Molecular Biology of the Genome. Christine Queitsch Department of Genome Sciences
|
|
|
- Octavia Carter
- 5 years ago
- Views:
Transcription
1 Molecular Biology of the Genome Christine Queitsch Department of Genome Sciences 1
2 Outline Information Flow in Genomics Gene Structure Genetic Linkage Chromatin Structure Genome Sequencing 2
3 DNA and the Flow of Information The genetic material: DNA - Four kinds of subunits (bases A, C, G, T) A coding problem C A G T Activities within the cell performed by proteins - Twenty kinds of subunits (amino acids) Ser Gly Cys Leu His Gln Asn Val Phe H 3 N + His Leu Val Glu Ala Leu Tyr Leu Val Cys Gly Glu Arg Glu Arg Arg Ala Lys Pro Thr Tyr Phe Phe Gly Ala Gln Asn Pro Gln Ala Gly Ala Val Glu Leu Ala Leu Tyr Leu Leu Gln Glu Ser Ala Leu Gly Cys Gln Glu Pro Ile Leu Asn Pro Ser Gly Tyr Gln Thr Gly Cys Lys Cys Leu Asn Arg COO Cys - Gly Gly Gln Gly Ile Gly Val Glu 3
4 The Central Dogma of Molecular Biology replication transcription translation DNA RNA Protein heredity phenotype Information into protein flows one way A universal code: 3 nucleotides = 1 amino acid 4
5 DNA Structure Information content is in the sequence of bases along a DNA molecule rules of base pairing each strand of the double helix has all the info needed to recreate the other strand Redundancy in the code multiple ways that DNA can specify a single amino acid Genetic variation differences in the base sequence between different individuals why individuals vary in their phenotypes 5
6 Central Dogma: DNA Replication DNA structure: polarity and base pairing 5 Watson 3 3 Crick 5 A pairs with T G pairs with C DNA replication: what s the point? lagging strand leading strand 3 duplicate the entire genome prior to cell division new subunits can only be added to the 3 OH of the growing chain 3 5 6
7 Central Dogma: Transcription Genes specific segments along the chromosomal DNA that code for some function Transcription: copy gene into RNA (to make a specific protein) mrna gene promoter terminator gene terminator gene mrna promoter 7
8 Transcription Transcription: copy gene into RNA to make a specific protein ribonucleic acid uses uracil (U) in place of thymine (T) gene coding or sense strand 5 w 3 3 c 5 mrna RNA polymerase template strand Where s the 5 end of the gene? of the mrna? Which way is RNA polymerase moving? 8
9 Transcription in vivo gene DNA nascent RNA transcripts RNA polymerases 9
10 Practice Question gene 5 w 3 3 c 5 1. Which way (to the right or left) are RNA polymerases moving? 2. Which strand (W or C) is the template strand? 10
11 Processing of pre-mrna Eukaryotic genes are interrupted by introns (non-coding information). They must be removed from the RNA before translation in a process called splicing. gene pre-mrna exons introns mature mrna ORF UTR s (untranslated regions) introns discarded exons spliced together 11
12 Review of the Central Dogma: Translation Translating the nucleic acid code to a peptide code Possible coding systems: 1 base per amino acid 2 bases per amino acid 3 bases per amino acid Could only code for 4 amino acids! Could only code for 16 amino acids 64 possible combinations that s plenty! 12
13 The triplet code 3 bases = 1 amino acid More than 1 triplet can code for the same amino acid codon Translation: reads the information in RNA to order the amino acids in a protein A U G A C U U C A G U A A C A U U A A C C 5 3 mrna M e t T h r S e r V a l T h r P h e NH 3 + COO - protein 13
14 Punctuation: Start: AUG = methionine, the first amino acid in (almost) all proteins Stop: UAA, UAG, and UGA. A U G A C U U C A G U A A C A U U A A C C 5 3 mrna M e t T h r S e r V a l T h r P h e STOP NH 3 + COO - protein NOT an amino acid! 14
15 The Genetic Code: Who is the interpreter? Where s the dictionary? What are the rules of grammar? trna = transfer RNA Met amino acid 3 Met charged trna UAC trna aminoacyl trna synthetase 3 UAC 5 5 AUG 3 anticodon recognizes codon in mrna 15
16 The ribosome: mediates translation Locates the 1st AUG, sets the reading frame for codonanticodon base-pairing Met Thr ribosome... UAC UGA... 5 AUAUGACUUCAGUAACCAUCUAACA 3 After the 1st two trnas have bound 16
17 the ribosome breaks the Met-tRNA bond; Met is instead joined to the second amino acid Met Thr ribosome UAC UGA... 5 AUAUGACUUCAGUAACCAUCUAACA 3 P-site A-site 17
18 the ribosome breaks the Met-tRNA bond; Met is instead joined to the second amino acid and the Met-tRNA is released Met Thr ribosome UAC UGA... 5 AUAUGACUUCAGUAACCAUCUAACA 3 then ribosome moves over by 1 codon in the 3 direction 18
19 Met Thr Ser UGA AGU... 5 AUAUGACUUCAGUAACCAUCUAACA 3 19
20 When the ribosome reaches the Stop codon termination Met Thr Ser Val Thr Phe STOP UAG... 5 AUAUGACUUCAGUAACCAUCUAACA 3 20
21 The finished peptide! N-terminus NH 3 + Met Thr Ser Val Thr Phe COO - C-terminus 5 3 AUAUGACUUCAGUAACCAUCUAACA 21
22 Practice Question Which strand on the DNA sequence is the coding (sense) strand? How can you tell? 22
23 Finding Sense in Nonsense cbdryloiaucahjdhtheflybitthedogbutnotthecatjhhajctipheq GGGTATAGAAAATGAATATAAACTCATAGACAAGATCGGTGAGGGAACATTTTCGTCAGTGTATAAAGCCAAAGATATCACTGGGAAAATAA CAAAAAAATTTGCATCACATTTTTGGAATTATGGTTCGAACTATGTTGCTTTGAAGAAAATATACGTTACCTCGTCACCGCAAAGAATTTATAA TGAGCTCAACCTGCTGTACATAATGACGGGATCTTCGAGAGTAGCCCCTCTATGTGATGCAAAAAGGGTGCGAGATCAAGTCATTGCTGTTT TACCGTACTATCCCCACGAGGAGTTCCGAACTTTCTACAGGGATCTACCAATCAAGGGAATCAAGAAGTACATTTGGGAGCTACTAAGAGCA TTGAAGTTTGTTCATTCGAAGGGAATTATTCATAGAGACATCAAACCGACAAATTTTTTATTTAATTTGGAATTGGGGCGTGGAGTGCTTGTT GATTTTGGTCTAGCCGAGGCTCAAATGGATTATAAAAGCATGATATCTAGTCAAAACGATTACGACAATTATGCAAATACAAACCATGATGGT GGATATTCAATGAGGAATCACGAACAATTTTGTCCATGCATTATGCGTAATCAATATTCTCCTAACTCACATAACCAAACACCTCCTATGGTCAC CATACAAAATGGCAAGGTCGTCCACTTAAACAATGTAAATGGGGTGGATCTGACAAAGGGTTATCCTAAAAATGAAACGCGTAGAATTAAAA GGGCTAATAGAGCAGGGACTCGTGGATTTCGGGCACCAGAAGTGTTAATGAAGTGTGGGGCTCAAAGCACAAAGATTGATATATGGTCCGT AGGTGTTATTCTTTTAAGTCTTTTGGGCAGAAGATTTCCAATGTTCCAAAGTTTAGATGATGCGGATTCTTTGCTAGAGTTATGTACTATTTTT GGTTGGAAAGAATTAAGAAAATGCGCAGCGTTGCATGGATTGGGTTTCGAAGCTAGTGGGCTCATTTGGGATAAACCAAACGGATATTCTA ATGGATTGAAGGAATTTGTTTATGATTTGCTTAATAAAGAATGTACCATAGGTACGTTCCCTGAGTACAGTGTTGCTTTTGAAACATTCGGATT TCTACAACAAGAATTACATGACAGGATGTCCATTGAACCTCAATTACCTGACCCCAAGACAAATATGGATGCTGTTGATGCCTATGAGTTGAA AAAGTATCAAGAAGAAATTTGGTCCGATCATTATTGGTGCTTCCAGGTTTTGGAACAATGCTTCGAAATGGATCCTCAAAAGCGTAGTTCAG CAGAAGATTTACTGAAAACCCCGTTTTTCAATGAATTGAATGAAAACACATATTTACTGGATGGCGAGAGTACTGACGAAGATGACGTTGTC AGCTCAAGCGAGGCAGATTTGCTCGATAAGGATGTTCT How do you find out if sequence contains a gene? How do you identify the gene? 23
24 Reading Frame: the ribosome establishes the grouping of nucleotides that correspond to codons by the first AUG encountered. Starts counting triplets from this base 5 AUAUGACUUCAGUAACCAUCUAACA 3 ORF: open reading frame, from the first AUG to the first in-frame stop. The ORF encodes the information for the protein. More generally: a reading frame with a stretch of codons not interrupted by stop non-coding RNAs! 24
25 Looking for ORFs - read the sequence 5 3, looking for stop - try each reading frame - since we know the genetic code can do a virtual translation if necessary How to identify genes experimentally? 25
26 Outline Information Flow in Genomics Gene Structure Genetic Linkage Chromatin Structure Genome Sequencing 26
27 Gene Structure: The Parts List Genomic DNA for a protein-coding eukaryotic gene is comprised of regulatory and coding sequences Enhancer distal regulatory element 5 UTR Exon Exon 3 UTR Promoter proximal regulatory element Intron Intron = CRM (cis-regulatory motif) Can be upstream or downstream of promoter, proximal or distal 27
28 Promoters Promoters are specific sites on DNA that RNA polymerase first binds to initiate the transcription of a gene Composed of a variety of different cis-sequence elements which recruit trans-acting factors through DNA-protein interactions 28
29 Core Promoter Elements 5 UTR Exon Exon 3 UTR Enhancer Promoter Intron Intron BRE TATA inr G C G G CGCC C A ~-50 - not all elements required TATA ~-30 A A A T T PyPyAN A PyPy +1 T - many promoters lack a TATA box, using instead the functionally analogous initiator (inr) element 29
30 Combinatorial Gene Regulation Most eukaryotic genes have multiple cis regulatory motifs located outside of the core promoter region Can be located in promoter proximal regions, 3 downstream regions, and many kb away from target gene Allows for combinatorial control of gene expression 30
31 Distal regulatory elements: Enhancers Enhancer : - Can function in either orientation - Can occur far (>50 kb) from the gene - Can be up or downstream - Range in size between ~ bp - Contain multiple TF binding sites Enhancesome 31
32 Untranslated Regions (UTRs) Most eukaryotic mrnas contain untranslated regions in their 5 and 3 ends The 5 UTR is the region between the start of transcription and the start of translation The 3 UTR is the region between the stop codon and poly-a tail Both the 5 and 3 UTRs can contain cis regulatory sequences that bind TFs, influence transport to the cytoplasm, mediate transcript stability, and translational control 5 UTR Exon Exon 3 UTR 32
33 Alternative Splicing mrna from some genes can be spliced into two or more distinct transcripts Creates protein diversity (isoforms) 5 splice site 3 splice site 33
34 Outline Information Flow in Genomics Gene Structure Genetic Linkage Chromatin Structure Genome Sequencing 34
35 Transmission of Genetic Information 2N 2N Diploid 2N 1N 1N Chromosomes decondensed Chromosomes condensed Elements of cell division Cell growth Chromosome duplication Chromosome segregation 35
36 Meiosis Interphase: Chromosomes replicate Meiosis I: Reductive division, homologous chromosomes separate Meiosis II: Sister chromatids separate 36
37 Recombination 37
38 How Does Distance Between Loci Affect Transmission? Independent Assortment: loci are unlinked or far enough apart that they are transmitted independently from one another Genetic linkage: loci are close enough together on a chromosome to be transmitted together 38
39 Genetic Mapping The frequency of recombination between loci is based on the distance between them 39
40 Recombination Is A Measure of Distance Recombination fraction, = the probability that a recombinant gamete is transmitted If two loci are on different chromosomes, they will segregate independently => recombination fraction = 0.5 If two loci are right next to each other, they will segregate together during meiosis => recombination fraction = 0 Jargon: < 0.5 the loci are close (they are linked) = 0.5 the loci are far apart (they are not linked) 40
41 Recombination Is A Measure of Distance Map Distance = Number Recombinant Gametes Total Number of Gametes x 100 Centimorgan (cm): a unit of chromosome length, equals the length of chromosome over which crossing-over occurs with 1% frequency 41
42 Practice Question In maize, consider three recessive phenotypes: lazy growth (ll), glossy leaves (gg), and sugary endosperm (ss). The following cross was made: Ll Gg Ss x ll gg ss and the observed progeny distribution was (neither gene nor linkage phase is known) Phenotype Number wildtype 286 lazy 33 glossy 59 sugary 4 lazy, glossy 2 lazy, sugary 44 glossy, sugary 40 lazy, glossy, sugary 272 Total 740 Determine order and distances among the three genes 42
43 Where to begin? Wild-type for all L G S / l g s x Recomb. lazy, gloss, sugary l g s / l g s Parental types will constitute 50% of all progeny, so Rule 1: Two most-frequent gametes types are the parental types
44 L G S // l g s x l g s // l g s Progeny Phenotype Progeny Genotypes Number wildtype L G S // l g s 286 lazy l G S // l g s 33 glossy L g S // l g s 59 sugary L G s // l g s 4 lazy,glossy l g S // l g s 2 lazy,sugary l G s // l g s 44 glossy,sugary L g s // l g s 40 lazy,glossy,sugary l g s // l g s 272 Total 740
45 Linkage phase in heterozygous parent? L G S or L g S or l g S or L g s l g s l G s L G s l G S
46 Rule 2 The double-recombinant gametes will be the two least frequent types. A B C a b c Progeny Phenotype Progeny Genotypes Number wildtype L G S / l g s 286 lazy l G S / l g s 33 glossy L g S / l g s 59 sugary L G s / l g s 4 lazy,glossy l g S / l g s 2 lazy,sugary l G s / l g s 44 glossy,sugary L g s / l g s 40 lazy,glossy,sugary l g s / l g s 272 Total 740
47 Rule 3 Effect of double crossovers is to interchange the members of the middle pair of alleles between the chromosomes A B C A b C a b c a B c
48 Parental types: L G S and l g s Double-crossover types: L G s and l g S Which gene is in the middle? L S G L s G l s g l S g Now you know linkage phase of heterozygous parent and gene order how far apart are these genes?
49 Count the cross-overs between adjacent genes L S G l s g In parents, L allele on same homolog as S and l on same homolog as s. So if these get broken up ---> cross-over between L and S loci In parents, S on same homolog as G and s on same homolog as g. If these get broken up --> recombination between S and G loci
50 Rule 4: Reciprocal products expected to occur in approximately equal numbers LGS lgs ( ) LgS lgs (59 44) Lgs lgs (40 33) LGs lgs (4 2) Progeny Progeny Genotype Phenotype # wildtype L G S / l g s 286 lazy l G S / l g s 33 glossy L g S / l g s 59 sugary L G s / l g s 4 lazy,glossy l g S / l g s 2 lazy,sugary l G s / l g s 44 glossy,sugary L g s / l g s 40 lazy,glossy,sugary l g s / l g s 272 Total 740
51 Progeny Progeny Genotype Crossover or Non-Crossover? Phenotype # wildtype L G S / l g s 286 Parental (NCO) lazy l G S / l g s 33 single CO between L and S glossy L g S / l g s 59 single CO between S and G sugary L G s / l g s 4 double CO lazy,glossy l g S / l g s 2 double CO lazy,sugary l G s / l g s 44 single CO between S and G glossy,sugary L g s / l g s 40 single CO between L and S lazy,glossy,sugary l g s / l g s 272 Parental (NCO) Total 740 Rec Freq L-S l G S 33 L g s 40 L G s 4 l g S 2 79 Rec Freq S-G L g S 59 l G s 44 L G s 4 l g S 2 109
52 Rec Freq L-S l G S 33 L g s 40 L G s 4 l g S 2 79 Rec Freq S-G L g S 59 l G s 44 L G s 4 l g S /740 or 10.7% of gametes recombinant between L & S. distance between L & S = 10.7 map units 109/740 or 14.8 % of gametes recombinant between S & G. distance between S & G= 14.8 map units 10.7 mu 14.8 mu L S G
53 Outline Information Flow in Genomics Gene Structure Genetic Linkage Chromatin Structure Genome Sequencing 53
54 Chromosome Structure: Coils of Coils of Coils nucleosome at mitosis Local unpacking of chromatin allows gene expression and replication 54
55 Nucleosomes ~146 bp of DNA wrapped around nucleosome ~ 80 bp linker histone octamer 55
56 Histone Modification and Chromatin Activity modifications change interaction with DNA and trans-factors can activate or repress transcription reinforce regulatory patterns set up by TFs 56
57 What Do These Modifications Do? A Histone Code? Distinct histone modifications, on one or more tails, act sequentially or in combination that is read by other proteins to bring about distinct downstream events (Strahl and Allis, 2000, Nature, 403:41) Carey et al. Cell (2007) 128:707 57
58 Outline Information Flow in Genomics Gene Structure Genetic Linkage Chromatin Structure Genome Sequencing 58
59 DNA Sequencing Technology Sanger sequencing Next-Generation 3 rd and 4 th Generation 59
60 Genome Sequencing: Hierarchical Shotgun Sequencing Shear genomic DNA into smaller pieces and subclone into library (such as BACs, Cosmids, etc.) Create physical map Shotgun sequence each BAC from minimal tiling path (shearing of ~150kb BAC clone into ~ 2kb fragments) Data from linkage and physical maps used to assemble sequence maps of chromosomes 60
61 Genome Sequencing: Whole Genome Shotgun Sequencing Whole genome randomly sheared three times Plasmid library constructed with ~ 2kb inserts Plasmid library with ~10 kb inserts BAC library with ~200 kb inserts Computer program assembles sequences into chromosomes No physical map construction Only one BAC library Overcomes problems of repeat sequences only not really 61
62 62
63 Next-Generation Sequencing Technology Illumina HiSeq: 4 billion reads per flow cell X 100 bases, paired = 400 Gbp 8 samples per flow cell = 50 Gbp each (one human genome = 3 Gbp) Reagent cost ~$8K per run Updated: HiSeq 3000/4000 SBS Kits enable up to 1500 Gb (1.5 Tb) of output per dual flow cell run ABI SOLID: similar yield Roche 454: 1 million reads X 500 bases = 0.5 Gbp 63
64 Illumina sequencing Mardis, ER, 2008, ARGHG 64
65 Illumina sequencing: clusters 65
66 Illumina sequencing: sequence reaction 66
67 Illumina sequencing: sequence reaction Sequence clusters are imaged after each cycle of synthesis 67
68 What is missed? Plenty: repetitive DNA and structural variation Example: short tandem repeats C C C A A A G C A G G G C A G C A G 68
69 3 rd Generation Sequencing Technology Single Molecule Real Time (SMRT) sequencing technology (PacBio RS) based on circular DNA molecules read by polymerase and long reads - up to 10kb error-prone 69
70 4 th Generation Sequencing Technology Protein nanopore sequencing (Oxford Nanopore) ultra-long reads - up to 1MB, limited by integrity of the DNA high error rate, low throughput 70
71 Next-Gen Sequencing - What s All the Fuss About? 71
72 The Era of Personal Genomics? James D. Watson (5/31/2007) J. Craig Venter (8/4/2007) /photos/venter jpg It is here. The challenge is interpretation.
73 Censoring of Watson s ApoE gene 3.6 kb Important ethical issues confront personal genomics. 73
74 Interpreting Genome Sequences The ENCODE Project: comprehensive parts list of the functional elements in the human genome Pilot Project Description ENCODE Project Consortium et al. The ENCODE (ENCyclopedia Of DNA Elements) Project. Science (2004) vol. 306 (5696) Pilot Project Results ENCODE Project Consortium et al. Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project. Nature (2007) vol. 447 (7146) 74
75 Let s Play Gene or No Gene A gene is often a segment of DNA that encodes a protein. How about DNA that encodes: a micro RNA that binds to an mrna to inhibit translation? an RNA spliced out of an intron and used for another function? an antisense transcript? a long non-coding RNA of unknown function? a pseudogene? 75
Transcription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
Protein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
Molecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
Genetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
5 GENETIC LINKAGE AND MAPPING
5 GENETIC LINKAGE AND MAPPING 5.1 Genetic Linkage So far, we have considered traits that are affected by one or two genes, and if there are two genes, we have assumed that they assort independently. However,
a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled
Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
Sample Questions for Exam 3
Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.
Academic Nucleic Acids and Protein Synthesis Test
Academic Nucleic Acids and Protein Synthesis Test Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Each organism has a unique combination
2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
From DNA to Protein
Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins
Translation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein
Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of
Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary
Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page
13.2 Ribosomes & Protein Synthesis
13.2 Ribosomes & Protein Synthesis Introduction: *A specific sequence of bases in DNA carries the directions for forming a polypeptide, a chain of amino acids (there are 20 different types of amino acid).
The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
BioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
Biology Final Exam Study Guide: Semester 2
Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion
Transcription: RNA Synthesis, Processing & Modification
Transcription: RNA Synthesis, Processing & Modification 1 Central dogma DNA RNA Protein Reverse transcription 2 Transcription The process of making RNA from DNA Produces all type of RNA mrna, trna, rrna,
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.
Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.
DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3
DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can
somatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive
CHAPTER 6 MEIOSIS AND MENDEL Vocabulary Practice somatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive CHAPTER 6 Meiosis and Mendel sex
RNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
Basic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes
ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination
Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown
1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains
Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
PRACTICE TEST QUESTIONS
PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.
GENE REGULATION. Teacher Packet
AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures
CCR Biology - Chapter 8 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 8 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Hershey and Chase know
Basic Principles of Transcription and Translation
The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific traits by dictating the synthesis of
DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)
DNA, RNA, replication, translation, and transcription Overview Recall the central dogma of biology: DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) DNA structure
2006 7.012 Problem Set 3 KEY
2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression
RNA and Protein Synthesis
Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
12.1 The Role of DNA in Heredity
12.1 The Role of DNA in Heredity Only in the last 50 years have scientists understood the role of DNA in heredity. That understanding began with the discovery of DNA s structure. In 1952, Rosalind Franklin
Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons
Tutorial II Gene expression: mrna translation and protein synthesis Piergiorgio Percipalle, PhD Program Control of gene transcription and RNA processing mrna translation and protein synthesis KAROLINSKA
Test Two Study Guide
Test Two Study Guide 1. Describe what is happening inside a cell during the following phases (pictures may help but try to use words): Interphase: : Consists of G1 / S / G2. Growing stage, cell doubles
BCH401G Lecture 39 Andres
BCH401G Lecture 39 Andres Lecture Summary: Ribosome: Understand its role in translation and differences between translation in prokaryotes and eukaryotes. Translation: Understand the chemistry of this
Chapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
Announcements. Chapter 15. Proteins: Function. Proteins: Function. Proteins: Structure. Peptide Bonds. Lab Next Week. Help Session: Monday 6pm LSS 277
Lab Next Week Announcements Help Session: Monday 6pm LSS 277 Office Hours Chapter 15 and Translation Proteins: Function Proteins: Function Enzymes Transport Structural Components Regulation Communication
Translation. Translation: Assembly of polypeptides on a ribosome
Translation Translation: Assembly of polypeptides on a ribosome Living cells devote more energy to the synthesis of proteins than to any other aspect of metabolism. About a third of the dry mass of a cell
The Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
Genetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
Introduction. What is Ecological Genetics?
1 Introduction What is Ecological enetics? Ecological genetics is at the interface of ecology, evolution, and genetics, and thus includes important elements from each of these fields. We can use two closely
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Lab # 12: DNA and RNA
115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long
AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET
NAME: AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET 1. Griffith's experiments showing the transformation of R strain pneumococcus bacteria to S strain pneumococcus bacteria in the presence of
To be able to describe polypeptide synthesis including transcription and splicing
Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
Chapter 17: From Gene to Protein
AP Biology Reading Guide Fred and Theresa Holtzclaw Julia Keller 12d Chapter 17: From Gene to Protein 1. What is gene expression? Gene expression is the process by which DNA directs the synthesis of proteins
Replication Study Guide
Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have
The world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
Genetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
BCOR101 Midterm II Wednesday, October 26, 2005
BCOR101 Midterm II Wednesday, October 26, 2005 Name Key Please show all of your work. 1. A donor strain is trp+, pro+, met+ and a recipient strain is trp-, pro-, met-. The donor strain is infected with
Chapter 5: Organization and Expression of Immunoglobulin Genes
Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed
Gene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription
Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional
Bio 102 Practice Problems Genetic Code and Mutation
Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine
European Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects
Mutation Mutation provides raw material to evolution Different kinds of mutations have different effects Mutational Processes Point mutation single nucleotide changes coding changes (missense mutations)
Appendix C DNA Replication & Mitosis
K.Muma Bio 6 Appendix C DNA Replication & Mitosis Study Objectives: Appendix C: DNA replication and Mitosis 1. Describe the structure of DNA and where it is found. 2. Explain complimentary base pairing:
AP BIOLOGY 2009 SCORING GUIDELINES
AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following
Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College. Eastern Campus
Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology An Introduction
Practice Problems 4. (a) 19. (b) 36. (c) 17
Chapter 10 Practice Problems Practice Problems 4 1. The diploid chromosome number in a variety of chrysanthemum is 18. What would you call varieties with the following chromosome numbers? (a) 19 (b) 36
I. Genes found on the same chromosome = linked genes
Genetic recombination in Eukaryotes: crossing over, part 1 I. Genes found on the same chromosome = linked genes II. III. Linkage and crossing over Crossing over & chromosome mapping I. Genes found on the
CHAPTER 30: PROTEIN SYNTHESIS
CHAPTER 30: PROTEIN SYNTHESIS (Translation) Translation: mrna protein LECTURE TOPICS Complexity, stages, rate, accuracy Amino acid activation [trna charging] trnas and translating the Genetic Code - Amino
Answer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA.
Answer: 2. Uracil Adenine, Cytosine and Guanine are found in both RNA and DNA. Thymine is found only in DNA; Uracil takes its (Thymine) place in RNA molecules. Answer: 2. hydrogen bonds The complementary
MCAS Biology. Review Packet
MCAS Biology Review Packet 1 Name Class Date 1. Define organic. THE CHEMISTRY OF LIFE 2. All living things are made up of 6 essential elements: SPONCH. Name the six elements of life. S N P C O H 3. Elements
http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets
http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct
Recombinant DNA Technology
Recombinant DNA Technology Stephen B. Gruber, MD, PhD Division of Molecular Medicine and Genetics November 4, 2002 Learning Objectives Know the basics of gene structure, function and regulation. Be familiar
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure
Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure Nucleic acids play an important role in the storage and expression of genetic information. They are divided into
Sickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes
Protein Structure Polypeptide: Protein: Therefore: Example: Single chain of amino acids 1 or more polypeptide chains All polypeptides are proteins Some proteins contain >1 polypeptide Hemoglobin (O 2 binding
Pipe Cleaner Proteins. Essential question: How does the structure of proteins relate to their function in the cell?
Pipe Cleaner Proteins GPS: SB1 Students will analyze the nature of the relationships between structures and functions in living cells. Essential question: How does the structure of proteins relate to their
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
The Structure, Replication, and Chromosomal Organization of DNA
Michael Cummings Chapter 8 The Structure, Replication, and Chromosomal Organization of DNA David Reisman University of South Carolina History of DNA Discoveries Friedrich Miescher Isolated nuclein from
Amino Acids. Amino acids are the building blocks of proteins. All AA s have the same basic structure: Side Chain. Alpha Carbon. Carboxyl. Group.
Protein Structure Amino Acids Amino acids are the building blocks of proteins. All AA s have the same basic structure: Side Chain Alpha Carbon Amino Group Carboxyl Group Amino Acid Properties There are
Gene Finding CMSC 423
Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher
Genomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
Multiple Choice Write the letter that best answers the question or completes the statement on the line provided.
Name lass Date hapter 12 DN and RN hapter Test Multiple hoice Write the letter that best answers the question or completes the statement on the line provided. Pearson Education, Inc. ll rights reserved.
Control of Gene Expression
Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
Overview of Eukaryotic Gene Prediction
Overview of Eukaryotic Gene Prediction CBB 231 / COMPSCI 261 W.H. Majoros What is DNA? Nucleus Chromosome Telomere Centromere Cell Telomere base pairs histones DNA (double helix) DNA is a Double Helix
Nucleotides and Nucleic Acids
Nucleotides and Nucleic Acids Brief History 1 1869 - Miescher Isolated nuclein from soiled bandages 1902 - Garrod Studied rare genetic disorder: Alkaptonuria; concluded that specific gene is associated
Umm AL Qura University MUTATIONS. Dr Neda M Bogari
Umm AL Qura University MUTATIONS Dr Neda M Bogari CONTACTS www.bogari.net http://web.me.com/bogari/bogari.net/ From DNA to Mutations MUTATION Definition: Permanent change in nucleotide sequence. It can
Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA
Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns
(1-p) 2. p(1-p) From the table, frequency of DpyUnc = ¼ (p^2) = #DpyUnc = p^2 = 0.0004 ¼(1-p)^2 + ½(1-p)p + ¼(p^2) #Dpy + #DpyUnc
Advanced genetics Kornfeld problem set_key 1A (5 points) Brenner employed 2-factor and 3-factor crosses with the mutants isolated from his screen, and visually assayed for recombination events between
CHAPTER 40 The Mechanism of Protein Synthesis
CHAPTER 40 The Mechanism of Protein Synthesis Problems: 2,3,6,7,9,13,14,15,18,19,20 Initiation: Locating the start codon. Elongation: Reading the codons (5 3 ) and synthesizing protein amino carboxyl.