Comprehensive mirna Research Technologies
|
|
|
- Bruno Sparks
- 9 years ago
- Views:
Transcription
1 Comprehensive mirna Research Technologies Sample & Assay Technologies
2 QIAGEN solutions for advancing microrna research In the last few years, the identification of microrna (mirna) and the recognition of its important role in regulation of gene expression have led to increasing interest in the identification and characterization of mirnas (1 3). A growing body of evidence suggests that mirnas play a role in many diverse biological processes such as development, differentiation, and apoptosis. Misregulation of mirna expression is reported to be associated with several cancers (1) and other diseases. The mirna system is an endogenous mechanism of regulation of gene expression. mirna precursors are transcribed from genomic DNA in the nucleus. The mature mirnas contribute to the regulation of endogenous genes, primarily by translational repression (see flowchart, opposite). In addition, mirnas can mediate mrna destruction by rapid deadenylation and/or decapping. While sirnas and mirnas act on endogenous mrnas through integration into a multiprotein silencing complex (RISC), sirnas require a perfect match with the targeted mrna, leading to cleavage and subsequent destruction, whereas mirnas are often only partially complementary to target mrnas. Naturally occurring mirna-binding sites are typically found in the 3' untranslated regions (UTRs) of target mrnas. Their partial complementarity has made positive identification of true binding sites difficult and imprecise. To support this exciting new field of research, QIAGEN has introduced innovative mirneasy and miscript technologies for mirna purification and detection. mirneasy Kits (page 4) enable purification of total RNA, including mirnas and other small RNAs, from all types of animal tissues and cells. Small RNAs, including mirna can be enriched in a separate fraction if desired. Using the miscript System (page 6), real-time PCR analysis can be used to detect hundreds of mirnas, as well as mrnas, from a single cdna synthesis reaction. As well as mirnas, knowledge about other classes of small, noncoding RNAs is currently emerging (4). mirneasy Kits and the miscript System have been tested and verified for purification and detection of other noncoding RNAs (e.g., snornas, pirnas). For more details and application data, visit References 1. Cummins, J.M. and Velculescu, V.E. (2006) Implications of micro-rna profiling for cancer diagnosis. Oncogene 25, micrornas supplement (2006) Nature Genetics 38, 6s. 3. Kloosterman, W.P. and Plasterk, R.H. (2006) The diverse functions of micrornas in animal development and disease. Dev. Cell 11, Mattick, J.S. and Makunin, I.V. (2005) Small regulatory RNAs in mammals. Hum. Mol. Genet. 14, R121. Purification Analysis Functional studies mirneasy Mini Kit miscript Reverse Transcription Kit HiPerFect Transfection Reagent* mirneasy 96 Kit miscript SYBR Green PCR Kit Coming soon: miscript Primer Assays mirna Inhibitors mirna Synthesis * Visit for more information. Please inquire for more information about these products. 2 Comprehensive mirna Technologies 04/2007
3 mirna and sirna Pathways sirna Exogenous sirna used as a research tool Perfect complementarity to target mrna Sequence-specific target mrna degradation mirna Endogenous Often partial complementarity to target mrna Translational repression and/or target mrna degradation mirnas are first transcribed in the nucleus as long, primary mirnas (pri-mirna). While still in the nucleus, they are processed into precursor mirnas (pre-mirna) by nuclear Drosha, a dsrna-specific ribonuclease. Pre-miRNAs are subsequently transported from the nucleus into the cytosol by Exportin-5. Dicer (an RNase III-like enzyme) processes the pre-mirnas into ~22 nt mature mirnas that are subsequently incorporated into the RNA-induced silencing complex (RISC). When the RISC identifies the complementary or partially complementary mrna target, it inhibits gene expression by translational repression or by mrna degradation. mirna resources Visit for useful mirna resources including: Protocols Application notes References Background information Links to databases Comprehensive mirna Technologies 04/2007 Sample & Assay Technologies 3
4 mirneasy Mini Kit and mirneasy 96 Kit For effective purification of total RNA including mirna or enrichment of mirna in a separate fraction Effective purification from all types of animal tissues and cells Efficient enrichment of mirna and other small RNAs in a separate fraction High-purity RNA suitable for all downstream applications Flexibility of low-throughput or 96-well formats Purification of total RNA or enrichment of mirna mirneasy Kits enable purification of total RNA which includes RNA from approximately 18 nucleotides (nt) upwards. Alternatively, an mirna-enriched fraction (<200 nt) and a total RNA fraction (>200 nt) can be purified separately (see flowchart). The mirneasy Mini Kit provides low-throughput RNA purification using spin columns. The mirneasy 96 Kit is used for highthroughput purification in a 96-well format. Purified total RNA is suitable for use in downstream applications such as northern blot analysis and quantitative, real-time RT-PCR. Enrichment of small RNAs may provide better results for some applications such as microarray analysis. mirneasy Procedures Copurification of mirna and total RNA Lyse and homogenize Separate purification of mirna-enriched fraction and total RNA* Lyse and homogenize Bind to spin column/plate Bind to spin column/plate Bind flow-through to spin column/plate Elute mirna and total RNA Elute mirna-enriched fraction Elute total RNA (>200 nt) * Separate purification using the mirneasy Mini Kit requires additionally the RNeasy MinElute Cleanup Kit. For separate purification using the mirneasy 96 Kit, an additional RNeasy 96 plate is required. For economical purchase of an additional RNeasy 96 plate, we recommend ordering an RNeasy 96 Kit (see Ordering Information, page 10). 4 Comprehensive mirna Technologies 04/2007
5 Effective purification from animal tissues and cells mirneasy Kits efficiently purify RNA from tissues and cells, even when low amounts of starting material are used. In the results shown in Figure 1, C T values increased linearly when RNA was purified from decreasing amounts of cells or tissue, indicating effective mirna purification from a wide range of amounts of starting material. RNA can be purified from a variety of tissues and cells, including difficultto-lyse tissues (Figure 2). Purification of total RNA including mirna allows direct comparison of mirna expression levels with those of housekeeping reference genes or any other mrna of interest (Figure 2). Figure 2. Efficient copurification from a wide range of tissues. Total RNA including mirna was purified from 25 mg of a range of RNAlater stabilized rat tissues using the mirneasy 96 Kit. Purified RNA was used as a template in quantitative, real-time RT-PCR assays for the mirna mir-16 and for the larger mrna of the PGK1 gene. Results showed successful detection of both PGK1 mrna (large RNA) and mir-16 (small RNA) from the same eluates. A B Figure 1. Effective purification from a range of starting amounts. Total RNA was purified from A Jurkat cells using the mirneasy 96 Kit or B a dilution series of rat lung tissue homogenate from 20 mg to 200 pg tissue equivalent, using the mirneasy Mini Kit. mirna-enriched fractions (<200 nt) were also isolated from the same samples. Purified RNA was used as a template in quantitative, real-time RT-PCR assays for the mirna mir-16. High-purity RNA RNA prepared using mirneasy Kits is highly pure and ready for use in sensitive downstream applications. mirneasy procedures eliminate the possibility of contamination with salts or phenol which could interfere with later analyses (Figure 3). In addition to higher purity, mirneasy Kits offer superior yields to alternative methods of mirna purification such as using TRIzol Reagent (Figure 4). OD mirneasy TRIzol Figure 3. Highly pure RNA without phenol carryover. Total RNA including mirna was purified from 1x10 6 Jurkat cells using the mirneasy Mini Kit or precipitation from TRIzol Reagent. The absorbance spectra showed the OD maximum for RNA purified using the mirneasy Kit was at 260 nm. In contrast, the OD maximum was greater than 260 nm when TRIzol was used for purification, indicating phenol carryover. In addition, the OD 230 measurement was higher in the TRIzolprepared RNA, indicating salt carryover from the TRIzol Reagent. Figure 4. mirneasy Kit outperforms TRIzol. Total RNA including mirna was purified from a range of amounts of Jurkat cells using the mirneasy Mini Kit or precipitation from TRIzol Reagent. Purified RNA was used as a template in quantitative, real-time RT-PCR assays for the mirna mir-16. Results showed that C T values were lower after purification using the mirneasy Kit, indicating that higher amounts of mirna were purified than when using TRIzol. mirna was effectively purified from as little as 1x10 2 cells using the mirneasy Kit. In contrast, no mirna was detected after 40 PCR cycles from 1x10 2 cells when TRIzol was used for purification. Comprehensive mirna Technologies 04/2007 Sample & Assay Technologies 5
6 The miscript System For detection of hundreds of mirnas from a single cdna synthesis reaction using SYBR Green based, real-time PCR Fast, simple quantification of multiple mirnas from a single cdna synthesis reaction reducing variability and saving precious sample Quantification of mirna and mrna from the same cdna synthesis reaction allowing simultaneous detection of reference genes or other mrnas of interest Hundreds of validated and predesigned mirna-specific assays available for human, mouse, and rat via the GeneGlobe Web portal Sensitive and specific detection and quantification of mirna Quantify Hundreds of mirnas from a Single cdna Synthesis Reaction Total RNA from mirneasy Kit (mrna, mirna, & other noncoding RNAs) Reverse transcription using miscript System One cdna miscript Primer Assays Real-time PCR of multiple mirnas Principle of the miscript System The miscript System is a three-component system which covers all the steps of conversion of mirna and mrna into cdna and detection of mirnas in SYBR Green based, real-time PCR. The miscript Reverse Transcription Kit, miscript SYBR Green PCR Kit, and miscript Primer Assay allow sensitive and specific detection and quantification of mirna. The modular system enables detection of individual mirnas of interest using miscript Primer Assays or screening of multiple human, mouse, or rat mirnas using miscript Primer Assay Sets. Alternatively, researcher-designed assays can be used for newly discovered mirnas. For this reason, the three components can be purchased separately. The miscript System comprises the following components: miscript Reverse Transcription Kit This kit enables simple, single-step cdna synthesis. miscript SYBR Green PCR Kit This kit includes the miscript Universal Primer which allows detection of mirnas in combination with an mirna-specific primer. miscript Primer Assay The assay comprises an mirna-specific forward primer which is used in combination with the miscript SYBR Green PCR Kit. 6 Comprehensive mirna Technologies 04/2007
7 miscript Reverse Transcription Kit The miscript Reverse Transcription Kit includes miscript Reverse Transcriptase Mix and miscript RT Buffer. miscript Reverse Transcriptase Mix is an optimized blend of enzymes comprising a poly(a) polymerase and a reverse transcriptase. miscript RT Buffer has been developed specifically for use with miscript Reverse Transcriptase Mix to enable maximum activity of both enzymes. It includes Mg 2+, dntps, oligo-dt primers, and random primers. Unlike mrnas, mirnas are not polyadenylated in nature. During the reverse-transcription step, mirnas are polyadenylated by poly(a) polymerase. In parallel, reverse transcriptase converts both mirna and mrna to cdna (see flowchart, Step 1). The parallel reactions make mirna conversion into cdna a very fast and simple one-tube procedure. The oligo-dt primers carry a universal tag sequence on the 5' end which allows amplification in the real-time PCR step (see flowchart, Step 2). miscript SYBR Green PCR Kit The miscript SYBR Green PCR Kit is based on the proven technology of QuantiTect SYBR Green Kits. The miscript SYBR Green PCR Kit includes QuantiTect SYBR Green PCR Master Mix and the miscript Universal Primer which is specific for the universal tag sequence on the 5' end of the cdna. The cdna serves as the template for real-time PCR analysis using the miscript Primer Assay in combination with the miscript SYBR Green PCR Kit. mirnas are amplified using the miscript Universal Primer together with the mirna-specific primer (the miscript Primer Assay). A single cdna synthesis reaction is sufficient to interrogate hundreds of mirnas by real-time PCR using different miscript Primer Assays, allowing comprehensive expression profiling of known mirnas. The cdna can also be used for detection of mrna using gene-specific primer pairs (instead of the miscript Primer Assay and Universal Primer), allowing simultaneous detection of reference genes, such as GAPDH, or any other mrnas of interest, such as the mrna targeted by a particular mirna (Figure 5). QIAGEN offers QuantiTect Primer Assays for real-time PCR detection of mrna. Figure 5. A single cdna synthesis reaction enables detection of multiple mirnas and mrnas. Total RNA was prepared from HeLa S3 cells using the mirneasy Mini Kit. The miscript System was used for real-time PCR analysis of 4 mirnas (Let-7a, mir-16, mir-21, and mir-25). QuantiTect Primer Assays were used for real-time PCR analysis of 4 mrnas (GAPDH, PPIA, CDC2, and MAPK1). Comprehensive mirna Technologies 04/2007 Sample & Assay Technologies 7
8 miscript Primer Assay miscript Primer Assays are mirna-specific primers used in combination with the miscript SYBR Green PCR Kit for real-time PCR of mirna using SYBR Green detection. The miscript SYBR Green PCR Kit includes the miscript Universal Primer which is necessary for successful amplification. miscript Primer Assays are available in single tubes and can be ordered online from the GeneGlobe Web portal ( ). miscript Primer Assays for the detection of human mirnas have been experimentally validated. miscript Primer Assays for mouse and rat are predesigned and a proportion has been validated. Human, Mouse, or Rat miscript Primer Assay Sets provide assays for >95% of the mirnas listed in mirbase version 9.0 ( ). Linearity of cdna synthesis enables sensitive detection Using the miscript System, the cdna synthesis reaction is highly linear which ensures sensitive, accurate quantification in subsequent real-time PCR. In the results shown in Figure 6, C T values from real-time PCRs were highly linear following cdna synthesis reactions from a range of amounts of starting RNA. Figure 6. Highly linear cdna synthesis reactions. RNA was purified from HeLa S3 cells using the mirneasy Mini Kit. A range of amounts of RNA from 10 pg to 1 µg were used in cdna synthesis reactions using the miscript Reverse Transcription Kit. cdna was used as a template in quantitative, real-time PCR assays for 5 mirnas (mir-16, mir-20a, mir-25, mir-28, and mir-26a). 8 Comprehensive mirna Technologies 04/2007
9 Highly specific mirna detection The existence of multiple mirna isoforms presents a significant challenge in mirna quantification. miscript Primer Assays are highly specific and can distinguish between isoforms as shown for the Let-7 family. Human Let-7 isoforms with mismatches and/or differing lengths were used in these experiments (Table 1). In most cases, cross reactivity was very low and insignificant. Where cross reactivity was observed, it was at low levels (e.g., ~6% for Let-7a miscript Primer Assay with Let-7f cdna). These results indicate that miscript Primer Assays are isoform specific. Table 1. Isoforms of human Let-7 family mirna sequence Let-7a Let-7b Let-7c Let-7d Let-7e Let-7f Let-7g Let-7i UGAGGUAGUAGGUUGUAUAGUU UGAGGUAGUAGGUUGUGUGGUU UGAGGUAGUAGGUUGUAUGGUU AGAGGUAGUAGGUUGCAUAGU UGAGGUAGGAGGUUGUAUAGU UGAGGUAGUAGAUUGUAUAGUU UGAGGUAGUAGUUUGUACAGU UGAGGUAGUAGUUUGUGCUGU These sequences show the Let-7 isoforms. Base changes are red and underlined. Changes in length are indicated by a red dot. Table 2. Specificity of miscript Primer Assays Relative detection (as % of perfect match) cdna used miscript Primer Assay used in PCR Let-7a Let-7b Let-7c Let-7d Let-7e Let-7f Let-7g Let-7i Let-7a Let-7b Let-7c Let-7d Let-7e Let-7f Let-7g Let-7i Synthetic mirnas of each Let-7 isoform were used in cdna synthesis reactions performed with the miscript Reverse Transcription Kit. An aliquot of the resultant cdna was used as a template in real-time PCR reactions with a miscript Primer Assay for each isoform and the miscript SYBR Green PCR Kit. The % relative detection was calculated using the differences between the C T values achieved from the mismatching miscript Primer Assays and those from the perfectly matching miscript Primer Assays (% relative detection = 2 ΔCT x 100). Comprehensive mirna Technologies 04/2007 Sample & Assay Technologies 9
10 Ordering Information Product Contents Cat. No. mirneasy Mini Kit (50) mirneasy 96 Kit (4) miscript Reverse Transcription Kit (10) miscript Reverse Transcription Kit (50) miscript Primer Assay (100) Human miscript Primer Assay Set V1.0 Mouse miscript Primer Assay Set V1.0 Rat miscript Primer Assay Set V1.0 miscript SYBR Green PCR Kit (200) miscript SYBR Green PCR Kit (1000) 50 RNeasy Mini Spin Columns, Collection Tubes (1.5 ml and 2 ml), QIAzol Lysis Reagent, RNase- Free Reagents and Buffers 4 RNeasy 96 Plates, Collection Microtubes (racked), Elution Microtubes CL, Caps, S-Blocks, AirPore Tape Sheets, QIAzol Lysis Reagent, RNase-Free Reagents and Buffers For 10 reactions: miscript Reverse Transcriptase Mix, miscript RT Buffer, RNase-Free Water For 50 reactions: miscript Reverse Transcriptase Mix, miscript RT Buffer, RNase-Free Water 10x miscript Primer Assay (contains one mirna-specific primer) 452 miscript Primer Assays targeting human mirnas provided in 96-well plates 356 miscript Primer Assays targeting mouse mirnas provided in 96-well plates 226 miscript Primer Assays targeting rat mirnas provided in 96-well plates For 200 reactions: QuantiTect SYBR Green PCR Master Mix, miscript Universal Primer For 1000 reactions: QuantiTect SYBR Green PCR Master Mix, miscript Universal Primer Varies* Additional kits for purification of separate fractions RNeasy MinElute Cleanup Kit (50) RNeasy 96 Kit (4) 50 RNeasy MinElute Spin Columns, Collection Tubes (1.5 ml and 2 ml), RNase-Free Reagents and Buffers 4 RNeasy 96 Plates, Elution Microtubes CL, Caps, S-Blocks, AirPore Tape Sheets, RNase-Free Reagents and Buffers For mirna purification from formalin-fixed, paraffin-embedded tissue RNeasy FFPE Kit (50) Related products QuantiTect Primer Assay (200) QuantiTect SYBR Green PCR Kit (200) 50 RNeasy MinElute Spin Columns, 50 gdna Eliminator Mini Spin Columns, Collection Tubes, RNase-Free Reagents and Buffers 10x QuantiTect Primer Assay (contains a mix of forward and reverse primers for a specific target) For 200 x 50 µl reactions: 3 x 1.7ml 2x QuantiTect SYBR Green PCR Master Mix, 2 x 2 ml RNase-Free Water Varies* * Visit to search for and order these Primer Assays. Larger kit size available; please inquire. Requires a supplementary protocol. Visit to download the protocol Comprehensive Advancing mirna microrna Technologies research 04/2007
11 mirneasy Kits, the RNeasy MinElute Cleanup Kit, the RNeasy 96 Kit, the RNeasy FFPE Kit, the miscript System, HiPerFect Transfection Reagent, QuantiTect SYBR Green Kits, and QuantiTect Primer Assays are intended for research use. No claim or representation is intended to provide information for the diagnosis, prevention, or treatment of a disease. Trademarks: QIAGEN, GeneGlobe, MinElute, QuantiTect, RNeasy (QIAGEN Group); SYBR (Molecular Probes, Inc.). QIAzol Lysis Reagent is a subject of US Patent No. 5,346,994 and foreign equivalents. RNAlater is a trademark of AMBION, Inc., Austin, Texas and is covered by various U.S. and foreign patents. miscript Primer Assays and QuantiTect Primer Assays are compatible for use in the 5 nuclease process or the dsdna-binding dye processes covered by patents owned by Roche or owned by or licensed to Applera Corporation. No license under these patents to practice the 5 nuclease process or the dsdna-binding dye processes are conveyed expressly or by implication to the purchaser by the purchase of this product. Purchase of the miscript SYBR Green PCR Kit, QuantiTect SYBR Green Kit, and QuantiFast SYBR Green Kit is accompanied by a limited, non-transferable immunity from suit to use it with detection by a dsdna-binding dye as described in U.S. Patents Nos. 5,994,056 and 6,171,785 and corresponding patent claims outside the United States for the purchaser s own internal research. No real-time apparatus or system patent rights or any other patent rights, and no right to use this product for any other purpose are conveyed expressly, by implication or by estoppel / QIAGEN, all rights reserved.
12 Australia Orders Fax Technical Austria Orders 0800/ Fax 0800/ Technical 0800/ Belgium Orders Fax Technical Canada Orders Fax Technical 800-DNA-PREP ( ) China Orders Fax Technical Denmark Orders Fax Technical Finland Orders Fax Technical France Orders Fax Technical Germany Orders Fax Technical Hong Kong Orders Fax Technical Ireland Orders Fax Technical Italy Orders Fax Technical Japan Telephone Fax Technical Luxembourg Orders Fax Technical The Netherlands Orders Fax Technical Norway Orders Fax Technical South Korea Orders Fax Technical Sweden Orders Fax Technical Switzerland Orders Fax Technical UK Orders Fax Technical USA Orders Fax Technical 800-DNA-PREP ( ) /2007 Sample & Assay Technologies
Mir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr
User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,
AffinityScript QPCR cdna Synthesis Kit
AffinityScript QPCR cdna Synthesis Kit INSTRUCTION MANUAL Catalog #600559 Revision C.01 For In Vitro Use Only 600559-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this
ab185916 Hi-Fi cdna Synthesis Kit
ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1
Application Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C
microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr
User Manual/Hand book. qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse)
User Manual/Hand book qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse) Kit Components Cat. No. MA003...Human Whole Genome mirna qpcr Profiling Kit (-20 C) The following components are sufficient
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
Micro RNAs: potentielle Biomarker für das. Blutspenderscreening
Micro RNAs: potentielle Biomarker für das Blutspenderscreening micrornas - Background Types of RNA -Coding: messenger RNA (mrna) -Non-coding (examples): Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear
TaqMan Fast Advanced Master Mix. Protocol
TaqMan Fast Advanced Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED
HiPerFect Transfection Reagent Handbook
Fifth Edition October 2010 HiPerFect Transfection Reagent Handbook For transfection of eukaryotic cells with sirna and mirna Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the
Essentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
miscript mirna PCR Array Handbook
May 2012 miscript mirna PCR Array Handbook miscript II RT Kit miscript SYBR Green PCR Kit miscript mirna PCR Arrays miscript mirna QC PCR Array For SYBR Green-based, real-time PCR profiling of micrornas
QuantiNova Reverse Transcription Kit Handbook
June 2015 QuantiNova Reverse Transcription Kit Handbook For cdna synthesis with integrated removal of genomic DNA contamination For use in real-time two-step RT PCR Sample to Insight Contents Kit Contents...
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
mirnaselect pep-mir Cloning and Expression Vector
Product Data Sheet mirnaselect pep-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-C STORAGE: -80ºC QUANTITY: 2 vectors; each contains 100 µl of bacterial glycerol stock Components 1. mirnaselect
Introduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation -Optimal strategies to a successful mirna research project Optimal strategies to a successful mirna research
Global MicroRNA Amplification Kit
Global MicroRNA Amplification Kit Store kit at -20 C on receipt (ver. 3-060901) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in
The world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
Profiling of microrna in Blood Serum/Plasma. Guidelines for the mircury LNA TM Universal RT microrna PCR System
Profiling of microrna in Blood Serum/Plasma Guidelines for the mircury LNA TM Universal RT microrna PCR System Table of Contents 2 Introduction.....................................................................................
QuantiTect Reverse Transcription Handbook
March 2009 QuantiTect Reverse Transcription Handbook For cdna synthesis with integrated removal of genomic DNA contamination For use in real-time two-step RT-PCR Sample & Assay Technologies QIAGEN Sample
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
All-in-One mirna qrt-pcr Detection System Handbook
All-in-One mirna qrt-pcr Detection System Handbook For quantitative detection of mature mirna All-in-One mirna First-Strand cdna Synthesis Kit Cat. No. AMRT-0020 (20 mirna reverse transcription reactions)
Speed Matters - Fast ways from template to result
qpcr Symposium 2007 - Weihenstephan Speed Matters - Fast ways from template to result March 28, 2007 Dr. Thorsten Traeger Senior Scientist, Research and Development - 1 - Overview Ạgenda Fast PCR The Challenges
FastLine cell cdna Kit
1. FastLine cell cdna Kit For high-speed preparation of first-strand cdna directly from cultured cells without RNA purification www.tiangen.com RT100701 FastLine cell cdna Kit Cat. no. KR105 Kit Contents
All-in-One First-Strand cdna Synthesis Kit
All-in-One First-Strand cdna Synthesis Kit For reliable first-strand cdna synthesis from all RNA sources Cat. No. AORT-0020 (20 synthesis reactions) Cat. No. AORT-0050 (50 synthesis reactions) User Manual
RNeasy MinElute Cleanup Handbook
Second Edition December October 2010 2005 RNeasy MinElute Cleanup Handbook For RNA cleanup and concentration with small elution volumes Sample & Assay Technologies QIAGEN Sample and Assay Technologies
Real-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube
User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally
U.S. Patent No. 9,051,563 and other pending patents. Ver. 1.1.3
INSTRUCTION MANUAL Direct-zol RNA MiniPrep Catalog Nos. R050, R05, R05, & R053 Highlights Quick, spin column purification of high-quality (DNA-free) total RNA directly from TRIzol, TRI Reagent and other
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
Relative Quantification of mirna Target mrnas by Real-Time qpcr. 1 Introduction. Gene Expression Application Note No. 4
Gene Expression Application Note No. 4 Relative Quantification of mirna Target mrnas by Real-Time qpcr Ute Ernst, Jitao David Zhang, Anja Irsigler, Stefan Wiemann, Ulrich Tschulena Division: Molecular
Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011
Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)
Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3
Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA
DP419 RNAsimple Total RNA Kit. RNAprep pure Series. DP501 mircute mirna Isolation Kit. DP438 MagGene Viral DNA / RNA Kit. DP405 TRNzol Reagent
Overview of TIANGEN Products DP419 RNAsimple Total RNA Kit DP430 RNAprep pure Kit(For Cell/Bacteria) DP315/DP315-R TIANamp Virus DNA/RNA Kit DP431 RNAprep pure Kit (For Tissue) Silica-membrane Technology
RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl
Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl
PreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas
ExpressArt Bacterial H-TR cdna synthesis kit With extreme selectivity against rrnas suitable for 2 to 4 µg total RNA Catalogue No. 8004-A30 (30 rxns) Reagents Materials are provided for 30 cdna synthesis
Profiling of non-coding RNA classes Gunter Meister
Profiling of non-coding RNA classes Gunter Meister RNA Biology Regensburg University Universitätsstrasse 31 93053 Regensburg Overview Classes of non-coding RNAs Profiling strategies Validation Protein-RNA
MMLV High Performance Reverse Transcriptase
MMLV High Performance Reverse Transcriptase Cat. Nos. RT80110K and RT80125K Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio).
sirna Duplexes & RNAi Explorer
P r o d u c t S p e c i f i c a t i o n s Guaranteed RNAi Explorer kit with Fl/Dabcyl Molecular Beacon Catalog No.:27-6402-01 Guaranteed RNAi Explorer kit with Fluorescein/Tamra TaqMan Catalog No.:27-6402-01
Genomic DNA Extraction Kit INSTRUCTION MANUAL
Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview
amplification tech Optical Design of CFX96 Real-Time PCR Detection System Eliminates the Requirement of a Passive Reference Dye
amplification tech note 6047 Optical Design of CFX96 Real-Time PCR Detection System Eliminates the Requirement of a Passive Reference Dye Liz Jordan and Richard Kurtz, Gene Expression Division, io-rad
RNA Extraction and Quantification, Reverse Transcription, and Real-time PCR (q-pcr)
RNA Extraction and Quantification, Reverse Transcription, and Real-time Preparation of Samples Cells: o Remove media and wash cells 2X with cold PBS. (2 ml for 6 well plate or 3 ml for 6cm plate) Keep
Validating Microarray Data Using RT 2 Real-Time PCR Products
Validating Microarray Data Using RT 2 Real-Time PCR Products Introduction: Real-time PCR monitors the amount of amplicon as the reaction occurs. Usually, the amount of product is directly related to the
Real-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
Outline. interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work?
Outline Outline interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work? What is RNA interference? Recently discovered regulatory level. Genome immune system.
RT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹 20100803
技 術 專 員 費 軫 尹 20100803 Overview of presentation Basic Biology of RNA interference Application of sirna for gene function? How to study mirna? How to deliver sirna and mirna? New prospects on RNAi research
Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit
Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to
Outline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction
Outline MicroRNA Bioinformatics Rickard Sandberg Dept. of Cell and Molecular Biology (CMB) Karolinska Institutet! Introduction! microrna target site prediction! Useful resources 2 short non-coding RNAs
qstar mirna qpcr Detection System
qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr
Highly specific and sensitive quantitation
PRODUCT ULLETIN SYR Select Master Mix SYR Select Master Mix Highly specific and sensitive quantitation SYR Select Master Mix offers advanced performance at an affordable price. SYR Select Master Mix is
SYBR Green Realtime PCR Master Mix -Plus-
Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction
5PCR, real-time PCR, reverse transcription, and cloning
5PCR, real-time PCR, reverse transcription, and cloning 166 www.qiagen.com QIAGEN Product Guide 2007 PCR, real-time PCR, reverse transcription, and cloning 5 5.1 PCR and RT-PCR www.qiagen.com/pg/pcr Selection
mircute mirna qpcr Detection Kit (SYBR Green)
mircute mirna qpcr Detection Kit (SYBR Green) For detection of mirna using real-time RT-PCR (SYBR Green I) www.tiangen.com QP110302 mircute mirna qpcr Detection Kit (SYBR Green) Kit Contents Cat. no. FP401
Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR
Protocol Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Copyright 2008, 2010 Applied Biosystems. All rights reserved. Ambion and Applied Biosystems products are for Research Use Only.
Absolute Quantification Getting Started Guide
5 cdna Reverse Primer Oligo d(t) or random hexamer Synthesis of 1st cdna strand 3 5 cdna Applied Biosystems 7300/7500/7500 Fast Real-Time PCR System Absolute Quantification Getting Started Guide Introduction
Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit
USER GUIDE Power SYBR Green PCR Master Mix and Power SYBR Green RT-PCR Reagents Kit Catalog Number 4368577, 4367659, 4367660, 4368706, 4368702, 4368708 (Master Mix) and 4368711 (RT-PCR Reagents Kit) Publication
DyNAmo cdna Synthesis Kit for qrt-pcr
DyNAmo cdna Synthesis Kit for qrt-pcr Instruction manual F- 470S Sufficient for 20 cdna synthesis reactions (20 µl each) F- 470L Sufficient for 100 cdna synthesis reactions (20 µl each) Description...
SYBR Green PCR Master Mix and SYBR Green RT-PCR Reagents Kit
USER GUIDE SYBR Green PCR Master Mix and SYBR Green RT-PCR Reagents Kit Catalog Number 4309155 (Master Mix) and 4306736 (RT-PCR Reagents Kit) Publication Part Number 4310251 Rev. G Revision Date September
MicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control
MicroRNA formation mirna s are processed from several precursor stages Mammalian genomes seem to have 100 s of mirna s Nucleotides in positions 2-8 of an mirna are considered the mirna seed 5 Methyl-G
Reverse Transcription System
TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/
CompleteⅡ 1st strand cdna Synthesis Kit
Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Megaplex Pools For microrna Expression Analysis
Megaplex Pools For microrna Expression Analysis Protocol Copyright 2008, 2010 Applied Biosystems. All rights reserved. For Research Use Only. Not for use in diagnostic procedures. Information in this document
Quantitative Real Time PCR Protocol. Stack Lab
Quantitative Real Time PCR Protocol Stack Lab Overview Real-time quantitative polymerase chain reaction (qpcr) differs from regular PCR by including in the reaction fluorescent reporter molecules that
New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.
New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System
QIAGEN Supplementary Protocol
QIAGEN Supplementary Protocol Isolation of Peripheral Blood Mononuclear Cells (PBMC) and Purification of Total RNA from PBMC Using the RNeasy Micro or Mini Kit This protocol describes how to isolate PBMC
ab185915 Protein Sumoylation Assay Ultra Kit
ab185915 Protein Sumoylation Assay Ultra Kit Instructions for Use For the measuring in vivo protein sumoylation in various samples This product is for research use only and is not intended for diagnostic
A role of microrna in the regulation of telomerase? Yuan Ming Yeh, Pei Rong Huang, and Tzu Chien V. Wang
A role of microrna in the regulation of telomerase? Yuan Ming Yeh, Pei Rong Huang, and Tzu Chien V. Wang Department of Molecular and Cellular Biology, Chang Gung University, Kwei San, Tao Yuan 333, Taiwan
PicoMaxx High Fidelity PCR System
PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED
Real-time PCR: Understanding C t
APPLICATION NOTE Real-Time PCR Real-time PCR: Understanding C t Real-time PCR, also called quantitative PCR or qpcr, can provide a simple and elegant method for determining the amount of a target sequence
Path-ID Multiplex One-Step RT-PCR Kit
USER GUIDE Path-ID Multiplex One-Step RT-PCR Kit TaqMan probe-based multiplex one-step real-time RT-PCR detection of RNA targets Catalog Numbers 4428206, 4428207, 4440022 Publication Part Number 4440907
QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.
QUANTITATIVE RT-PCR Application: Quantitative RT-PCR is used to quantify mrna in both relative and absolute terms. It can be applied for the quantification of mrna expressed from endogenous genes, and
Review of AB-Ambion systems for microrna Isolation, Analysis and Regulation
Review of AB-Ambion systems for microrna Isolation, Analysis and Regulation Marjorie JOINER Ingénieur Applications Applied Biosystems France Isabelle KAYSER Ingénieur Commercial Applied Biosystems France
Gene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
PrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
RIBOPROTECT. RNase Inhibitor RT33-020, RT33-100
RIBOPROTECT RT33-020, RT33-100 RT33-020, RT33-100 RIBOPROTECT The RIBOPROTECT is a recombinant protein isolated and purified from Escherichia coli. It inhibits ribonuclease (RNase) activity of enzymes
Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium
Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium I. Introduction: Sequence based assays of transcriptomes (RNA-seq) are in wide use because of their favorable
ZR DNA Sequencing Clean-up Kit
INSTRUCTION MANUAL ZR DNA Sequencing Clean-up Kit Catalog Nos. D40 & D4051 Highlights Simple 2 Minute Bind, Wash, Elute Procedure Flexible 6-20 µl Elution Volumes Allow for Direct Loading of Samples with
Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products
Genolution Pharmaceuticals, Inc. Revolution through genes, And Solution through genes. Life Science and Molecular Diagnostic Products www.genolution1.com TEL; 02-3010-8670, 8672 Geno-Serum Hepatitis B
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh
Dynabeads mrna DIRECT Micro Kit
USER GUIDE Dynabeads mrna DIRECT Micro Kit Catalog Number 61021 Revision 004 Revision Date 14 May 2012 For Research Use Only. Not for human or animal therapeutic or diagnostic use. For Research Use Only.
Hepatitis B Virus. genesig Advanced Kit. DNA testing. Everything... Everyone... Everywhere... Core Protein Region. 150 tests.
TM Primerdesign Ltd TM Primerdesign Ltd Hepatitis B Virus Core Protein Region genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory and research use
Relative Quantification Applied Biosystems 7300/7500 Real Time PCR System
5 3 5 cdna Reverse Primer Oligo d(t) or random hexamer 3 5 cdna Getting Started Guide Relative Quantification Applied Biosystems 7300/7500 Real Time PCR System Introduction and Example RQ Experiment Designing
RealStar HBV PCR Kit 1.0 11/2012
RealStar HBV PCR Kit 1.0 11/2012 RealStar HBV PCR Kit 1.0 For research use only! (RUO) Product No.: 201003 96 rxns INS-201000-GB-02 Store at -25 C... -15 C November 2012 altona Diagnostics GmbH Mörkenstraße
RT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial
RT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial Samuel J. Rulli, Jr., Ph.D. qpcr-applications Scientist [email protected] Pathway Focused Research from Sample Prep to Data Analysis! -2-
Stratagene QPCR Mouse Reference Total RNA
Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits
Real-Time Quantitative PCR Instruments and Consumables
Index Page Sequence Detection Systems 2 Sequence Detection Systems Accessories and Softwares 3 Sequence Detection PCR Reagent Kits 4 Sequence Detection PCR Reagents 9 Sequence Detection Systems Disposables
ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053
INSTRUCTION MANUAL ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 Highlights Simple 10 Minute Bind, Wash, Elute Procedure Flexible 15-20 µl Elution Volumes Allow for Direct Loading of Samples
Supplemental Material. Methods
Supplemental Material Methods Measurement of lncrnas expression Total RNA was extracted from PAXgene TM tubes using the PAXgene blood RNA kit (Qiagen, Venlo, Netherlands) as described by the manufacturer.
