECL Western Blotting Substrate INSTRUCTIONS FOR USE OF PRODUCTS W1001 AND W1015. Technical Manual ECL Western Blotting Substrate INSTRUCTIONS FOR USE OF PRODUCTS W1001 AND W1015. PRINTED IN USA. 6/09 ECL Western Blotting Substrate All technical literature is available on the Internet

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Dot Blot Analysis. Teacher s Guidebook. (Cat. # BE 502) think proteins! think G-Biosciences www.gbiosciences.com

Dot Blot Analysis. Teacher s Guidebook. (Cat. # BE 502) think proteins! think G-Biosciences www.gbiosciences.com PR110 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name Dot Blot Analysis Teacher s Guidebook (Cat. # BE 502) think proteins! think G-Biosciences

More information

Laboratory Techniques I Oncology for Scientists I

Laboratory Techniques I Oncology for Scientists I Laboratory Techniques I Oncology for Scientists I September 9 th, 2015 Hayley Affronti, PhD Student Hayley.Affronti@roswellpark.org Dr. Sheila Figel too! When we first hit the lab there are so many things

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

Gene Expression Assays

Gene Expression Assays APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency

More information

ab185915 Protein Sumoylation Assay Ultra Kit

ab185915 Protein Sumoylation Assay Ultra Kit ab185915 Protein Sumoylation Assay Ultra Kit Instructions for Use For the measuring in vivo protein sumoylation in various samples This product is for research use only and is not intended for diagnostic

More information

GENOTYPING ASSAYS AT ZIRC

GENOTYPING ASSAYS AT ZIRC GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed

More information

BacReady TM Multiplex PCR System

BacReady TM Multiplex PCR System BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA

Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA Classical Microbiology courses are typically structured to introduce the identification of bacterial species using a series of biochemical

More information

QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.

QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency. QUANTITATIVE RT-PCR Application: Quantitative RT-PCR is used to quantify mrna in both relative and absolute terms. It can be applied for the quantification of mrna expressed from endogenous genes, and

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc. New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System

More information

Protein immunoblotting

Protein immunoblotting Protein immunoblotting (Western blotting) Dr. Serageldeen A. A. Sultan Lecturer of virology Dept. of Microbiology SVU, Qena, Egypt seaas@lycos.com Western blotting -It is an analytical technique used to

More information

Mitochondrial DNA Analysis

Mitochondrial DNA Analysis Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information