RNAi: principle DNA RNA PROTEIN

Transcription

1 RNAi: principle RNAi DNA RNA PROTEIN Transcription (nucleus) Translation (cytoplasm) Many diseases develop from the undesirable production of specific proteins (oncogene products, mutant proteins, toxins, etc). Protein production in the cell begins with transcription. This process generates a messenger RNA (mrna), which is then translated into protein in the cytoplasm. A typical mrna produces approximately 5,000 copies of a protein. Consequently, targeting mrna rather than the protein itself is potentially a much more efficient approach to block protein function.

2 RNAi RNA-based, mrna-targeted therapeuticals specifically target and degrade mrna using a naturally occurring cellular mechanism, called RNA interference, that regulates the expression of genes. RNA interference (RNAi) is a highly promising therapeutic approach for those diseases where aberrant protein production is a problem. RNAi can also be applied to inhibit the expression or replication of pathogenic viruses, such as HIV and hepatitis C virus.

3 RNAi is a natural mechanism of controlling gene expression RNA interference is an apparently ancient defense mechanism against foreign double-stranded RNA (dsrna). In RNAi response, RNAs of 2123 nucleotides in length, called small interfering RNAs (sirnas), are snipped from longer dsrna chains by an enzyme called Dicer. The antisense strand of the sirna is used by an RNA-induced silencing complex (RISC) to guide messenger RNA (mrna) cleavage, so promoting mrna degradation.

4 How sirna therapeuticals work: In RNAi-based therapy, a doublestranded short interfering RNA (sirna) molecule is engineered to precisely match the protein-encoding nucleotide sequence of the target mrna to be silenced. Following administration, the sirna hijacks the RNAi pathway. It associates with RISC and directs it to the target mrna. The sirna-associated RISC binds to the target mrna through a base-pairing interaction and degrades it. RISC complex is catalytic and can cleave multiple target mrnas.

5 How to introduce sirna into the cell? 1. Synthetic RNA (sirna) can be injected into the cell 2. A viral vector encoding a short hairpin RNA (shrna) can be used to deliver sirna into the cell 3. sirna -coding DNA constructs can be incorporated into the genome

6 RNAi: advantages RNA interference-based therapeutics have potentially significant advantages over traditional approaches to treating diseases. Broad Applicability Diseases for which an abnormal gene function can be identified as a cause or as an essential contributing factor are potentially treatable with RNA interference-based drugs. Therapeutic Precision Some of the side effects associated with traditional drugs may be reduced or avoided by using RNA interferencebased drugs designed to inhibit expression of only a disease-associated and targeted gene and not interfere with other genes in the body. Target RNA Destruction Compared to most drugs that only temporarily prevent targeted protein function, RNA interference-based drugs are designed to destroy the target RNA and therefore stop the associated undesirable protein production required for disease progression.

7 sirna for treatment of AMD Age-related macular degeneration (AMD) is an eye disease that destroys central vision by damaging the macula, the central region of the retina. AMD affects millions of people worldwide. The main symptoms of AMD is dim or fuzzy central vision. Objects may appear distorted or smaller then they really are, and straight lines may appear wavy or curved. Patients may develop a blank or blind spot in their central field of vision. There are no effective therapies.

8 sirna for treatment of AMD AMD is often associate and promoted by neovascularization - new blood vessel growth. Macular neovascularization is stimulated by interaction of vascular endothelial growth factor (VEGF) with vascular endothelial growth factor receptor VEGFR-1. Inhibiting production of VEGFR-1 should stop neovascularization and prevent development of AMD. Company SIRNA Therapeutics (San Francisco) has developed a short interfering RNA: SIRNA-027. Sirna-027 inhibited neovascularization (new blood vessel growth associated with disease) in several validated preclinical models. It is in the Phase II of clinical trials. SIRNA Therapeutics was acquired in 2006 by Merck for 1.1 billion dollars. Another company, Acuity Pharmaceuticals, is developing sirna that targets VEGF. Inhibition of blood vessel growth in corneas of mice after a single intravitreal injection

9 sirna targeting ApoB ApoB is a liver enzyme essential for the assembly and secretion of low-density lipoprotein (LDL), which are required for metabolism of cholesterol. High levels of ApoB and LDL increase risk of coronary artery disease. Alnylam Pharmaceuticals developed sirna to target ApoB. They first used chloresterol-conjugated sirna to demonstrate its effect on ApoB production in mice (Nature, 2004, 432, )

10 sirna targeting ApoB Later (in 2006) Alnylam Pharmaceuticals tested the liposomal formulation of stable nucleic acid lipid particles (SNALPs) in primates. Liposomal formulation works much better when sirna is to be delivered to liver. The effect of single administration persisted for up to 11 days! 1 mg/kg 2 days after administration 3 days after administration real sirna mistmatched sirna

11 Pachyonychia congenita Pachyonychia congenita (PC) is a rare form of hereditary keratoderma that can affect the skin, mouth, hair and eyes. It is caused by mutation in one of four human keratin genes. The predominant clinical feature common to PC is nail dystrophy, blistering and formation of extremely thick skin on palms and on soles of the feet. Courtesy of Dr. Hickerson, Transderm, Inc An approach being developed by Transderm, Inc. is based on using sirna specific to the mutant version of the keratin gene.

12 Pachyonychia congenita A number of overlapping sirna have been tested in their ability to inhibit production of the mutant, but not the wild type protein Screening for effective N171K sirna inhibitors K6A WT GTGAACAGATCAAGACCCTCAACAACAAGTTTGCCTCCTTC wild type K6A N171K GTGAACAGATCAAGACCCTCAAAAACAAGTTTGCCTCCTTC mutant Activity WT MUT sirna: mutk6a_3.1 GAUCAAGACCCUCAAaAACUU!!! mutk6a_3.2 AUCAAGACCCUCAAaAACAUU mutk6a_3.3 UCAAGACCCUCAAaAACAAUU mutk6a_3.4 CAAGACCCUCAAaAACAAGUU - - mutk6a_3.5 AAGACCCUCAAaAACAAGUUU - - mutk6a_3.6 AGACCCUCAAaAACAAGUUUU - + mutk6a_3.7 GACCCUCAAaAACAAGUUUUU + ++ mutk6a_3.8 ACCCUCAAaAACAAGUUUGUU - + mutk6a_3.9 CCCUCAAaAACAAGUUUGCUU!!! mutk6a_3.10 CCUCAAaAACAAGUUUGCCUU - - mutk6a_3.11 CUCAAaAACAAGUUUGCCUUU - - mutk6a_3.12 UCAAaAACAAGUUUGCCUCUU - - mutk6a_3.13 CAAaAACAAGUUUGCCUCCUU - - mutk6a_3.14 AAaAACAAGUUUGCCUCCUUU - - mutk6a_3.15 AaAACAAGUUUGCCUCCUUUU - - mutk6a_3.16 aaacaaguuugccuccuucuu + ++ Several of the mutant-specific sirnas are in clinical trials

13 sirna RNAi-holds promise for the treatment of viral diseases. HIV: sirnas can inhibit HIV replication in cell culture. HIV infection can be blocked by targeting either viral genes (for example, gag, rev, tat and env) or human genes (for example, CD4, the principal receptor for HIV) that are involved in the HIV life cycle. Thus, such antiviral therapies can attack multiple viral and cellular targets and could circumvent genetic resistance of HIV. Silencing cellular receptor, CCR5, can prevent viral entry. Silencing a viral gene should interfere with viral production. Targeting multiple genes may enhance viral suppression and reduce the chances of viral escape by mutation.

14 Micro RNA (mirna) Micro RNA (mirna) are small RNAs produced in the cell. They are involved in regulation of expression of many cellular genes. There are estimated 230 mirnas in humans - ca. 1% of the total gene number. There are roughly as many mirnas as transcription factors. mirnas are excised from short doublestranded stem-loop precursors, and regulate stability and translational regulation of partially complementary mrnas. mirna binds to the untranslated 3 terminal segment of mrna and down-regulates translation. The mechanism is unknown. 5 3 Translation is blocked

15 sirna and mirna use similar but distinct mechanisms for gene silencing

16 Read more about RNAi and sirna therapeuticals at

17 SELEX Systematic Evolution of Ligands by Exponential Enrichment SELEX is a method of identifying RNA sequences with specific binding or catalytic activity in a population of molecules with partially random sequence. The purpose of SELEX is identification RNA molecules with a high affinity for a target (RNA aptamers) or RNA molecules with specific catalytic activities (ribozymes) SELEX was invented in two laboratories: - Larry Gold (University of Colorado) - Jack Szostack (Harvard Massachusetts General Hospital)

18 Aptamers and the principle of SELEX Aptamers are short nucleic acid molecules selected from a large random sequence pool to bind to specific target molecule. from the Latin, aptus, meaning to fit. RNA

19 SELEX The starting material for a SELEX experiment is a collection of synthetic, random-sequence RNA molecules containing one hundred trillion (10 14 ) to ten quadrillion (10 16 ) different sequences. Each molecule contains a segment of random sequence flanked by unique primer-binding sequences at each end to facilitate amplification. specific random specific 5 3 UAGCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNUGCUUAC ca 20 nt nt ca 20 nt Dilemma: The longer the random sequence segment - the more likely to have wanted functional groups in the proper places. As RNA gets longer, it takes more molecules to represent all possible sequences. random sequence length # of possible sequences # moles weight 20-mer 4 20 = 1.1 x = 1.8 pmoles = 12 ng 30-mer 4 30 = 1.1 x = 1.8 umoles = 18 mg 40-mer 4 40 = 1.2 x = 2 moles = 26 kg 165-mer = 1.2 x = 2 x moles = tons Planet Earth: = 6 x tons

20 Synthesis of random nucleic acids: UAGCTGGA UAGCTGGAA UAGCTGGAU UAGCTGGAG UAGCTGG UAGCTGGU UAGCTGGAC UAGCTGGUA UAGCTGGUU UAGCTGGUG UAGCTGGUC UAGCTGGGA UAGCTGGUUA UAGCTGGUUU UAGCTGGUUG UAGCTGGUUC UAGCTGGG UAGCTGGGU UAGCTGGGG UAGCTGGGC UAGCTGGCA UAGCTGGC UAGCTGGCU UAGCTGGCG Complexity: UAGCTGGCC

21 Step 1. Generation of RNA Random-sequence synthetic DNA is used to prepare RNA transcripts: T7 promoter specific Initial DNA pool random specific TAGCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCTTAC RNA Transcription with T7 RNA polymerase Mixture of random-sequence RNA molecules

22 Step 2. Selection (affinity column) Random RNA pool ligand carrier Pass mixture of RNA molecules through a column with the ligand Non-bound RNA Bound RNA Population enriched in aptamers

23 Step 3. Reverse transcription RNA aptamer Specifically + non-specifically bound RNA DNA primer Reverse transcription cdna RNA aptamer

24 Step 4. PCR amplification cdna T7 promoter sequence L-primer PCR R-primer The first round DNA (enriched in sequences corresponding to RNA aptamers)

25 Generation of second-round RNA The second round DNA RNA Transcription with T7 RNA polymerase The second round RNA: Mixture is enriched in specific binders etc..

26 With every round of selection - better and better enrichment in specific binders Repeated rounds of selection (usually 7-15) SELEX allows for amplification and isolation of only few molecules of RNA with specific properties from pools of enormous diversity

27 RNA aptamers can serve as reversible antagonists of blood coagulation Blood anticoagulants are important medicines, but their use is often associated with a severe adverse effect - profound bleeding. One needs to have a fast-acting antidot for rapid reversal of anticoagulant effect. The use of RNA anticoagulants makes possible to develop a drug-antidot pair. Rusconi and colelagues from Duke University Medical Center have developed such a pair for a coagulation factor IXa (Nature, 419, 90-94)

28 RNA aptamers as reversible antagonists of blood coagulation Coagulation factor IXa is one of the proteins that promotes fibrin clot formation. Starting RNA pool (40 random positions ): species. After 8 rounds isolated an RNA species that had high affinity for the factor IXa (Kd = 0.65 nm). Then minimized the aptamer structure The selected aptamer increased clotting time to the level observed in individuals deficient in factor IX - minimized aptamer

29 RNA aptamers as reversible antagonists of blood coagulation Antidot: altering the shape of apatamer will prevent its binding to the target (factor IXa). An oligonucleotide complementary to a specific part of the aptamer should alter its structure and prevent binding to the target C G C G G U A U A G U C C C C A U Administered in vivo, the antidot completely reverse the activity of the aptamer in 10 min

30 Aptamers vs Antibodies Aptamers Binding affinity in low nanomolar to picomolar range Entire selection is a chemical process carried out in vitro and can therefore target any protein Can select for ligands under a variety of conditions for in vitro diagnostics Iterative rounds against known target limits screening processes Uniform activity regardless of batch synthesis Antibodies Binding affinity in low nanomolar to picomolar range Selection requires a biological system, therefore difficult to raise antibodies to toxins (not tolerated by animal) or non-immunogenic targets Limited to physiologic conditions for optimizing antibodies for diagnostics Screening monoclonal antibodies time consuming and expensive Activity of antibodies vary from batch to batch PK parameters can be changed on demand Investigator determines target site of protein Wide variety of chemical modifications to molecule for diverse functions Return to original conformation after temperature insult No evidence of immunogenicity Aptamer-specific antidote can be developed to reverse the inhibitory activity of the drug Difficult to modify PK parameters Immune system determines target site of protein Limited modifications of molecule Temperature sensitive and undergo irreversible denaturation Significant immunogenicity No rational method to reverse molecules

31 Other therapeutic applications of SELEX - Control of viral replication (HIV, HCV, etc.) - Inhibition of prion formation (Alzheimer s) - Anti-angiogenesis (VEGF) - Antiinflamatory - Immunomodulators - Anticancer

32 Main problems of RNA therapeutics: stability and delivery Unmodified short RNAs are rapidly degraded in vivo by RNases. Modification of the RNA structure (for example, replacement of 2 OH with 2 F or 2 O-Me) can significantly extend the life of sirna in the bloodstream and protect sirna against nuclease activity in serum. 2 OH is critical for hydrolysis of RNA by cellular RNases

33 sirna delivery Some tissues of the body that are easily accessible, including the respiratory and genital tracts, the eye, skin, can take up sirnas after topical application or direct injection of naked sirnas alone or in complexes with cationic lipids. Other strategies: - encapsulation in liposomes (stable nucleic acid-lipid particles or SNALPs). - RNA bound to protamineantibody fusion (protamine is positively charged and tightly binds RNA). Cell-specific RNA delivery. - covalently coupling RNA to cholesterol to facilitate uptake through ubiquitously expressed cell-surface LDL receptors