Biological Stability and Activity of sirna in Ionic Liquids**
|
|
|
- Randolf Webster
- 10 years ago
- Views:
Transcription
1 Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Supporting Information Biological Stability and Activity of sirna in Ionic Liquids** Romiza R. Mazid a, Upulie Divisekara a, Wenjuan Yang a, R. Vijayaraghavan b, Douglas R. MacFarlane b, Christina Cortez-Jugo c, Wenlong Cheng a, * a Department of Chemical Engineering, Monash University, Clayton 3800, VIC, Australia b School of Chemistry, Monash University, Clayton 3800, VIC, Australia c Department of Mechanical and Aerospace Engineering Engineering, Monash University, Clayton 3800, VIC, Australia Contents 1 Experimental Procedures sirna sequence Additional Results sirna degradation mechanism Time Lapse Profile of RNase A concentration on CD45 sirna in PBS, 20% IL and 50% IL Time Lapse Degradation Profile of egfp sirna in PBS, 20% IL and 50% IL Melting Temperature Curves References S
2 1 Experimental Procedures Materials: CD45 sirna, phosphate buffered saline (PBS) tablets, acrylamide/bisacrylamide 40% (19:1) and ammonium persulfate were purchased from Sigma Aldrich. egfp sirna, 10 x Tris-Borate-EDTA, ultrapure N,N,N,N -tetramethylethylenediamine (TEMED), Dulbecco Modified Eagle medium (DMEM), Fetal Calf Serum (FCS), Optimem, RNAiMAX, alamarblue reagent and Hanks Balanced Salt Solution (HBSS) were purchased from Life Technologies. The sirna ladder, microrna marker and 4x loading dye were purchased from New England Biolabs care of Genesearch. The mirna-21-mer was from Trilink Biotechnologies and a kind gift from Dr Lillian Lee, RMIT University, Melbourne. Choline dihydrogen phosphate (CDP) and the buffered ionic liquid (IL) were respectively prepared as per the literature procedure 1-3. Further dilutions of the CDP- IL were carried out with water to achieve final compositions of 50% (w/w) IL and 20%(w/w) IL. Hela egfp cells were purchased from CellBiolabs. Cell Culturing: The activity of egfp sirna after storing it in 20% (w/) IL and 50% (w/w) IL was examined. Typically, HeLa GFP cells were plated in a 48 well plate with cells/well in DMEM with 10% FCS. The cells were incubated at 37 o C with 5% CO 2 and grown for 24 hours. HeLa egfp cells were then transfected with egfp sirna (15 pmole sirna per well) according to the manufacturer s instructions (for Lipofectamine) and incubated for 48 hours. To measure cytotoxicity, an identical plate was prepared and following the 48 h incubation, alamarblue was added according to the manufacturer s instructions. HBSS was used instead of media and the plate was read 24 h after alamarblue addition. Gel Electrophoresis: All gel making and running apparatus was purchased from Bio-Rad. Native polyacrylamide gel electrophoresis (PAGE) and 7M urea polyacrylamide gel electrophoresis, was used to qualitatively determine the stability of sirna. The gels were prepared using short plates and spacer plates assembled in a gel cassette assembly system before securing it in a casting stand and immediately after pouring the gel a 10 well comb was inserted. The gels were left to polymerize for at least an hour before usage and if necessary stored at 4 o C for up to one week maximum. The gels were used to run the sirna samples in a Mini-PROTEAN Tetra cell using a PowerPac. Urea PAGE, the gels were run for 15 minutes prior to loading to heat the gel. All gels were run at 70V for 75 minutes for as the loading dye approached the end of the gel. 2S
3 Following the run, the gels were stained with 1x SYBR Safe prepared in 1 X TBE for 20 minutes. Once stained, gels were visualised using a Molecular Imager Gel Doc XR System with Quantity One software. UV-Vis Spectroscopy: The melting temperature curves for egfp sirna were measured using a Cary UV-VIS, controlled by a thermostat and using a thermal package. egfp sirna was prepare at 1 µm in its respective buffer and heated to 95 o C for three minutes before slowly cooling to room temperature and conducting the measurements. The absorbance was measured using a wavelength of 275 nm, with a slit average of 2 nm, at an average time of 0.2 s and ramping at 1 o C/min. The thermal package was then used to derive the 1 st derivative, and conduct the two state process for van t Hoff s model. The raw data measured was smoothed using a 25 pt algorithm using OriginPro 8. Flow Cytometry: egfp gene knockdown was determined by flow cytometry. Following a 48 hour transfection with egfp sirna, HeLa egfp cells were trypsinized, washed three times in PBS before resuspending in PBS with 2% FCS. The samples were kept on ice and analysed by flow cytometry on a BD FACS Calibur. Data was analysed using Flow Jo V10. Just prior to analysis by flow cytometry, propidium iodide was added to stain dead cells. Circular Dichroism Spectroscopy: The sirna samples were prepared at stock concentrations and degraded at 37 o C for 1 hour before diluting the solution to 1.5 µm to measure on the circular dichrosim (CD) spectrometer. The samples were run from 200 nm to 350 nm and an accumulation of three measurements, per sample was obtained. The resulting data was smoothed by a 25 pt algorithm using OriginPro 8. 3S
4 2 sirna sequence CD45 sirna duplex 5'dTdTCUGGCUGAAUUUCAGAGCA3' 3'GACCGACUUAAAGUCUCGUdTdT5' mirna-21-mer 5'UAGCUUAUCAGACUGAAGUUGA3' 4S
5 3 Additional Results 3.1 sirna degradation mechanism Figure S1 below illustrates both CD45 sirna and egfp sirna profiles in 10% native PAGE and 12% urea PAGE (7 M). In order to help identify the double stranded and single stranded sirna as well as the effect of CDP-IL on the sirna under denaturing conditions. Evidently the CDP-ILs is also able to restrict the destabilization of double stranded sirna as less single stranded sirna can be seen upon increasing amount of IL in Figure S1 (b) and (d). Figure S1: Degradation mechanism of CD45 sirna and egfp sirna profiled. CD45 sirna (a) Native PAGE (b) Urea PAGE and egfp sirna (c) Native PAGE and (d) Urea PAGE. The positive denotes denaturing heat treatment at 95 o C for 5 minutes and the negative denotes no heat treatment. 5S
6 3.2 sirna degradation kinetics Figure S2 below shows CD45 sirna in 12% urea PAGE (7 M). After the four hours there is primarily single stranded CD45 sirna remaining. Figure S2: Degradation kinetics of CD45 sirna on native PAGE gels. (a) 20% IL (b) 50% IL. 0h denotes no treatment with RNase A. 21mer single-stranded mirna sizer marker was loaded into the last lanes of both gels. 6S
7 3.3 Time Lapse Profile of RNase A concentration on CD45 sirna in PBS, 20% IL and 50% IL Figure S2 below is a continuation of Figure 2 in the main text over a period of almost 4 months. The concentration of RNase A is 0.25mg/ml, 0.5 mg/ml, 1 mg/ml and 2 mg/ml. Figure S3: Degradation profile of CD45 sirna in PBS, 20% (w/w) IL and 50% (w/w) IL. Native gel electrophoresis images of stock samples treated with RNase A on Day 0 for 1 hour at 37 o C and thereafter an aliquot was taken for the following days from the same stock at: a) Day 0; b) Day 13; c) Day 55; d) Day 97; e) 111 of incubation. 7S
8 3.4 Time Lapse Degradation Profile of egfp sirna in PBS, 20% IL and 50% IL Native PAGE gels were run periodically over a long period of time to investigate the stability of egfp sirna. The sirna was treated with 1 mg/ml of RNase A for 1 hour at 37 o C on Day 3 in PBS, 20% (w/w) IL and 50% (w/w) IL. Figure S4: Degradation profile of egfp sirna in PBS, 20% (w/w) IL and 50% (w/w) IL. Native PAGE images of stock samples treated with RNase on Day 0 for 1 hour at 37 o C and thereafter an aliquot was taken for the following days from the same stock at: a) Day 0; b) Day 3; c) Day 9; d) Day 28; e) Day 63; and f) Day 98 of incubation. 8S
9 3.5 Melting Temperature Curves Melting temperature curves were run on a Cary UV-Vis with a 6 cell Peltier. The peak of the sirna in each buffer was first determined before the melting temperature was run at a slit of 2 nm and average time of 0.2 s. Each sample was run in triplicates before conducting thermodynamic analysis. Figure S5: Melting Temperature profile of egfp sirna in PBS, 20% (w/w) IL and 50% (w/w) IL. 9S
10 4 References 1. K. Fujita, D. R. MacFarlane and M. Forsyth, Chemical communications, 2005, R. Vijayaraghavan, B. Thompson, D. MacFarlane, R. Kumar, M. Surianarayanan, S. Aishwarya and P. Sehgal, Chem. Commun., 2009, 46, D. R. MacFarlane, R. Vijayaraghavan, H. N. Ha, A. Izgorodin, K. D. Weaver and G. D. Elliott, Chemical Communications, 2010, 46, S
Northern blot analysis for microrna. (Narry Kim s lab)
Northern blot analysis for microrna (Narry Kim s lab) Materials 1. 10~50 μg of total RNA extracted from HeLa cells treated with sirna 2. RNA loading buffer 3. Probe: DNA oligonucleotide complementary to
TOOLS sirna and mirna. User guide
TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)
Instructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control
is a is a state of the art transfection reagent, specifically designed for the transfer of sirna and mirna into a variety of eukaryotic cell types. is a state of the art transfection reagent, specifically
In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab)
In vitro analysis of pri-mirna processing by Drosha-DGCR8 complex (Narry Kim s lab) 1-1. Preparation of radiolabeled pri-mirna transcript The RNA substrate for a cropping reaction can be prepared by in
Running protein gels and detection of proteins
Running protein gels and detection of proteins 1. Protein concentration determination using the BIO RAD reagent This assay uses a colour change reaction to give a direct measurement of protein concentration.
Denaturing Gradient Gel Electrophoresis (DGGE)
Laboratory for Microbial Ecology Department of Earth, Ecological and Environmental Sciences University of Toledo Denaturing Gradient Gel Electrophoresis (DGGE) Background information Denaturing gradient
Real-time monitoring of rolling circle amplification using aggregation-induced emission: applications for biological detection
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 215 Supplementary Information Real-time monitoring of rolling circle amplification using aggregation-induced
RPCI 004 v.002 Staining Procedure For all Directly Conjugated Reagents (Whole Blood Method)
Immune Tolerance Network RPCI 004 v.002 Staining Procedure For all Directly Conjugated Reagents (Whole Blood Method) Author: Paul Wallace, Director, RPCI Laboratory of Flow Cytometry Approved by: Paul
Western Blotting: Mini-gels
Western Blotting: Mini-gels Materials a Protein Extraction Buffer (for callus or kernel), Solution Stock Final Volume Tris-HCl ph 80 1 M 200 mm 20 ml NaCl 4 M 100 mm 25 ml Sucrose 2 M 400 mm 20 ml EDTA
Troubleshooting Guide for DNA Electrophoresis
Troubleshooting Guide for Electrophoresis. ELECTROPHORESIS Protocols and Recommendations for Electrophoresis electrophoresis problem 1 Low intensity of all or some bands 2 Smeared bands 3 Atypical banding
SDS-PAGE. (June 23, 2005)
SDS-PAGE (June 23, 2005) GATHER REAGENTS & MATERIALS 30% acrylamide/0.8% bisacrylamide (30:1) 4X Tris. Cl/SDS, ph 8.8 4X Tris. Cl/SDS, ph 6.8 Ammonium persulfate, 10% (Make fresh each time.) SDS electrophoresis
STANDARD OPERATING PROCEDURE
STANDARD OPERATING PROCEDURE Title: Evaluation using Western Blot SOP#: M-103 Version #: 1 Author: R. Saul Date Approved: Feb. 5, 2009 Date Modified: 1. PURPOSE The purpose of this document is to describe
INTERFERin in vitro sirna/mirna transfection reagent PROTOCOL. 1 Standard sirna transfection of adherent cells... 2
INTERFERin in vitro sirna/mirna transfection reagent PROTOCOL DESCRIPTION INTERFERin is a powerful sirna/mirna transfection reagent that ensures efficient gene silencing and reproducible transfection in
EZ-Run Protein Gel Solution. EZ-Run Protein Standards. EZ-Run Gel Staining Solution. Traditional SDS-Page Reagents. Protein Electrophoresis
EZ-Run Protein Gel Solution EZ-Run Protein Standards EZ-Run Gel Staining Solution Traditional SDS-Page Reagents Protein Electrophoresis protein electrophoresis Introduction Sodium dodecyl sulfate polyacrylamide
Cloning GFP into Mammalian cells
Protocol for Cloning GFP into Mammalian cells Studiepraktik 2013 Molecular Biology and Molecular Medicine Aarhus University Produced by the instructors: Tobias Holm Bønnelykke, Rikke Mouridsen, Steffan
Supporting Information. The G-triplex DNA could function as a new variety of DNA peroxidase
Supporting Information The G-triplex DNA could function as a new variety of DNA peroxidase Shaoru Wang +, Boshi Fu +, Shuang Peng, Xiaoe Zhang, Tian Tian*, Xiang Zhou* College of Chemistry and Molecular
Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides
Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides Polyacrylamide gel electrophoresis (PAGE) and subsequent analyses are common tools in biochemistry and molecular biology. This Application
Introduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
DNA Separation Methods. Chapter 12
DNA Separation Methods Chapter 12 DNA molecules After PCR reaction produces many copies of DNA molecules Need a way to separate the DNA molecules from similar sized molecules Only way to genotype samples
Objectives: Vocabulary:
Introduction to Agarose Gel Electrophoresis: A Precursor to Cornell Institute for Biology Teacher s lab Author: Jennifer Weiser and Laura Austen Date Created: 2010 Subject: Molecular Biology and Genetics
MEF Starter Nucleofector Kit
page 1 of 7 MEF Starter Nucleofector Kit for Mouse Embryonic Fibroblasts (MEF) MEF display significant phenotypic variations which depend on the strain, the genetic background of the mice they are isolated
Transformation Protocol
To make Glycerol Stocks of Plasmids ** To be done in the hood and use RNase/DNase free tips** 1. In a 10 ml sterile tube add 3 ml autoclaved LB broth and 1.5 ul antibiotic (@ 100 ug/ul) or 3 ul antibiotic
How To Make A Molecular Encoder And Decoder
Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Supporting information Molecular Encoder - Decoder Based on Assembly of Graphene with Dye-labeled
Hoechst 33342 HSC Staining and Stem Cell Purification Protocol (see Goodell, M., et al. (1996) J Exp Med 183, 1797-806)
Hoechst 33342 HSC Staining and Stem Cell Purification Protocol (see Goodell, M., et al. (1996) J Exp Med 183, 1797-86) The Hoechst purification was established for murine hematopoietic stem cells (HSC)
User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube
User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally
ArC Amine Reactive Compensation Bead Kit
ArC Amine Reactive Compensation Bead Kit Catalog no. A1346 Table 1. Contents and storage information. Material Amount Composition Storage Stability ArC reactive beads (Component A) ArC negative beads (Component
SDS-PAGE Protocol Mutated from the SDS-PAGE protocol written by the Lord of the Flies
SDS-PAGE Protocol Mutated from the SDS-PAGE protocol written by the Lord of the Flies Pouring the resolving gel 1. Clean glass plates with soap and water, then with ethanol. Assemble the glass plates and
protocol handbook 3D cell culture mimsys G hydrogel
handbook 3D cell culture mimsys G hydrogel supporting real discovery handbook Index 01 Cell encapsulation in hydrogels 02 Cell viability by MTS assay 03 Live/Dead assay to assess cell viability 04 Fluorescent
MEF Nucleofector Kit 1 and 2
page 1 of 7 MEF Nucleofector Kit 1 and 2 for Mouse Embryonic Fibroblasts (MEF) MEF display significant phenotypic variations which depend on the strain, the genetic background of the they are isolated
Southern Blot Analysis (from Baker lab, university of Florida)
Southern Blot Analysis (from Baker lab, university of Florida) DNA Prep Prepare DNA via your favorite method. You may find a protocol under Mini Yeast Genomic Prep. Restriction Digest 1.Digest DNA with
Optimized Protocol sirna Test Kit for Cell Lines and Adherent Primary Cells
page 1 of 8 sirna Test Kit for Cell Lines and Adherent Primary Cells Kit principle Co-transfection of pmaxgfp, encoding the green fluorescent protein (GFP) from Pontellina p. with an sirna directed against
ab139418 Propidium Iodide Flow Cytometry Kit for Cell Cycle Analysis
ab139418 Propidium Iodide Flow Cytometry Kit for Cell Cycle Analysis Instructions for Use To determine cell cycle status in tissue culture cell lines by measuring DNA content using a flow cytometer. This
Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus
Protein extraction from Tissues and Cultured Cells using Bioruptor Standard & Plus Introduction Protein extraction from tissues and cultured cells is the first step for many biochemical and analytical
METHOD USED TO EXTRACT TOTAL MUSCLE PROTEIN FOR WESTERN BLOT USING TRIS-EDTA BUFFER*
METHOD USED TO EXTRACT TOTAL MUSCLE PROTEIN FOR WESTERN BLOT USING TRIS-EDTA BUFFER* SOLUTIONS FOR SAMPLE EXTRACTION 1. Tris-EDTA Buffer, ph 8.3 1 liter 50 mm Tris 6.06 g 10 mm EDTA 3.72 g Adjust ph to
Western Blotting For Protein Analysis
Western Blotting For Protein Analysis Part 1: Laemmli Gel Electrophoresis Using Mini-PROTEAN II Electrophoresis Cell Note: Powder-free gloves should be worn throughout the entire procedure. A. Preparing
Plant Genomic DNA Extraction using CTAB
Plant Genomic DNA Extraction using CTAB Introduction The search for a more efficient means of extracting DNA of both higher quality and yield has lead to the development of a variety of protocols, however
Cell Cycle Phase Determination Kit
Cell Cycle Phase Determination Kit Item No. 10009349 Customer Service 800.364.9897 * Technical Support 888.526.5351 www.caymanchem.com TABLE OF CONTENTS GENERAL INFORMATION 3 Materials Supplied 3 Safety
EdU Flow Cytometry Kit. User Manual
User Manual Ordering information: (for detailed kit content see Table 2) EdU Flow Cytometry Kits for 50 assays: Product number EdU Used fluorescent dye BCK-FC488-50 10 mg 6-FAM Azide BCK-FC555-50 10 mg
Especially developed for the transfection of mammalian cells with sirna or mirna
METAFECTENE SI Especially developed for the transfection of mammalian cells with sirna or mirna For ordering information, MSDS, publications and application notes see www.biontex.com Description Cat. No.
DNA Electrophoresis Lesson Plan
DNA Electrophoresis Lesson Plan Primary Learning Outcomes: Students will learn how to properly load a well in an agarose gel. Students will learn how to analyze the results of DNA electrophoresis. Students
Mouse ES Cell Nucleofector Kit
page 1 of 7 Mouse ES Cell Nucleofector Kit for Mouse Embryonic Stem Cells Cell type Origin Cells derived from mouse blastocysts. Morphology Round cells growing in clumps. Important remarks! 1. This protocol
HiPerFect Transfection Reagent Handbook
Fifth Edition October 2010 HiPerFect Transfection Reagent Handbook For transfection of eukaryotic cells with sirna and mirna Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the
RAGE. Plugs for RAGE/PFGE
1 RAGE Rotating Field Gel Electrophoresis (RAGE) is a variation on Pulsed Field Gel Electrophoresis (PFGE) and gives similar results. We use equipment that was only briefly marketed by Stratagene, at far
Proto col. GoClone Repor ter Construc ts: Sample Protocol for Adherent Cells. Tech support: 877-994-8240. Luciferase Assay System
Luciferase Assay System Proto col GoClone Repor ter Construc ts: Sample Protocol for Adherent Cells LightSwitch Luciferase Assay System GoClone Reporter Assay Workflow Step 1: Seed cells in plate format.
PROTOCOL. Immunocytochemistry (ICC) MATERIALS AND EQUIPMENT REQUIRED
PROTOCOL Immunocytochemistry (ICC) 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 11-07 MATERIALS AND EQUIPMENT REQUIRED Materials: MitoSciences primary monoclonal antibody/antibodies Fluorophore-conjugated
Updated: July 2005. 5' End label RNA markers 18.113 (18mer) and 44.12 (24mer) with Kinase and 32P-gamma-ATP. Gel purify labeled markers.
RNA Cloning Method Flowchart Extract total RNA containing small RNAs. Check quality on denaturing gel with EtBr staining 5' End label RNA markers 18.113 (18mer) and 44.12 (24mer) with Kinase and 32P-gamma-ATP.
EVALUATION OF THE EFFECT OF THE COMPOUND RIBOXYL ON THE ATP LEVEL AND CELLULAR RESPIRATION FROM HUMAN DERMAL FIBROBLASTS
EVALUATION OF THE EFFECT OF THE COMPOUND RIBOXYL ON THE ATP LEVEL AND CELLULAR RESPIRATION FROM HUMAN DERMAL FIBROBLASTS FINAL REPORT OF THE STUDY GT050923 Study promoter: LUCAS MEYER COSMETICS ZA Les
SmartFlare RNA Detection Probes: Principles, protocols and troubleshooting
Technical Guide SmartFlare RNA Detection Probes: Principles, protocols and troubleshooting Principles of SmartFlare technology RNA detection traditionally requires transfection, laborious sample prep,
Electrophoresis and Electroblotting of Proteins
Electrophoresis and Electroblotting of Proteins The purpose of the next lab exercises will be to study the relative amounts of β-actin in cells of the B-16 melanoma, liver and muscle of mice. Electrophoresis
Human serum albumin (HSA) nanoparticles stabilized with. intermolecular disulfide bonds. Supporting Information
Human serum albumin (HSA) nanoparticles stabilized with intermolecular disulfide bonds Wentan Wang, Yanbin Huang*, Shufang Zhao, Ting Shao and Yi Cheng* Department of Chemical Engineering, Tsinghua University,
BUFFERS and MEDIAS Coomassie Blue Staining Solution Coomassie blue Destaining Solution DMEM Normal Cell Culture Media
BUFFERS and MEDIAS Coomassie Blue Staining Solution 2 g Coomassie Blue 2 L Methanol or Ethanol * 1.6 L 400 ml Glacial acetic acid *If you will be microwaving the gel in staining solution for rapid staining
Protocol Micro Lab. K:\Microlab_protocols\Protocols_active\03 Instrument manuals\ml03_001_001 DGGE.doc. Preparation of gels
Preparation of gels Cautions: Wear gloves all times when handling acryl amide and form amide solutions and all work with acryl amide and form amide has to be done in a flow hood. Acryl amide is very toxic.
MTT Cell Proliferation Assay
ATCC 30-1010K Store at 4 C This product is intended for laboratory research purposes only. It is not intended for use in humans, animals or for diagnostics. Introduction Measurement of cell viability and
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
Glycolysis Cell-Based Assay Kit
Glycolysis Cell-Based Assay Kit Item No. 600450 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION
DNA Integrity Number (DIN) For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments
DNA Integrity Number () For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments Application Note Nucleic Acid Analysis Author Arunkumar Padmanaban Agilent Technologies,
HARVESTING AND CRYOPRESERVATION OF HUMAN EMBRYONIC STEM CELLS (hescs)
HARVESTING AND CRYOPRESERVATION OF HUMAN EMBRYONIC STEM CELLS (hescs) OBJECTIVE: can be cryopreserved in a liquid nitrogen (LN 2 ) freezer for long-term storage. This Standard Operating Procedure (SOP)
MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C
microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr
Measuring Cell Viability/Cytotoxicity: Cell Counting Kit-F
Introduction The Cell Counting Kit-F is a fluorometic assay for the determination of viable cell numbers. Calcein-AM in this kit passes through the cell membrane and is hydrolized by the esterase in the
Troubleshooting Polyacrylamide Gel Electrophoresis (PAGE)
PIPET TIPS Troubleshooting The IDT gel electrophoresis group runs preparatory polyacrylamide gels to purify certain oligonucleotides and can run up to 500 gels a day based on demand. Running that many
PROTOCOL 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 www.mitosciences.com
PROTOCOL Western Blotting Transfer and Detection Procedure 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 02-11 DESCRIPTION Western Blotting Transfer and Detection Procedure ADDITIONAL MATERIALS REQUIRED
Technical Note. Roche Applied Science. No. LC 19/2004. Color Compensation
Roche Applied Science Technical Note No. LC 19/2004 Purpose of this Note Color The LightCycler System is able to simultaneously detect and analyze more than one color in each capillary. Due to overlap
2D gel electrophoresis
2D gel electrophoresis Required solutions Cathode buffer: TRIS 7.6g Glycine 36g SDS 2.5g Fill up with ddwater to 250ml ESS (equilibration stock solution) SDS 2g Urea 36g EDTA 3mg 50 mm TRIS-HCl ph 6.8
Radius 24-Well Cell Migration Assay (Laminin Coated)
Product Manual Radius 24-Well Cell Migration Assay (Laminin Coated) Catalog Number CBA-125-LN 24 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction Cell migration is a highly
CHRISTIAN LAB WESTERN BLOT PROTOCOL
CHRISTIAN LAB WESTERN BLOT PROTOCOL There is actually 2 parts to a western blot: A. SDS-PAGE: Separates protein by size. Smaller proteins migrate faster through the gel than larger proteins. Size separation
The cell lines used in this study were obtained from the American Type Culture
Supplementary materials and methods Cell culture and drug treatments The cell lines used in this study were obtained from the American Type Culture Collection (ATCC) and grown as previously described.
CFSE Cell Division Assay Kit
CFSE Cell Division Assay Kit Item No. 10009853 Customer Service 800.364.9897 * Technical Support 888.526.5351 www.caymanchem.com TABLE OF CONTENTS GENERAL INFORMATION 3 Materials Supplied 4 Precautions
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination
Section III: Loading and Running DNA in Agarose Gels
Section III: In This Section DNA Loading 90 Loading Buffers 91 Optimal Voltage and Electrophoretic Times 92 Fast Running Protocols for High Resolution in MetaPhor Agarose Gels 93 References 94 89 Section
Standard Operating Procedure
1.0 Purpose: 1.1 The characterisation of of main leukocyte subsets in peripheral blood cells from mice by flow cytometry. Reliable values of frequencies of leukocyte clusters are very much dependent on
The Techniques of Molecular Biology: Forensic DNA Fingerprinting
Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins
Biochemistry Lab SDS PAGE and Western blot General Instructions
Background When an electrical field is applied across a solution, the movement of the charged particles (proteins) is influenced not only by the charge but also the voltage, distance between electrodes,
Manual for: sirna-trans Maximo Reagent
Manual for: sirna-trans Maximo Reagent Contact: [email protected]; www.geneon.net GeneON GmbH Germany GeneON GmbH / Protocol sirna-trans reagent vs. 1.3 / www.geneon.net / - 0 - sirna-trans reagent Instruction
AGAROSE GEL ELECTROPHORESIS:
AGAROSE GEL ELECTROPHORESIS: BEST PRACTICES (BACK TO THE BASICS) Unit of Tropical Laboratory Medicine April 2009 Marcella Mori WORKFLOW OF AGAROSE GEL ELECTROPHORESIS: THREE STEPS Agarose gel electrophoresis
7 Electrophoresis. µ proportional to Q
7 Electrophoresis Objectives: A) To perform agarose gel electrophoresis of the proteins isolated in last week's experiment and B) to interpret the banding patterns produced by these proteins. Introduction:
RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl
Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl
Product name Company Cat # PowerPac Basic Power supply Bio Rad 165-6019 Mini Protean electrophoresis system Mini trans blot cell Bio Rad 170-3930
SDS-PAGE and western blot for low molecular weight proteins (2-20kDa) Merav Marom Shamur, Smart Assays Aim: Analysis of low molecular weight proteins by SDS-PAGE and western blot under reducing conditions.
1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.
Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,
Recipes for Reagents and Stock Solutions
The success of the laboratories depends on the use of high-quality reagents. Follow the recipes with care and pay attention to cleanliness. Use a clean spatula for each ingredient or carefully pour each
Covalent Conjugation to Cytodiagnostics Carboxylated Gold Nanoparticles Tech Note #105
Covalent Conjugation to Cytodiagnostics Carboxylated Gold Nanoparticles Tech Note #105 Background Gold nanoparticle conjugates have been widely used in biological research and biosensing applications.
VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10
Topic J10+11: Molecular-biological methods + Clinical virology I (hepatitis A, B & C, HIV) To study: PCR, ELISA, your own notes from serology reactions Task J10/1: DNA isolation of the etiological agent
TECHNICAL BULLETIN. HIS-Select Nickel Affinity Gel. Catalog Number P6611 Storage Temperature 2 8 C
HIS-Select Nickel Affinity Gel Catalog Number P6611 Storage Temperature 2 8 C TECHNICAL BULLETIN Product Description HIS-Select Nickel Affinity Gel is an immobilized metalion affinity chromatography (IMAC)
Islet Viability Assessment by Single Cell Flow Cytometry
Islet Viability Assessment by Single Cell Flow Cytometry Page 1 of 8 Purpose: To comprehensively assess the viability of the islet cell preparation prior to transplantation. Tissue Samples: A sample containing
Hydrogen Peroxide Cell-Based Assay Kit
Hydrogen Peroxide Cell-Based Assay Kit Item No. 600050 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION
Developing Protocols of Tricine-SDS-PAGE for Separation of Polypeptides in the Mass Range 1-30 kda with Minigel Electrophoresis System
Int. J. Electrochem. Sci., 11 (2016) 640-649 International Journal of ELECTROCHEMICAL SCIENCE www.electrochemsci.org Developing Protocols of Tricine-SDS-PAGE for Separation of Polypeptides in the Mass
Chapter 14 SDS-PAGE. Objectives
SDS-PAGE This lab will introduce you to SDS-PAGE, a simple and inexpensive method for resolving proteins in complex mixtures. SDS-PAGE gels provide the starting materials for western blots and for some
岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹 20100803
技 術 專 員 費 軫 尹 20100803 Overview of presentation Basic Biology of RNA interference Application of sirna for gene function? How to study mirna? How to deliver sirna and mirna? New prospects on RNAi research
Validating Microarray Data Using RT 2 Real-Time PCR Products
Validating Microarray Data Using RT 2 Real-Time PCR Products Introduction: Real-time PCR monitors the amount of amplicon as the reaction occurs. Usually, the amount of product is directly related to the
Classic Immunoprecipitation
292PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name Classic Immunoprecipitation Utilizes Protein A/G Agarose for Antibody Binding (Cat.
Protocol for Western Blotting
Protocol for Western Blotting Materials Materials used on Day 3 Protease inhibitor stock: 1 μg/μl pepstatin A in DMSO 200 μm leupeptin in OG Buffer 200 mm PMSF: Freshly made. Ex) 34.8 mg PMSF in 1 ml isopropanol
Western Blot Protocol Protein isolation
Western Blot Protocol Protein isolation A. Preparation of cell lysates. - Preparation of materials: -Dial the microcentrifuge temperature control setting to 4 C -Prepare a bucket of ice -Prepare lysis
2. Cut 6 sheets of Whatman 3MM paper and 1 sheet of blotting membrane to the size of the gel, or slightly smaller.
Method for Western Blotting Western Blotting ELECTROPHORESIS Prepare and run an SDS PAGE gel. Select a gel percent which will give the best resolution for the size of antigen being analyzed (if known).
6 Characterization of Casein and Bovine Serum Albumin
6 Characterization of Casein and Bovine Serum Albumin (BSA) Objectives: A) To separate a mixture of casein and bovine serum albumin B) to characterize these proteins based on their solubilities as a function
Fluorescent dyes for use with the
Detection of Multiple Reporter Dyes in Real-time, On-line PCR Analysis with the LightCycler System Gregor Sagner, Cornelia Goldstein, and Rob van Miltenburg Roche Molecular Biochemicals, Penzberg, Germany
Troubleshooting Sequencing Data
Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page
Analysis of Casein and Whey Protein in Whole, 2%, and Skim Milk by Capillary Gel Electrophoresis
Analysis of Casein and Whey Protein in Whole, 2%, and Skim Milk by Capillary Gel Electrophoresis Marcia Santos, Staff Applications Scientist, Beckman Coulter Life Sciences, Brea, CA USA Mark Lies, Marketing
NCL Method ITA-6. Leukocyte Proliferation Assay
NCL Method ITA-6 Leukocyte Proliferation Assay Nanotechnology Characterization Laboratory National Cancer Institute-Frederick SAIC-Frederick Frederick, MD 21702 (301) 846-6939 [email protected] December
UV-VIS VARIAN, INC. Cary 100/300 UV-Vis. S p e c t r o p h o t o m e t e r s
UV-VIS VARIAN, INC. Cary 100/300 UV-Vis S p e c t r o p h o t o m e t e r s Unmatched quality and performance Outstanding performance, flexibility, and ease of use are what you can expect from Varian s
EZ Load Molecular Rulers. Catalog Numbers 170-8351 20 bp 170-8352 100 bp 170-8353 100 bp PCR 170-8354 500 bp 170-8355 1 kb 170-8356 Precision Mass
EZ Load Molecular Rulers Catalog Numbers 170-8351 20 bp 170-8352 100 bp 170-8353 100 bp PCR 170-8354 500 bp 170-8355 1 kb 170-8356 Precision Mass EZ Load Molecular Rulers Quantity DNA sufficient for 100
