RNAi: principle DNA RNA PROTEIN

Size: px
Start display at page:

Download "RNAi: principle DNA RNA PROTEIN"

Transcription

1 RNAi: principle RNAi DNA RNA PROTEIN Transcription (nucleus) Translation (cytoplasm) Many diseases develop from the undesirable production of specific proteins (oncogene products, mutant proteins, toxins, etc). Protein production in the cell begins with transcription. This process generates a messenger RNA (mrna), which is then translated into protein in the cytoplasm. A typical mrna produces approximately 5,000 copies of a protein. Consequently, targeting mrna rather than the protein itself is potentially a much more efficient approach to block protein function.

2 RNAi RNA-based, mrna-targeted therapeuticals specifically target and degrade mrna using a naturally occurring cellular mechanism, called RNA interference, that regulates the expression of genes. RNA interference (RNAi) is a highly promising therapeutic approach for those diseases where aberrant protein production is a problem. RNAi can also be applied to inhibit the expression or replication of pathogenic viruses, such as HIV and hepatitis C virus.

3 RNAi is a natural mechanism of controlling gene expression RNA interference is an apparently ancient defense mechanism against foreign double-stranded RNA (dsrna). In RNAi response, RNAs of 2123 nucleotides in length, called small interfering RNAs (sirnas), are snipped from longer dsrna chains by an enzyme called Dicer. The antisense strand of the sirna is used by an RNA-induced silencing complex (RISC) to guide messenger RNA (mrna) cleavage, so promoting mrna degradation.

4 How sirna therapeuticals work: In RNAi-based therapy, a doublestranded short interfering RNA (sirna) molecule is engineered to precisely match the protein-encoding nucleotide sequence of the target mrna to be silenced. Following administration, the sirna hijacks the RNAi pathway. It associates with RISC and directs it to the target mrna. The sirna-associated RISC binds to the target mrna through a base-pairing interaction and degrades it. RISC complex is catalytic and can cleave multiple target mrnas.

5 How to introduce sirna into the cell? 1. Synthetic RNA (sirna) can be injected into the cell 2. A viral vector encoding a short hairpin RNA (shrna) can be used to deliver sirna into the cell 3. sirna -coding DNA constructs can be incorporated into the genome

6 RNAi: advantages RNA interference-based therapeutics have potentially significant advantages over traditional approaches to treating diseases. Broad Applicability Diseases for which an abnormal gene function can be identified as a cause or as an essential contributing factor are potentially treatable with RNA interference-based drugs. Therapeutic Precision Some of the side effects associated with traditional drugs may be reduced or avoided by using RNA interferencebased drugs designed to inhibit expression of only a disease-associated and targeted gene and not interfere with other genes in the body. Target RNA Destruction Compared to most drugs that only temporarily prevent targeted protein function, RNA interference-based drugs are designed to destroy the target RNA and therefore stop the associated undesirable protein production required for disease progression.

7 sirna for treatment of AMD Age-related macular degeneration (AMD) is an eye disease that destroys central vision by damaging the macula, the central region of the retina. AMD affects millions of people worldwide. The main symptoms of AMD is dim or fuzzy central vision. Objects may appear distorted or smaller then they really are, and straight lines may appear wavy or curved. Patients may develop a blank or blind spot in their central field of vision. There are no effective therapies.

8 sirna for treatment of AMD AMD is often associate and promoted by neovascularization - new blood vessel growth. Macular neovascularization is stimulated by interaction of vascular endothelial growth factor (VEGF) with vascular endothelial growth factor receptor VEGFR-1. Inhibiting production of VEGFR-1 should stop neovascularization and prevent development of AMD. Company SIRNA Therapeutics (San Francisco) has developed a short interfering RNA: SIRNA-027. Sirna-027 inhibited neovascularization (new blood vessel growth associated with disease) in several validated preclinical models. It is in the Phase II of clinical trials. SIRNA Therapeutics was acquired in 2006 by Merck for 1.1 billion dollars. Another company, Acuity Pharmaceuticals, is developing sirna that targets VEGF. Inhibition of blood vessel growth in corneas of mice after a single intravitreal injection

9 sirna targeting ApoB ApoB is a liver enzyme essential for the assembly and secretion of low-density lipoprotein (LDL), which are required for metabolism of cholesterol. High levels of ApoB and LDL increase risk of coronary artery disease. Alnylam Pharmaceuticals developed sirna to target ApoB. They first used chloresterol-conjugated sirna to demonstrate its effect on ApoB production in mice (Nature, 2004, 432, )

10 sirna targeting ApoB Later (in 2006) Alnylam Pharmaceuticals tested the liposomal formulation of stable nucleic acid lipid particles (SNALPs) in primates. Liposomal formulation works much better when sirna is to be delivered to liver. The effect of single administration persisted for up to 11 days! 1 mg/kg 2 days after administration 3 days after administration real sirna mistmatched sirna

11 Pachyonychia congenita Pachyonychia congenita (PC) is a rare form of hereditary keratoderma that can affect the skin, mouth, hair and eyes. It is caused by mutation in one of four human keratin genes. The predominant clinical feature common to PC is nail dystrophy, blistering and formation of extremely thick skin on palms and on soles of the feet. Courtesy of Dr. Hickerson, Transderm, Inc An approach being developed by Transderm, Inc. is based on using sirna specific to the mutant version of the keratin gene.

12 Pachyonychia congenita A number of overlapping sirna have been tested in their ability to inhibit production of the mutant, but not the wild type protein Screening for effective N171K sirna inhibitors K6A WT GTGAACAGATCAAGACCCTCAACAACAAGTTTGCCTCCTTC wild type K6A N171K GTGAACAGATCAAGACCCTCAAAAACAAGTTTGCCTCCTTC mutant Activity WT MUT sirna: mutk6a_3.1 GAUCAAGACCCUCAAaAACUU!!! mutk6a_3.2 AUCAAGACCCUCAAaAACAUU mutk6a_3.3 UCAAGACCCUCAAaAACAAUU mutk6a_3.4 CAAGACCCUCAAaAACAAGUU - - mutk6a_3.5 AAGACCCUCAAaAACAAGUUU - - mutk6a_3.6 AGACCCUCAAaAACAAGUUUU - + mutk6a_3.7 GACCCUCAAaAACAAGUUUUU + ++ mutk6a_3.8 ACCCUCAAaAACAAGUUUGUU - + mutk6a_3.9 CCCUCAAaAACAAGUUUGCUU!!! mutk6a_3.10 CCUCAAaAACAAGUUUGCCUU - - mutk6a_3.11 CUCAAaAACAAGUUUGCCUUU - - mutk6a_3.12 UCAAaAACAAGUUUGCCUCUU - - mutk6a_3.13 CAAaAACAAGUUUGCCUCCUU - - mutk6a_3.14 AAaAACAAGUUUGCCUCCUUU - - mutk6a_3.15 AaAACAAGUUUGCCUCCUUUU - - mutk6a_3.16 aaacaaguuugccuccuucuu + ++ Several of the mutant-specific sirnas are in clinical trials

13 sirna RNAi-holds promise for the treatment of viral diseases. HIV: sirnas can inhibit HIV replication in cell culture. HIV infection can be blocked by targeting either viral genes (for example, gag, rev, tat and env) or human genes (for example, CD4, the principal receptor for HIV) that are involved in the HIV life cycle. Thus, such antiviral therapies can attack multiple viral and cellular targets and could circumvent genetic resistance of HIV. Silencing cellular receptor, CCR5, can prevent viral entry. Silencing a viral gene should interfere with viral production. Targeting multiple genes may enhance viral suppression and reduce the chances of viral escape by mutation.

14 Micro RNA (mirna) Micro RNA (mirna) are small RNAs produced in the cell. They are involved in regulation of expression of many cellular genes. There are estimated 230 mirnas in humans - ca. 1% of the total gene number. There are roughly as many mirnas as transcription factors. mirnas are excised from short doublestranded stem-loop precursors, and regulate stability and translational regulation of partially complementary mrnas. mirna binds to the untranslated 3 terminal segment of mrna and down-regulates translation. The mechanism is unknown. 5 3 Translation is blocked

15 sirna and mirna use similar but distinct mechanisms for gene silencing

16 Read more about RNAi and sirna therapeuticals at

17 SELEX Systematic Evolution of Ligands by Exponential Enrichment SELEX is a method of identifying RNA sequences with specific binding or catalytic activity in a population of molecules with partially random sequence. The purpose of SELEX is identification RNA molecules with a high affinity for a target (RNA aptamers) or RNA molecules with specific catalytic activities (ribozymes) SELEX was invented in two laboratories: - Larry Gold (University of Colorado) - Jack Szostack (Harvard Massachusetts General Hospital)

18 Aptamers and the principle of SELEX Aptamers are short nucleic acid molecules selected from a large random sequence pool to bind to specific target molecule. from the Latin, aptus, meaning to fit. RNA

19 SELEX The starting material for a SELEX experiment is a collection of synthetic, random-sequence RNA molecules containing one hundred trillion (10 14 ) to ten quadrillion (10 16 ) different sequences. Each molecule contains a segment of random sequence flanked by unique primer-binding sequences at each end to facilitate amplification. specific random specific 5 3 UAGCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNUGCUUAC ca 20 nt nt ca 20 nt Dilemma: The longer the random sequence segment - the more likely to have wanted functional groups in the proper places. As RNA gets longer, it takes more molecules to represent all possible sequences. random sequence length # of possible sequences # moles weight 20-mer 4 20 = 1.1 x = 1.8 pmoles = 12 ng 30-mer 4 30 = 1.1 x = 1.8 umoles = 18 mg 40-mer 4 40 = 1.2 x = 2 moles = 26 kg 165-mer = 1.2 x = 2 x moles = tons Planet Earth: = 6 x tons

20 Synthesis of random nucleic acids: UAGCTGGA UAGCTGGAA UAGCTGGAU UAGCTGGAG UAGCTGG UAGCTGGU UAGCTGGAC UAGCTGGUA UAGCTGGUU UAGCTGGUG UAGCTGGUC UAGCTGGGA UAGCTGGUUA UAGCTGGUUU UAGCTGGUUG UAGCTGGUUC UAGCTGGG UAGCTGGGU UAGCTGGGG UAGCTGGGC UAGCTGGCA UAGCTGGC UAGCTGGCU UAGCTGGCG Complexity: UAGCTGGCC

21 Step 1. Generation of RNA Random-sequence synthetic DNA is used to prepare RNA transcripts: T7 promoter specific Initial DNA pool random specific TAGCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCTTAC RNA Transcription with T7 RNA polymerase Mixture of random-sequence RNA molecules

22 Step 2. Selection (affinity column) Random RNA pool ligand carrier Pass mixture of RNA molecules through a column with the ligand Non-bound RNA Bound RNA Population enriched in aptamers

23 Step 3. Reverse transcription RNA aptamer Specifically + non-specifically bound RNA DNA primer Reverse transcription cdna RNA aptamer

24 Step 4. PCR amplification cdna T7 promoter sequence L-primer PCR R-primer The first round DNA (enriched in sequences corresponding to RNA aptamers)

25 Generation of second-round RNA The second round DNA RNA Transcription with T7 RNA polymerase The second round RNA: Mixture is enriched in specific binders etc..

26 With every round of selection - better and better enrichment in specific binders Repeated rounds of selection (usually 7-15) SELEX allows for amplification and isolation of only few molecules of RNA with specific properties from pools of enormous diversity

27 RNA aptamers can serve as reversible antagonists of blood coagulation Blood anticoagulants are important medicines, but their use is often associated with a severe adverse effect - profound bleeding. One needs to have a fast-acting antidot for rapid reversal of anticoagulant effect. The use of RNA anticoagulants makes possible to develop a drug-antidot pair. Rusconi and colelagues from Duke University Medical Center have developed such a pair for a coagulation factor IXa (Nature, 419, 90-94)

28 RNA aptamers as reversible antagonists of blood coagulation Coagulation factor IXa is one of the proteins that promotes fibrin clot formation. Starting RNA pool (40 random positions ): species. After 8 rounds isolated an RNA species that had high affinity for the factor IXa (Kd = 0.65 nm). Then minimized the aptamer structure The selected aptamer increased clotting time to the level observed in individuals deficient in factor IX - minimized aptamer

29 RNA aptamers as reversible antagonists of blood coagulation Antidot: altering the shape of apatamer will prevent its binding to the target (factor IXa). An oligonucleotide complementary to a specific part of the aptamer should alter its structure and prevent binding to the target C G C G G U A U A G U C C C C A U Administered in vivo, the antidot completely reverse the activity of the aptamer in 10 min

30 Aptamers vs Antibodies Aptamers Binding affinity in low nanomolar to picomolar range Entire selection is a chemical process carried out in vitro and can therefore target any protein Can select for ligands under a variety of conditions for in vitro diagnostics Iterative rounds against known target limits screening processes Uniform activity regardless of batch synthesis Antibodies Binding affinity in low nanomolar to picomolar range Selection requires a biological system, therefore difficult to raise antibodies to toxins (not tolerated by animal) or non-immunogenic targets Limited to physiologic conditions for optimizing antibodies for diagnostics Screening monoclonal antibodies time consuming and expensive Activity of antibodies vary from batch to batch PK parameters can be changed on demand Investigator determines target site of protein Wide variety of chemical modifications to molecule for diverse functions Return to original conformation after temperature insult No evidence of immunogenicity Aptamer-specific antidote can be developed to reverse the inhibitory activity of the drug Difficult to modify PK parameters Immune system determines target site of protein Limited modifications of molecule Temperature sensitive and undergo irreversible denaturation Significant immunogenicity No rational method to reverse molecules

31 Other therapeutic applications of SELEX - Control of viral replication (HIV, HCV, etc.) - Inhibition of prion formation (Alzheimer s) - Anti-angiogenesis (VEGF) - Antiinflamatory - Immunomodulators - Anticancer

32 Main problems of RNA therapeutics: stability and delivery Unmodified short RNAs are rapidly degraded in vivo by RNases. Modification of the RNA structure (for example, replacement of 2 OH with 2 F or 2 O-Me) can significantly extend the life of sirna in the bloodstream and protect sirna against nuclease activity in serum. 2 OH is critical for hydrolysis of RNA by cellular RNases

33 sirna delivery Some tissues of the body that are easily accessible, including the respiratory and genital tracts, the eye, skin, can take up sirnas after topical application or direct injection of naked sirnas alone or in complexes with cationic lipids. Other strategies: - encapsulation in liposomes (stable nucleic acid-lipid particles or SNALPs). - RNA bound to protamineantibody fusion (protamine is positively charged and tightly binds RNA). Cell-specific RNA delivery. - covalently coupling RNA to cholesterol to facilitate uptake through ubiquitously expressed cell-surface LDL receptors

RNAi Shooting the Messenger!

RNAi Shooting the Messenger! RNAi Shooting the Messenger! Bronya Keats, Ph.D. Department of Genetics Louisiana State University Health Sciences Center New Orleans Email: [email protected] RNA interference (RNAi) A mechanism by which

More information

MicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control

MicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control MicroRNA formation mirna s are processed from several precursor stages Mammalian genomes seem to have 100 s of mirna s Nucleotides in positions 2-8 of an mirna are considered the mirna seed 5 Methyl-G

More information

Micro RNAs: potentielle Biomarker für das. Blutspenderscreening

Micro RNAs: potentielle Biomarker für das. Blutspenderscreening Micro RNAs: potentielle Biomarker für das Blutspenderscreening micrornas - Background Types of RNA -Coding: messenger RNA (mrna) -Non-coding (examples): Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear

More information

The world of non-coding RNA. Espen Enerly

The world of non-coding RNA. Espen Enerly The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often

More information

Outline. interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work?

Outline. interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work? Outline Outline interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work? What is RNA interference? Recently discovered regulatory level. Genome immune system.

More information

Dicer Substrate RNAi Design

Dicer Substrate RNAi Design INTEGRATED DNA TECHNOLOGIES, INC. Dicer Substrate RNAi Design How to design and order 27-mer Dicer-substrate Duplex RNAs for use as RNA interference reagents The following document provides a summary of

More information

TOOLS sirna and mirna. User guide

TOOLS sirna and mirna. User guide TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹 20100803

岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹 20100803 技 術 專 員 費 軫 尹 20100803 Overview of presentation Basic Biology of RNA interference Application of sirna for gene function? How to study mirna? How to deliver sirna and mirna? New prospects on RNAi research

More information

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

Final Review. Aptamers. Making Aptamers: SELEX 6/3/2011. sirna and mirna. Central Dogma. RNAi: A translation regulation mechanism.

Final Review. Aptamers. Making Aptamers: SELEX 6/3/2011. sirna and mirna. Central Dogma. RNAi: A translation regulation mechanism. Central Dogma Final Review Section Week 10 DNA RNA Protein DNA DNA replication DNA RNA transcription RNA Protein translation **RNA DNA reverse transcription http://bass.bio.uci.edu/~hudel/bs99a/lecture20/lecture1_1.html

More information

Lezioni Dipartimento di Oncologia Farmacologia Molecolare. RNA interference. Giovanna Damia 29 maggio 2006

Lezioni Dipartimento di Oncologia Farmacologia Molecolare. RNA interference. Giovanna Damia 29 maggio 2006 Lezioni Dipartimento di Oncologia Farmacologia Molecolare RNA interference Giovanna Damia 29 maggio 2006 RNA INTERFERENCE Sequence-specific gene suppression by dsrnas Gene silencing by dsrna: C. elegans

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure

More information

mirnaselect pep-mir Cloning and Expression Vector

mirnaselect pep-mir Cloning and Expression Vector Product Data Sheet mirnaselect pep-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-C STORAGE: -80ºC QUANTITY: 2 vectors; each contains 100 µl of bacterial glycerol stock Components 1. mirnaselect

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

Gene Silencing Oligos (GSOs) Third Generation Antisense

Gene Silencing Oligos (GSOs) Third Generation Antisense Gene Silencing Oligos (GSOs) Third Generation Antisense Walter R. Strapps, Ph.D. Executive Director, RNA Therapeutics Idera Pharmaceuticals Cambridge, MA NASDAQ: IDRA www.iderapharma.com Idera is a leader

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Viruses. Viral components: Capsid. Chapter 10: Viruses. Viral components: Nucleic Acid. Viral components: Envelope

Viruses. Viral components: Capsid. Chapter 10: Viruses. Viral components: Nucleic Acid. Viral components: Envelope Viruses Chapter 10: Viruses Lecture Exam #3 Wednesday, November 22 nd (This lecture WILL be on Exam #3) Dr. Amy Rogers Office Hours: MW 9-10 AM Too small to see with a light microscope Visible with electron

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

Viral Infection: Receptors

Viral Infection: Receptors Viral Infection: Receptors Receptors: Identification of receptors has come from expressing the gene for the receptor in a cell to which a virus does not normally bind -OR- By blocking virus attachment

More information

Control of Gene Expression

Control of Gene Expression Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems

More information

Gene Therapy. The use of DNA as a drug. Edited by Gavin Brooks. BPharm, PhD, MRPharmS (PP) Pharmaceutical Press

Gene Therapy. The use of DNA as a drug. Edited by Gavin Brooks. BPharm, PhD, MRPharmS (PP) Pharmaceutical Press Gene Therapy The use of DNA as a drug Edited by Gavin Brooks BPharm, PhD, MRPharmS (PP) Pharmaceutical Press Contents Preface xiii Acknowledgements xv About the editor xvi Contributors xvii An introduction

More information

Antibody Function & Structure

Antibody Function & Structure Antibody Function & Structure Specifically bind to antigens in both the recognition phase (cellular receptors) and during the effector phase (synthesis and secretion) of humoral immunity Serology: the

More information

RNA: Transcription and Processing

RNA: Transcription and Processing 8 RNA: Transcription and Processing WORKING WITH THE FIGURES 1. In Figure 8-3, why are the arrows for genes 1 and 2 pointing in opposite directions? The arrows for genes 1 and 2 indicate the direction

More information

Control of Gene Expression

Control of Gene Expression Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

13.4 Gene Regulation and Expression

13.4 Gene Regulation and Expression 13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

HUNTINGTON S DISEASE THERAPIES RESEARCH UPDATE

HUNTINGTON S DISEASE THERAPIES RESEARCH UPDATE HUNTINGTON S DISEASE MULTIDISCIPLINARY CLINIC HUNTINGTON S DISEASE THERAPIES RESEARCH UPDATE From gene to treatments The gene that causes Huntington s disease (HD) was discovered in 1993. Since then, enormous

More information

Guidance. 2. Definitions. 1. Introduction

Guidance. 2. Definitions. 1. Introduction Work with naked DNA or RNA (including oligonucleotides, sirna, mirna, sequences that code for highly biologically active molecules and full length viral genomes) Guidance 1. Introduction The following

More information

Mir-X mirna First-Strand Synthesis Kit User Manual

Mir-X mirna First-Strand Synthesis Kit User Manual User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh

More information

Chapter 18 Regulation of Gene Expression

Chapter 18 Regulation of Gene Expression Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection

More information

Complex multicellular organisms are produced by cells that switch genes on and off during development.

Complex multicellular organisms are produced by cells that switch genes on and off during development. Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Real-Time PCR Vs. Traditional PCR

Real-Time PCR Vs. Traditional PCR Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives

More information

Lecture 6. Regulation of Protein Synthesis at the Translational Level

Lecture 6. Regulation of Protein Synthesis at the Translational Level Regulation of Protein Synthesis (6.1) Lecture 6 Regulation of Protein Synthesis at the Translational Level Comparison of EF-Tu-GDP and EF-Tu-GTP conformations EF-Tu-GDP EF-Tu-GTP Next: Comparison of GDP

More information

CHAPTER 40 The Mechanism of Protein Synthesis

CHAPTER 40 The Mechanism of Protein Synthesis CHAPTER 40 The Mechanism of Protein Synthesis Problems: 2,3,6,7,9,13,14,15,18,19,20 Initiation: Locating the start codon. Elongation: Reading the codons (5 3 ) and synthesizing protein amino carboxyl.

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

Understanding series. new. directions. 1-800-298-2436 LungCancerAlliance.org. A guide for the patient

Understanding series. new. directions. 1-800-298-2436 LungCancerAlliance.org. A guide for the patient Understanding series LUNG CANCER: new treatment directions 1-800-298-2436 LungCancerAlliance.org A guide for the patient TABLE OF CONTENTS What s New in lung cancer? Advancements...4 Changes in genes that

More information

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells. Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: [email protected].

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu. Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: [email protected] What is Gene Expression & Gene Regulation? 1. Gene Expression

More information

Chapter 5: Organization and Expression of Immunoglobulin Genes

Chapter 5: Organization and Expression of Immunoglobulin Genes Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed

More information

2013 W. H. Freeman and Company. 26 RNA Metabolism

2013 W. H. Freeman and Company. 26 RNA Metabolism 2013 W. H. Freeman and Company 26 RNA Metabolism CHAPTER 26 RNA Metabolism Key topics: Transcription: DNA-dependent synthesis of RNA Capping and splicing: RNA processing Overview of RNA Function Ribonucleic

More information

Overview of Phase 1 Oncology Trials of Biologic Therapeutics

Overview of Phase 1 Oncology Trials of Biologic Therapeutics Overview of Phase 1 Oncology Trials of Biologic Therapeutics Susan Jerian, MD ONCORD, Inc. February 28, 2008 February 28, 2008 Phase 1 1 Assumptions and Ground Rules The goal is regulatory approval of

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

Prospects for Vaccines against Hepatitis C Viruses. T. Jake Liang. M.D. Liver Diseases Branch NIDDK, NIH, HHS

Prospects for Vaccines against Hepatitis C Viruses. T. Jake Liang. M.D. Liver Diseases Branch NIDDK, NIH, HHS Prospects for Vaccines against Hepatitis C Viruses T. Jake Liang. M.D. Liver Diseases Branch NIDDK, NIH, HHS HCV Vaccine Prevention strategies Protective immunity Barriers and solutions Vaccine candidates

More information

NO CALCULATORS OR CELL PHONES ALLOWED

NO CALCULATORS OR CELL PHONES ALLOWED Biol 205 Exam 1 TEST FORM A Spring 2008 NAME Fill out both sides of the Scantron Sheet. On Side 2 be sure to indicate that you have TEST FORM A The answers to Part I should be placed on the SCANTRON SHEET.

More information

A Genetic Analysis of Rheumatoid Arthritis

A Genetic Analysis of Rheumatoid Arthritis A Genetic Analysis of Rheumatoid Arthritis Introduction to Rheumatoid Arthritis: Classification and Diagnosis Rheumatoid arthritis is a chronic inflammatory disorder that affects mainly synovial joints.

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Viral Replication. Viral Replication: Basic Concepts

Viral Replication. Viral Replication: Basic Concepts Viral Replication Scott M. Hammer, M.D. Viral Replication: Basic Concepts Viruses are obligate intracellular parasites Viruses carry their genome (RNA or DNA) and sometimes functional proteins required

More information

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3

DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3 DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can

More information

VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10

VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10 Topic J10+11: Molecular-biological methods + Clinical virology I (hepatitis A, B & C, HIV) To study: PCR, ELISA, your own notes from serology reactions Task J10/1: DNA isolation of the etiological agent

More information

Hormones & Chemical Signaling

Hormones & Chemical Signaling Hormones & Chemical Signaling Part 2 modulation of signal pathways and hormone classification & function How are these pathways controlled? Receptors are proteins! Subject to Specificity of binding Competition

More information

PreciseTM Whitepaper

PreciseTM Whitepaper Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

PRACTICE TEST QUESTIONS

PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

Pharmacology skills for drug discovery. Why is pharmacology important?

Pharmacology skills for drug discovery. Why is pharmacology important? skills for drug discovery Why is pharmacology important?, the science underlying the interaction between chemicals and living systems, emerged as a distinct discipline allied to medicine in the mid-19th

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

Summary of Discussion on Non-clinical Pharmacology Studies on Anticancer Drugs

Summary of Discussion on Non-clinical Pharmacology Studies on Anticancer Drugs Provisional Translation (as of January 27, 2014)* November 15, 2013 Pharmaceuticals and Bio-products Subcommittees, Science Board Summary of Discussion on Non-clinical Pharmacology Studies on Anticancer

More information

Genetic Testing in Research & Healthcare

Genetic Testing in Research & Healthcare We Innovate Healthcare Genetic Testing in Research & Healthcare We Innovate Healthcare Genetic Testing in Research and Healthcare Human genetic testing is a growing science. It is used to study genes

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

DNA and Forensic Science

DNA and Forensic Science DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

Genetic Engineering and Biotechnology

Genetic Engineering and Biotechnology 1 So, what is biotechnology?? The use of living organisms to carry out defined chemical processes for industrial or commercial application. The office of Technology Assessment of the U.S. Congress defines

More information

European Medicines Agency

European Medicines Agency European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein

More information

GENE REGULATION. Teacher Packet

GENE REGULATION. Teacher Packet AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures

More information

RNA and Protein Synthesis

RNA and Protein Synthesis Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic

More information

Interaktionen von Nukleinsäuren und Proteinen

Interaktionen von Nukleinsäuren und Proteinen Sonja Prohaska Computational EvoDevo Universitaet Leipzig June 9, 2015 DNA is never naked in a cell DNA is usually in association with proteins. In all domains of life there are small, basic chromosomal

More information

ELISA BIO 110 Lab 1. Immunity and Disease

ELISA BIO 110 Lab 1. Immunity and Disease ELISA BIO 110 Lab 1 Immunity and Disease Introduction The principal role of the mammalian immune response is to contain infectious disease agents. This response is mediated by several cellular and molecular

More information

To be able to describe polypeptide synthesis including transcription and splicing

To be able to describe polypeptide synthesis including transcription and splicing Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain

More information

Hapten - a small molecule that is antigenic but not (by itself) immunogenic.

Hapten - a small molecule that is antigenic but not (by itself) immunogenic. Chapter 3. Antigens Terminology: Antigen: Substances that can be recognized by the surface antibody (B cells) or by the TCR (T cells) when associated with MHC molecules Immunogenicity VS Antigenicity:

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

Actions of Hormones on Target Cells Page 1. Actions of Hormones on Target Cells Page 2. Goals/ What You Need to Know Goals What You Need to Know

Actions of Hormones on Target Cells Page 1. Actions of Hormones on Target Cells Page 2. Goals/ What You Need to Know Goals What You Need to Know Actions of Hormones on Target Cells Graphics are used with permission of: Pearson Education Inc., publishing as Benjamin Cummings (http://www.aw-bc.com) Page 1. Actions of Hormones on Target Cells Hormones

More information

The Body s Defenses CHAPTER 24

The Body s Defenses CHAPTER 24 CHAPTER 24 The Body s Defenses PowerPoint Lectures for Essential Biology, Third Edition Neil Campbell, Jane Reece, and Eric Simon Essential Biology with Physiology, Second Edition Neil Campbell, Jane Reece,

More information

Luca Romagnoli, Ph.D. Business Development Manager

Luca Romagnoli, Ph.D. Business Development Manager Modelli innovativi di produzione per lo sviluppo di un processo altamente qualitativo di farmaci biologici Luca Romagnoli, Ph.D. Business Development Manager BIOLOGICAL DRUGS - SOURCES Monoclonal antibodies

More information

AP BIOLOGY 2009 SCORING GUIDELINES

AP BIOLOGY 2009 SCORING GUIDELINES AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following

More information

BioBoot Camp Genetics

BioBoot Camp Genetics BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before

More information

RIBOPROTECT. RNase Inhibitor RT33-020, RT33-100

RIBOPROTECT. RNase Inhibitor RT33-020, RT33-100 RIBOPROTECT RT33-020, RT33-100 RT33-020, RT33-100 RIBOPROTECT The RIBOPROTECT is a recombinant protein isolated and purified from Escherichia coli. It inhibits ribonuclease (RNase) activity of enzymes

More information

OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation

OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation -Optimal strategies to a successful mirna research project Optimal strategies to a successful mirna research

More information

Helices From Readily in Biological Structures

Helices From Readily in Biological Structures The α Helix and the β Sheet Are Common Folding Patterns Although the overall conformation each protein is unique, there are only two different folding patterns are present in all proteins, which are α

More information