TOOLS sirna and mirna. User guide



Similar documents
HiPerFect Transfection Reagent Handbook

岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹

Instructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control

Dicer Substrate RNAi Design

INTERFERin in vitro sirna/mirna transfection reagent PROTOCOL. 1 Standard sirna transfection of adherent cells... 2

MicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control

Functional Analysis. mircury LNA microrna Mimics

TransIT Transfection Reagent

RNAi Shooting the Messenger!

sirna Duplexes & RNAi Explorer

Manual for: sirna-trans Maximo Reagent

Optimized Protocol sirna Test Kit for Cell Lines and Adherent Primary Cells

Biological Stability and Activity of sirna in Ionic Liquids**

QIAGEN Transfection Technologies

Especially developed for the transfection of mammalian cells with sirna or mirna

RNA Interference. - Localization - Labeling - Expression Profiling - In Vivo Delivery - Transfection

Name Class Date. Figure Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

RNAi. Martin Latterich

PRODUCT INFORMATION...

Lezioni Dipartimento di Oncologia Farmacologia Molecolare. RNA interference. Giovanna Damia 29 maggio 2006

The world of non-coding RNA. Espen Enerly

Thermo Scientific Dharmacon sirna Libraries

Transfection reagent for visualizing lipofection with DNA. For ordering information, MSDS, publications and application notes see

Recombinant DNA and Biotechnology

EXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES

SmartFlare RNA Detection Probes: Principles, protocols and troubleshooting

Gene Silencing Oligos (GSOs) Third Generation Antisense

Supplementary Figure 1.

MEF Starter Nucleofector Kit

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Micro RNAs: potentielle Biomarker für das. Blutspenderscreening

LightSwitch Luciferase Assay System

ArC Amine Reactive Compensation Bead Kit

Outline. interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work?

CHAPTER 2 ANTIGEN/ANTIBODY INTERACTIONS

Proto col. GoClone Repor ter Construc ts: Sample Protocol for Adherent Cells. Tech support: Luciferase Assay System

Cell Cycle Phase Determination Kit

Fast, easy and effective transfection reagent for mammalian cells

mirnaselect pep-mir Cloning and Expression Vector

MEF Nucleofector Kit 1 and 2

RNA Viruses. A Practical Approac h. Alan J. Cann

Understanding the immune response to bacterial infections

Protein Expression. A Practical Approach J. HIGGIN S

Thermo Scientific DharmaFECT Transfection Reagents

Application Note No. 2 / July Quantitative Assessment of Cell Quality, Viability and Proliferation. System

Control of Gene Expression

Inhibition of MicroRNA Sensitizes 3D Breast Cancer Microtissues to Radiation Therapy

First Strand cdna Synthesis

Guidance. 2. Definitions. 1. Introduction

Real-time quantitative RT -PCR (Taqman)

Thermo Scientific Dharmacon ON-TARGETplus sirna The Standard for sirna Specificity

Classic Immunoprecipitation

An Introduction to Transfection Methods Technical Reference Guide

p21 Cell cycle arrest / genetic repair

RNAi: principle DNA RNA PROTEIN

qstar mirna qpcr Detection System

RAPAd mirna Adenoviral Expression System Catalog #: VPK-253

User Manual/Hand book. qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse)

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

Practical Cell Analysis

School of Nursing. Presented by Yvette Conley, PhD

CFSE Cell Division Assay Kit

2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line

Supplemental Information. McBrayer et al. Supplemental Data

博 士 論 文 ( 要 約 ) A study on enzymatic synthesis of. stable cyclized peptides which. inhibit protein-protein interactions

13.4 Gene Regulation and Expression

CONTRACTING ORGANIZATION: University of Alabama at Birmingham Birmingham, AL 35294

The Steps. 1. Transcription. 2. Transferal. 3. Translation

HUNTINGTON S DISEASE THERAPIES RESEARCH UPDATE

Final Review. Aptamers. Making Aptamers: SELEX 6/3/2011. sirna and mirna. Central Dogma. RNAi: A translation regulation mechanism.

Cell Culture Experiments

RayBio Creatine Kinase (CK) Activity Colorimetric Assay Kit

Comprehensive mirna Research Technologies

Essentials of Real Time PCR. About Sequence Detection Chemistries

KMS-Specialist & Customized Biosimilar Service

Mir-X mirna First-Strand Synthesis Kit User Manual

RNA Structure and folding

ELISA BIO 110 Lab 1. Immunity and Disease

User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube

DP419 RNAsimple Total RNA Kit. RNAprep pure Series. DP501 mircute mirna Isolation Kit. DP438 MagGene Viral DNA / RNA Kit. DP405 TRNzol Reagent

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

Control of Gene Expression

Animal Cell Culture. Third Edition. A Practical Approach OXJORD VNIVVRSITY 1'RVSS

PROTOCOL. Immunocytochemistry (ICC) MATERIALS AND EQUIPMENT REQUIRED

Creatine Kinase Activity Colorimetric Assay Kit ABE assays; Store at -20 C

Molecular Cloning, Product Brochure

Biosafety considerations of new dsrna molecules

Technical Note: Analysis of microrna function using mircury LNA TM microrna Inhibitors

Transcription:

TOOLS sirna and mirna User guide

Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas) are short, double-stranded RNA molecules that bind specific messenger RNA (mrna) molecules and decrease their activities by preventing an mrna from producing a protein. TOOLS sirna oligos undergo vigorous process monitoring and strict quality control, produce under ISO9000 quality standard system. Chemical Modified sirna exhibits greater longevity in cell culture and stability in cell culture and in serum, enhancing the ability for this to be used for in vivo applications and has much more extensional effective time than Standard sirna. TOOLS in vitro/vivo mirna mimics inhibitors are chemically-modified and optimized nucleic acids designed to specifically target the microrna (mirna) molecules in animals. Endogenous micrornas are small, regulatory RNAs that are expressed in animals and plants that affect the translation of target mrnas. The mature 17-24 nucleotide, single-stranded mirnas specifically target a protein complex to regulate translation at the level of mrna. Specifications Products (1 OD) sirna mirna mimics mirna inhibitor nmol 2.5 2.5 5 Molecular weight ~13300 ~13300 ~6500 weight 33 ug 33 ug 33 ug Concentration 20 um (20 pmol/ul) 20 um (20 pmol/ul) 20 um (20 pmol/ul) (when adding 125 ul H 2O) (when adding 125 ul H 2O) (when adding 250 ul H 2O) 1

Ordering information sirna In vitro sirna or chemically-modified sirna In vivo sirna or chemically-modified sirna Negative Control sirna FAM Negative Control sirna Positive Control sirna sirna set (Guaranteed >70% knock-down in mrna level) 3 x 1OD target sirna 1 x 0.5OD negative control sirna 1 x 0.5OD FAM labeled negative control sirna 1 x 0.5OD positive control sirna Chemically-modified sirna set(guaranteed >70% knock-down in mrna level) 3 x 1OD Chemically-modified target sirna 1 x 0.5OD negative control sirna 1 x 0.5OD FAM labeled negative control sirna 1 x 0.5OD positive control sirna 2OD/4OD/8OD 1OD 1OD 1OD mirna mimics & inhibitors In vitro mirna mimics In vitro mirna mimics negative control In vitro chemically-modified mirna inhibitor In vitro chemically-modified mirna inhibitor negative control In vivo chemically-modified mirna mimics In vivo chemically-modified mirna inhibitor In vivo mirna mimics & inhibitor negative control 2OD/4OD 2OD 2OD/4OD 2OD 2

sirna transfection guide: Cell Culture Before Transfection It is advised that before starting your transfection experiment, put your cells on your cell plate, then add proper culture medium, lastly incubate cells for 24 hrs to be 70%-90% by confluence. Transfection reagent: TOOLSoothFect transfection reagent (Cat.No. NFT-KA00) Culture vessel Surface Area (mm 2 /well) Cell Density Volume of plating Medium(ul/well) 96-well 50 1.5 x 10 4-5.0 x 10 4 100 ul 48-well 100 3.0 x 10 4-1.0 x 10 5 200 ul 24-well 200 8.0 x 10 4-2.0 x 10 5 500 ul 12-well 401 1.6 x 10 5-4.0 x 10 5 1.0 ml 6-well 962 3.0 x 10 5-8.0 x 10 5 2.0 ml 35 mm 962 3.0 x 10 5-8.0 x 10 5 2.0 ml 60 mm 2827 1.0 x 10 6-2.5 x 10 6 6.0 ml Culture vessel sirna Volume of plating Transfection reagent mediun (ul/well) 96-well 5 pmol 100ul 0.25 ul 24-well 20 pmol 500ul 1 ul 12-well 40 pmol 1ml 2 ul 6-well 100 pmol 2ml 5 ul 35 mm 100 pmol 2ml 5 ul 60 mm 600 pmol 5ml 10 ul mirna mimics or inhibitor transfection guide: mirna Culture Dish Transfection reagent (mimics or inhibitor) Cell density (cells/well) Final volume (per well) 96-well 0.2-0.6 ul 3 pmol 6000 0.1 ml 24-well 0.5-2 ul 15 pmol 40000 0.5 ml 12-well 1-3 ul 30 pmol 80000 1 ml 6-well 2-5 ul 75 pmol 200000 2.5 ml 3

In vivo sirna delivery guide: Delivery route (dissolve in vivo sirna in PBS or RNase free water or OptiMEM) Intravenous Intraperitoneal Intracranial Systemic delivery dosage: 0.15-0.2 nmol/g body weight Mice (body weight 15-20g): 3-4 nmol (40-50ug) Rat (body weight 150-200g): 30-40 nmol (400-500ug) A sirna dose of 5mg/kg/day is recommended as a starting point for experiments. In vivo mirna (mimics or inhibitor) delivery guide: Delivery route (dissolve in vivo mirna in PBS or normal saline:) Intravenous Intraperitoneal Intracranial 5-80ug/g body weight or 200nmol(3 times) Local delivery: 1-10nmol(0.5-4OD), volume: 30ul~100ul; TOOLS mirna modification example: hsa-mir-137 agomirs sense : 5' UUAUUGCUUAAGAAUACGCGUAG 3' antisense: 5' AsCsGCGUAUUCUUAAGCAAUAsAsUsUs-Chol- 3' Storage Store TOOLS sirna or mirna at 20 C 4

sirna or mirna FAQs : What is the best method of delivering sirnas into the cell? There are several methods that are used for delivering sirnas into cells including lipid-based transfection, electroporation, calcium phosphate co-precipitation, microinjection and vector delivery techniques. The choice between these methods is often a result of several factors including the ability of the cells to tolerate the delivery method, susceptibility to viral infection, and the growth properties of the cells. Although lipid-based transfection is one of the more commonly used methods for adherent cells, suspension cells are often more difficult to transfect and generally have higher rates of delivery with electroporation techniques. Is there a quick method for monitoring transfection efficiency? TOOLS has developed several options including a family of fluorescent-labeled sirnas and a novel RNA-based reagent known as sirna transfection Control. The uptake of sirnas can be visualized with the appropriate filters on a confocal microscope or by flow cytometry. Alternatively, fluorescent-labeled sirna is cytotoxic when successfully delivered into cells. Cells that have efficiently taken up this transfection control typically undergo apoptosis within 24 to 48 hours. This phenotypic outcome can easily be monitored using standard cell viability methods (e.g., alamarblue, MTT cytotoxicity, Trypan Blue dye exclusion, JC1 dye, or other appropriate assays). What is the best time-frame for monitoring sirna-dependent decreases in target mrna expression levels? In target protein levels? Generally, target mrna levels are decreased after 24 hours post-transfection following transfection of a gene-specific sirna duplex. However, maximal silencing may be reached at a later time point, so it is advisable to assay target mrna in a time-course study. In most cases, silencing will be maximal at 24 to 48 hours following transfection. Cellular target protein levels should be examined starting at 24 hours and assayed until a minimum level is noted, often 48 to 96 hours or greater. As always, it is important to verify transfection efficiency using an appropriate positive control. If there is no decrease in protein levels within this time frame, it may be necessary to perform a second sirna transfection, use a stabilized sirna, or develop a vector-based silencing cassette that can continuously produce the sirna for extended periods of time. 5