法 科 学 技 術,12(1),83 96(2007) 83 Original Article Mitochondrial DNA Sequence Variation and Phylogenetic Analysis in Japanese Individuals from Miyazaki Prefecture Taketo Uchiyama 1, Rinnosuke Hisazumi 1, Kenshi Shimizu 1, Kazuhiko Imaizumi 2, Kazumasa Sekiguchi 2 and Kentaro Kasai 2 Forensic Science Laboratory, Miyazaki Prefectural Police H.Q. 1 8 28, Asahi, Miyazaki 880 8509, Japan 1 National Research Institute of Police Science 6 3 1, Kashiwanoha, Kashiwa, Chiba 277 0882, Japan 2 (Received 23 August 2006; accepted 26 October 2006) Sequence variation in hypervariable regions HV1 and HV2 in the control region of mitochondrial DNA (mtdna) was studied in 100 unrelated Japanese individuals living in Miyazaki Prefecture (in southern Japan) by PCR ampliˆcation and direct sequencing. PCR and sequencing primer sets designed for the C stretch region at around position 16189 in HV1 and position 310 in HV2 were used. Sequence comparison revealed the existence of 90 dišerent haplotypes in 120 variable positions, and of these 82, were unique, 6 were observed twice and 2 were observed three times. Genetic diversity was estimated at 0.999 and the probability of two randomly selected sequences matching (Random Match Probability, RMP) was 1.24. TheC stretch region in HV1 was observed in 35 of individuals. The average number of nucleotide dišerences was 9.61 for HV1 and HV2. The majority of sequence variations were substitutions, particularly transitions from thymidine to cytosine (42.6 ). Sequence heteroplasmy was not found in this study. Based on the observed polymorphic sites in HV1 and HV2, haplogroups D4 (D4a), M7a, M7b, N9a were the most commonly observed clusters. The resulting data were compared with some existing Japanese mtdna databases. The present data contribute to expansion of the Japanese mtdna database, particularly the database for Miyazaki Prefecture. These results show that an mtdna database is very useful in forensic examination for identiˆcation of individuals. Key words: Mitochondrial DNA, Hypervariable region, HV1, HV2, Haplogroup, Phylogeny Introduction Human mitochondrial DNA (mtdna) is a 16,568 bp closed circular genome. Within the control region of the mtdna lie hypervariable region 1 (HV1) and hypervariable region 2 (HV2). The complete nucleotide sequence of humanmtdnawasdeterminedin1981 1) and reanalysis of the Cambridge reference sequence was carried out in 1999 2). mtdna is highly polymorphic due to a rapid rate of evolution 3), and is inherited maternally 4). mtdna is present in high copy number in each cell (1,000 10,000 copies) compared with nuclear DNA 5),ofwhich there is only a single copy per cell. Use of
84 Taketo Uchiyama et al. mtdna may thus provide results in situations where DNA typing with nuclear markers would not be successful, such as for highly degraded specimens, skeletal material, hair shafts and buried materials 6 9). For forensic applications of mtdna, population data for these polymorphic regions have been reported for several ethnic groups, including Asian 10 28) and Caucasian 28 34) populations. Analysis of mtdna has become a powerful tool for forensic and population genetic analyses. Sequence analysis of mtdna in forensic casework is useful if there is a large population database available on the basis of which to estimate the probability of two randomly selected sequences matching. Thus, it is important that mtdna sequence databases continue to be expanded, so they will become more reliable as tools for forensic analysis. A greater number of reliable mtdna data sets for the Japanese population are required to expand thedatabasefortheforensiccommunity. In the present study, we present a new database of mtdna sequences from a Japanese population. The aim of the study was to expand an mtdna database with reference to hypervariable segments HV1 and HV2 in the control region for 100 unrelated Japanese individuals living in Miyazaki prefecture (southern Japan), and show that the expanded database can be used in haplogroup-based comparisons for forensic and population genetic analyses along with other Japanese databases. The database will facilitate interpretation of results from mtdna sequence analysis in forensic casework performed in Japan. Materials and methods 1. Samples and DNA extraction Blood was obtained from 100 unrelated healthy Japanese individuals living in Miyazaki prefecture. Total DNA was extracted from blood samples by digestion in extraction bušer (TNE bušer: 100 mm Tris HCl, ph 8.0; 500 mm NaCl; 10 mm EDTA, including 1 SDS) with proteinase K (100 mg/ml) for 1 hour at 70 C and subsequent extraction using the QIAamp DNA Mini kit (QIAGEN) in accordance with the manufacturer's instructions. 2. PCR ampliˆcation PCR was performed on 2 ng of each DNA extract. The two hypervariable regions in the mtdna control region, HV1 and HV2, were each ampliˆed in a total of 50 ml ofpcrmix consisting of 0.5 mm of each primer, 1 PCR reaction bušer (10 mm Tris HCl, ph 8.3; 50 mm KCl; 1.5 mm MgCl 2 ), 200mM of each dntp, 5 U AmpliTaq DNA polymerase (Applied Biosystems) and 8 mg BSA. The primers used are listed in Table 1 8).Fivesetsof primers (HV1 A: L15997/H16401; HV1 B: L15997/H16173; HV1 C: L16208/H16401; HV2 D: L00029/H00438; and HV2 E: L00029/ H00290) canbeusedtoamplifyanddetermine the entire sequence of HV1 and HV2 (Fig. 1). Three of these primers (HV1 B, HV1 C and HV2 E) are for DNA samples that contain the C stretch region, a nucleotide transition from T to C at position 16189 and 310. Ampliˆcation was carried out in a GeneAmp PCR System 9700 (Applied Biosystems) under the following conditions: 33 cycles of 95 Cfor45s,60 Cfor30 s (60 ) and 72 C for 2 min. After PCR, 5 mlof the product was separated by electrophoresis on a2 agarose gel for 30 min, and the PCR products were visualized by ethidium bromide staining followed by UV transillumination. 3. Cycle sequencing and electrophoresis After PCR ampliˆcation, each PCR product was puriˆed using the QuickStep 2 PCR Puriˆcation Kit (Edge Biosystems). Cycle sequencing reactions were carried out using the BigDye TM Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems) on a GeneAmp PCR System 9700 ( Applied Biosystems) in a total reaction volume of 10 ml. Sequence analysis was performed directly on the puriˆed products using the M13 primer (Table 1) under the following conditions: 25 cycles of 96 C for15s,50 C for5s(60 ) and 60 C for 2 min. After the sequencing reaction, residual dye terminators were removed using the QuickStep 2 PCR Puriˆcation Kit (Edge Biosystems) and the products were dried in a
Variation and phylogeny of mtdna in Miyazaki Pref. 85 Fig. 1 Schematic representation of PCR primers and the regions for ampliˆcation of the HV1 and HV2 region. Table 1 Sequence of primers used for ampliˆcation and sequencing. Ampliˆcation Primer Nucleotide sequence L15997F (M13) (38 mer) 5 tgtaaaacgacggccagtcaccattagcacccaaagct 3 L16208F (M13) (37 mer) 5 tgtaaaacgacggccagtccccatgcttacaagcaag 3 H16173R (Rev) (35 mer) 5 caggaaacagctatgaccgggggggtttgatgtgg 3 H16401R (Rev) (38 mer) 5 caggaaacagctatgacctgatttcacggaggatggtg 3 L00029F (M13) (40 mer) 5 tgtaaaacgacggccagtggtctatcaccctattaaccac 3 H00438R (Rev) (39 mer) 5 caggaaacagctatgaccgggaaaataatgtgttagttg 3 H00290R (Rev) (38 mer) 5 caggaaacagctatgaccgggggggtttggtggaaatt 3 Sequencing Primer Nucleotide sequence Universal (M13)(18 mer) 5 tgtaaaacgacggccagt 3 Reverse (Rev) (18 mer) 5 caggaaacagctatgacc 3 vacuum concentrator. The samples were run on a 3130xl genetic analyzer (Applied Biosystems). The sequences from 15997 to 16401 in HV1 and from 29 to 438 in HV2 were determined. 4. Data analysis DNA sequences were analyzed by using ABI Prism Sequencing Analysis software version 3.3 (Applied Biosystems) and comparisons were made using ABI Prism Sequence Navigator Software version 1.01 (Applied Biosystems). The resulting sequence data were aligned and compared with the reference sequence 1).The genetic characteristics of the control region were calculated in accordance with Nei 35) and Tajima 36). mtdnas were classiˆed into (sub) haplogroups based on the HV1 and HV2 motifs of the haplogroup-speciˆc sequences described in recent surveys 19 26). Results and discussion mtdna HV1 (positions 15997 16401) and HV2 (positions 29 438) sequences were determined from a total of 100 unrelated Japanese individuals living in Miyazaki prefecture. Each mtdna sequence was a consensus sequence of that determined by the forward and reverse sequencing reactions using 5 primer sets 8) (Fig. 1 and Table 1). ThevariablesitesofthemtDNAcontrol region are summarized in Fig. 2 for both hypervariable regions. For 100 individuals, 76 variable sites were detected in HV1, and 44 variable sites were detected in HV2. Four rare variable sites and two novel variable sites were noted in this study compared with other investigations concerning the Japanese population 11 16). These nucleotide substitutions occurred at positions 16160 ( nucleotide transversion from A to T), 16212 (nucleotide transition from A to G), 16219 (nucleotide transition from A to G), 16342 (nucleotide transition from T to C), 228 (nucleotide transversion from G to T) and 408 (nucleotide transversion from T to A), and were observed
86 Taketo Uchiyama et al. Fig. 2 List of variable sites observed in the hypervariable regions (HV1 and HV2) of mtdna control region obtained from 100 unrelated Japanese individuals. Anderson's reference sequence is shown at the top. Dot shows the identical nucleotide with the reference.
Variation and phylogeny of mtdna in Miyazaki Pref. 87 Fig. 2 continued
88 Taketo Uchiyama et al. Table 2 Type of nucleotide change Types of nucleotide replacement observed in Japanese individuals (southern Japan, Miyazaki). HV1 HV2 This study Seo et al. [12] This study Seo et al. [12] n=100 n=100 n=100 n=100 Transition A G 18(13) 22(15) 220(11) 218(13) G A 46( 5) 37( 6) 13( 6) 15( 6) C T 146(25) 174(33) 27( 6) 27( 4) T C 189(29) 187(22) 48(11) 59( 9) subtotal 399(72) 420(76) 308(34) 319(32) Transversion A C 32( 3) 34( 3) A T 1( 1) 1( 1) C A 9( 3) 8( 3) C G 6( 3) T A 1( 1) 1( 1) T G 1( 1) subtotal 42( 7) 49(10) 2( 2) 1( 1) Insertion A 2( 1) G 1( 1) C 1( 1) 195( 4) 191( 6) T 1( 1) subtotal 1( 1) 195( 4) 195( 9) Deletion A 11( 3) 11( 2) C 4( 1) 1( 1) subtotal 15( 4) 12( 3) Total 441(79) 470(87) 520(44) 527(45) only once each in this study (Fig. 2 and Table 2). A search for these SNPs in an mtsnp database (http://www.giib.or.jp/mtsnp/index. shtml ) 19,20) revealed that the nucleotide substitution at position 16212 has been observed in Asians (Japanese, n=2) and Africans (n= 1), the nucleotide substitution at position 16342 in Asians (Japanese, n=1) and Europeans (n= 4), the nucleotide substitution at position 408 in Asians (Japanese, n=4 and Chinese, n=1) and Africans (n=1), and the nucleotide substitution at position 16219 in Europeans (n=13), but 16219 was a rare SNPs that as had not been previously conˆrmed in the Japanese population. Furthermore, the 16160 and 228 nucleotide substitutions were new SNPs which have not been previously reported. Sequence heteroplasmy was not found in this study. Table 2 shows the types of nucleotide substitution observed in each hypervariable region as found in this study and a previously reported Japanese mtdna sequence database by Seo et al. 12), in comparison with the reference sequence of Anderson et al. 1). In the present study, transitions make up the majority of the nucleotide substitutions ( 73.57 ). Transversions (4.58 ), insertions (20.29 ) and deletions (1.56 ) were also observed. Nucleotide substitutions at positions 16223 (nucleotide transition from C to T) and 16362 (nucleotide transition from T to C) in HV1, and at 73 (nucleotide transition from A to G) and 263 (nucleotide transition from A to G) in HV2 were found at frequencies of 83, 42, 100 and 96, respectively. Insertion of C at positions 309.1 and 315.1 in HV2 occurred at frequencies of 72 and 97, respectively. Twenty-four individuals had double C insertions at position 309.1 and
Variation and phylogeny of mtdna in Miyazaki Pref. 89 309.2 (Fig. 2). Deletions were found at 4 positions (249, 290, 291 and 309) in the HV2 region. The nucleotide sequence from 16184 to 16193 in HV1 contained serially repeated stretches of C when the nucleotide transition from T to C at position 16189 was present. In the present study, this nucleotide transition was observed in 35 individuals (Fig. 2 and Table 3). Table 4 summarizes all of the variable sequences from 16180 to 16195 in HV1 observed in our study. A total of 7 types of sequence variations were noted. Among them, 22 individuals had nucleotide transversions from A to C at positions 16182 or 16183 or both positions. In the combined sample of 417 individuals from the present study and three databases of Japanese mtdna previously reported (n=55, Sekiguchi et al. 11),n=100, Seo et al. 12),n=162, Imaizumi et al. 14) ), a total of 20 types of sequence variations were observed (Table 3). The nucleotide transition from T to C at position 16189 was found in 37.65 of individuals. For the 100 individuals of the present study, 74 dišerent HV1 haplotypes and 55 dišerent HV2 haplotypes were observed. When the HV1/ 2 sequences were analyzed together, they yielded 90 dišerent haplotypes characterized by 120 variable sites (Table 4). From these, 82 sequences were noted only once in the individuals of the present study, 6 were observed twice and 2 were observed 3 times (Table 4). The average number of nucleotide dišerences between the 100 sequences at the combined HV1/2 region was 9.61. The random match probability (RMP) testing using P=SX 2 (where X is the frequency of a mtdna genotype) gave valuesof2.1 forhv1,4.62 for HV2 and Table 3 Sequence variations and their frequencies around the C stretch observed between nt 16184 and 16193 of HV1. Nucleotide position 16180 16181 16182 16183 16184 16185 16186 16187 16188 16189 16190 16191 16192 16193 16194 16195 This study n=100 Combined database b) n=417( ) 1 a) A A A A C C C C C T C C C C A T 58 238(57.1) 2 T 2 7( 1.7) 3 T 5 21( 5.0) 4 T 1( 0.2) 5 T 1( 0.2) 6 C 1( 0.2) 7 C C 1( 0.2) 8 C C C 9 47(11.3) 9 C C C C C 1( 0.2) 10 C C C G C 1( 0.2) 11 C C C del del 1( 0.2) 12 C C 12 49(11.8) 13 C C G C 1 3( 0.7) 14 C C C C 1( 0.2) 15 C A C 1( 0.2) 16 C T C del 1( 0.2) 17 C T C del 1( 0.2) 18 C 13 36( 8.6) 19 C G C 3( 0.7) 20 T C 2( 0.5) a) : Sequence variation type 1 is identical with the Anderson's reference sequence. b) : Results from combined Japanese database with Sekiguchi et al. (n=55), Seo et al. (n=100) and Imaizumi et al. (n=162)
90 Taketo Uchiyama et al. Number of times observed Table 4 Frequency distribution of mtdna types in the Japanese databases. This study Combined database a) Number of mtdna types Number of mtdna types Total HV HV HV and HV HV and HV 1 61 46 82 82 306 306 2 6 1 6 12 18 36 3 5 1 2 6 7 21 4 1 0 0 0 2 8 5 0 2 0 0 1 5 6 0 3 0 0 1 6 7 0 1 0 0 2 14 8 1 0 0 0 0 0 10 0 0 0 0 1 10 11 0 0 0 0 1 11 14 0 1 0 0 0 0 Total 74 55 90 100 339 417 Genetic diversity 0.992 0.971 0.999 0.998 Random match probability 2.10 4.62 1.24 0.49 a) : Results from combined Japanese database with Sekiguchi et al. (n=55), Seo et al. (n=100) and Imaizumi et al. (n=162) Total 1.24 for HV1/2. The genetic diversity, utilizing h=(1-sx 2 )n/n-1 (n=sample size) was estimated to be 0.992 for HV1, 0.971 for HV2 and 0.999 for HV1/2 (Table 4). Similar values were obtained from other Japanese populations analyzed for the HV1/2 regionof mtdna: 0.999 by Seo et al. 12) and 0.997 by Imaizumi et al. 14) for both regions combined. In the combined Japanese database of 417 individuals 11,12,14), 339 dišerent haplotypes were characterized, and 306 sequences were noted only once, 18 were observed twice and 7 were observed 3 times. The genetic diversity and RMP were 0.998 and 0.49, respectively (Table 4). When study of genetic variation is used to help resolve identity in missing persons and criminal cases, analysis of the control region is generally performed, but not analysis of the coding region. Classiˆcation of haplogroups based only on control region data has been previously reported 25,27). If a phylogenetic tree based on control region data is used as a reference for classiˆcation, then the haplogroup of forensic sample can be more easily estimated. Figure 3 illustrates a phylogenetic tree constructed on the basis of the HV1 and HV2 motifs of haplogroup-speciˆc sequences of East Asian populations described in recent surveys 19 25). The tree is rooted in haplogroup L3 32,37). Black boxes are super-haplogroups (M, NandR), gray boxes are East Asian-speciˆc major-haplogroups (A,B,CZ,D,F,G,M7, M8, M9, M10, M11 and N9), white background boxes are sub-haplogroups observed in the present study, mainly (A4, A5, B4 (B4a, B4b, B4b1, B4b1a1), B5(B5a, B5b), F1(F1a, F1b, F1c), F2(F2a), C,D4(D4a, D4b1a, D4b2b), D5 (D5a, D5a1, D5a2), M9a,G1(G1a, G1b), G2 (G2a1, G2a1a), G4a, M7a (M7a1), M7b (M7b1, M7b2), M7c, M8a, M10a, N9 (N9a1, N9a2) and Y) 17 26). The polymorphic sites observed in HV1 and HV2 are summarized in Fig. 3 and Table 5. An underline shows informative SNPs of control regions. For reference, characteristic SNPs of coding regions 19,23,24) are shown by a double box (Fig. 3: the SNPs of coding region was not analyzed in this study). For each haplogroup, nt positions
Variation and phylogeny of mtdna in Miyazaki Pref. 91 Fig. 3 Phylogenetic tree of Japanese mtdna haplogroups based on polymorphic sites in HV1 and HV2. Black boxes are super-haplogroups, gray boxes are East Asian-speciˆc major-haplogroups and white background boxes are sub-haplogroups. Underline shows SNPs of control regions and double box shows SNPs of coding regions. 73, 263, and 315.1 were ignored in haplogroup classiˆcation. Using the phylogenetic tree, haplogroups were estimated in the present study and compared with a previously reported Japanese mtdna databases, Miyazaki 12), Tokyo 11,14). As a result, among the present study of 100 unrelated Japanese individuals living in Miyazaki prefecture, a classiˆcation to haplogroup was possible for 99 individuals. As for the one remaining subject, the HV1 sequence was completely identical to the reference sequence 1), suggesting the possibility of an origin other than Japan. Within the mtdna haplogroups identiˆed in this study, major haplogroups of East Asian populations, which showed frequencies greater than 5,wereA(12 ),B(9 ),D(30 ),FandG(6 each),m7 (30 ) and N9 (6 ). A total of 37 subhaplogroups were observed (Table 5). TheD4 haplogroup (n=16) was found with the highest frequency followed by haplogroups M7a1 (n= 15), D4a/M7b2/N9a2 (n=5 each), A/A4/A5 (n=4 each), andb4b1a1/d4b2b/d5a/f1b (n =3each). In other Japanese mtdna databases, estimate of haplogroup was possible for 48 out of 55 individuals 11), 80 out of 100 individuals 12), and 143 out of 162 individuals 14), respectively. Similar frequency values were also obtained from these Japanese mtdna databases (Table 5). Figure 4 shows the haplogroup frequencies observed in a Japanese population from the
92 Taketo Uchiyama et al. Table 5 Haplogroup frequencies observed in Japanese population (based on polymorphic sites observed at HV1 and HV2). Haplogroup Major Sub HV1 and HV2 proˆle Number of sequences found (n) Miyazaki Tokyo Sekiguchi Seo [12] [11] (n=100) (n=55) This study (n=100) Imaizumi [14] (n=162) A 16223T, 16290T, 16319A, 235G 4 0 1 2 A A4 16223T, 16290T, 16319A, 16362C, 235G 4 0 0 1 A5 16187T, 16223T, 16290T, 16319A, 235G 4 3 4 8 B4 16183C, 16189C, 16217C 2 2 1 7 B4a 16182C, 16183C, 16189C, 16217C, 16261T 2 2 1 2 B4b1 16136C, 16183C, 16189C, 16217C, 0 2 1 0 B 16136C, 16183C, 16189C, 16217C, 16284G, 199T, B4b1a1 202G, 207A 3 2 2 2 B5 16140C, 16183C, 16189C, 0 2 1 0 B5b 16140C, 16183C, 16189C, 16243C, 204C 2 2 2 3 D4 16223T, 16362C 16 27 8 37 D4a 16129A, 16223T, 16362C, 152C 5 5 2 7 D4b1 16223T, 16319A, 16362C, 152C 1 0 3 1 D D4b2b 16223T, 16291T, 16362C, 194T 3 0 1 0 D5 16183C, 16189C, 16223T, 16362C, 150T 1 0 1 4 D5a 16182C, 16183C, 16189C, 16223T, 16362C, 150T 3 0 0 6 D5a2 16164G, 16172C, 16182C, 16183C, 16189C, 16223T, 16266T, 16362C, 150T 1 0 1 0 F1a 16129A, 16162G, 16172C, 16304C, 249D 2 0 1 3 F F1b (16183C), 16189C, 16304C, 249D 3 0 4 7 F2a 16203G, 16291T, 16304C, 249D 1 0 0 0 G1a 16223T, 16325C, 16362C, 150T 1 2 1 5 G1b 16184T, 16214T, 16223T, 16362C 1 0 1 0 G2a1 16189C, 16223T, 16227G, 16278T, 16362C 1 1 1 3 G 16183C, 16189C, 16194G, 16195C, 16223T, G2a1a 1 0 0 4 16227G, 16278T, 16362C G4a 16223T, 16274A, 16362C 2 0 0 0 M 16223T 2 1 0 0 M7a 16209C, 16223T 2 0 1 2 M7a1 16209C, 16223T, 16324C 15 12 4 9 M7 16129A, 16189C, 16223T, 16297C, 16298C, 150T, M7b2 5 5 1 9 199C M7c 16223T, 146C, 199C 0 3 1 2 M8 M8 16223T, 16298C 1 3 0 0 M8a 16184T, 16223T, 16298C, 16319A 1 2 0 1 M9 M9a 16223T, 16234T, 16316G, 16362C 1 2 0 4 M10 M10 16093C, 16129A, 16223T, 16266T, 16311C, 16357C 1 1 1 5 M11 M11 16223T, 215G, 318C, 326G 1 0 1 1 N9 N9a2 16172C, 16223T, 16257A, 16261T, 150T 5 1 2 5 Y 16126C, 16231C, 16266T, 146C 1 0 0 1 CZ C 16223T, 16298C, 16327T, 249D 1 0 0 2 others 1 20 7 19
Variation and phylogeny of mtdna in Miyazaki Pref. 93 Fig. 4 Major haplogroup frequencies observed in the Japanese population. (based on polymorphic sites observed at HV1 and HV2, Miyazaki [white n=200], Tokyo[black n=217]). Miyazaki area (combined data from the present study and Seo et al. 12),n=200) and the Tokyo area (Sekiguchi et al. 11) and Imaizumi et al. 14),n =217). The D4 haplogroup was found with the highest frequency (21.5 ), which was similar to the frequency found for Japanese individuals (19.6 ) in the SWAGDAM data set 23).The frequency of the M7a1 haplogroup observed in the combined Miyazaki database was 13.5, which was high compared with the mtdna database of the Tokyo area (5.9 ). The data for the combined Miyazaki database were similar to M7a1 data from Okinawa as gathered by Kivisild et al. 22). In conclusion, the present data contributes to expansion of the Japanese mtdna database, particularly the database for Miyazaki Prefecture. The results show that an mtdna database with a high genetic diversity, a small RMP and relatively high intrapopulation diversity which can be very useful in forensic examination such as the identiˆcation of individuals, by DNA typing of single hair shafts or skeletal remains. It is assumed that SNPs information of coding region is important for a correct classiˆcation of the haplogroup. However, there is SNPs position of coding region in a wide area of mtdna as shown in the double box of Fig. 3, and it is di cult to analyze all. In this study, the SNPs of coding region was not analyzed. It was based on a phylogenetic tree of the haplogroup classiˆcation that has already been reported (Fig. 3, underline) 21 23,37) and the data was used only for the control region (HV1 and HV2) which was analyzed in this study. As a result it is possible to use the genetic position for distinguishing of haplogroups. An estimate of haplogroup showed a possibility for 99 out of 100 unrelated Japanese individuals. The phylogenetic tree constructed on the basis of the
94 Taketo Uchiyama et al. control region will be a useful tool when it is used to classify the Japanese haplogroup of mtdna in forensic analysis and even if it is data only of the control region, as to some extent a classiˆcation of Haplogroup is possible and it may become ešective at a business level in the future. References 1) Anderson, S., Bankier, A. T., Barrell, B. G., De Bruijn, H. L., Coulson, A. R., Drouin, J., Eperon, I. C., Nierlich, D. P., Roe, B. A., Sanger, F., Schreier, P. H., Smith, A. J. H., Staden, R., Young, I. G.: Sequence and organization of the human mitochondrial genome. Nature., 290, 457 465 (1981). 2) Andrews, R. M., Kubacka, I., Chinnery, P. F., Lightowlers, R. N., Turnbull, D. M., Howell, N.: Reanalysis and revision of the Cambridge reference sequence for human mitochondrial DNA. Nat. Genet., 23, 147 (1999). 3) Cann, R. L., Stoneking, M., Wilson, A. C.: Mitochondrial DNA and human evolution. Nature., 325, 31 36 (1987). 4) Giles,R.E.,Blanc,H.,Cann,H.M., Wallace, D. C.: Maternal inheritance of human mitochondrial DNA. Proc. Natl. Acad.Sci.USA., 77, 6715 6719 (1980). 5) Robin, E. D., Wong, R.: Mitochondrial DNA molecules and virtual number of mitochondria per cell in mammalian cells. J. Cell Physiol., 136, 507 513 (1988). 6) Seo, Y., Uchiyama, T., Shimizu, K., Takahama, K.: Identiˆcation of remains by sequencing of mitochondrial DNA control region. Am. J. Forensic Medicine and Pathology., 20(3), 138 143 (2000). 7) Seo, Y., Uchiyama, T., Matsuda, H., Shimizu, K., Takami, Y., Nakayama, T., Takahama, K.: Mitochondrial DNA and STR typing of matter adhering to an earphone. J. Forensic Sci., 47, 605 608 (2002). 8) Sekiguchi, K., Imaizumi, K., Matsuda, H., Mizuno, N., Yoshida, K., Senju, H., Sato, H., Kasai, K.: MtDNA analysis using capillary electrophoresis and its application to the analysis of mtdna in hair. Jpn. J. Sci. Tech. Iden., 7(2), 123 130 (2003). 9) Imaizumi,K.,Noguchi,K.,Shiraishi,T., Sekiguchi, K., Senju, H., Fujii, K., Yoshida, K., Kasai, K., Yoshino, M.: DNA typing of bone specimens-the potential use of the proˆler test as a tool for bone identiˆcation. Legal Med., 7, 31 41 (2005). 10) Yoshii, T., Takeda, E., Akiyama, K., Ishiyama, I.: Sequence polymorphisms of mitochondrial DNA and its forensic application (in Japanese). Legal Med., 49 (4), 242 250 (1995). 11) Sekiguchi, K., Imaizumi, K., Fujii, K., Senju, H., Mizuno, N., Sakai, I., Kasai, K., Sato, H., Seta, S.: Sequence polymorphisms of the control region of human mitochondrial DNA in Japanese Population (in Japanese). Jpn. J. Sci. Tech. Iden., 2,33 40 (1997). 12) Seo, Y., Stradmann-Bellinghausen, B., Rittner, C., Takahama, K., Schneider, P. M.: Sequence polymorphism of mitochondrial DNA control region in Japanese. Forensic Sci. Int., 97, 155 164 (1998). 13) Nishimaki, Y., Sato, K., Fang, L., Ma, M., Hasekura, H., Boettcher, B.: Sequence polymorphism in the mtdna HV1 region in Japanese and Chinese. Legal Med., 1, 238 249 (1999). 14) Imaizumi, K., Parsons, T. J., Yoshino, M., Holland, M. M.: A new database of mitochondrial DNA hypervariable regions I and II sequences from 162 Japanese. Int. J. Legal Med., 116, 68 73 (2002). 15) Koyama, H., Iwasa, M., Maeno, Y., Tsuchimochi, T., Isobe, I., Seko-Nakamura, Y., Monma-Ohtaki, J., Matsumoto, T., Ogawa, S., Sato, B., Nagao, M.: Mitochondrial sequence haplotype in the Japanese population. Forensic Sci. Int., 125, 93 96 (2002). 16) Nagai, A., Nakamura, I., Shiraki, F., Bunai, Y., Ohya, I.: Sequence polymorphism
Variation and phylogeny of mtdna in Miyazaki Pref. 95 of mitochondrial DNA in Japanese individuals from Gifu Prefecture. Legal Med., 5, S210 S213 (2003). 17) Maruyama, S., Minaguchi, K., Saitou, N.: Sequence polymorphism of the mitochondrial DNA control region and phylogenetic analysis of mtdna lineages in the Japanese population. Int. J. Legal Med., 117, 218 225 (2003). 18) Jin,H.J.,Kwak,K.D.,Hong,S.B., Shin, D. J., Han, M. S., Tyler-Smith, C., Kim, W.: Forensic genetic analysis of mitochondrial DNA hypervariable region I/ II sequences: An expanded Korean population database. Forensic Sci. Int., 158, 125 130 (2006). 19) Tanaka, M., Cabrera, V. M., Gonzalez, A. M., Larruga, J. M., Takeyasu, T., Fuku, N., Guo, L. J., Hirose, R., Fujita, Y., Kurata, M., Shinoda, K., Umetsu, K., Yamada, Y., Oshida, Y., Sato, Y., Hattori, N., Mizuno, Y., Arai, Y., Hirose, N., Ohta, S., Ogawa, O., Tanaka, Y., Kawamori, M., Sakamoto-Nagai, M., Maruyama, W., Shimokata, H., Suzuki, R., Shimodaira, H.: Mitochondrial genome variation in Eastern Asia and the peopling of Japan. Genome Res., 14, 1832 1850 (2004). 20) Tanaka, M., Takeyasu, T., Fuku, N., Li- Jun, G., Kurata, M.: Mitochondrial genome single nucleotide polymorphisms and their phenotypes in the Japanese. Ann NY Acad Sci., 1011, 7 20 (2004). 21) Umetsu, K., Tanaka, M., Yuasa, I., Saitou, N., Takeyasu, T., Fuku, N., Naito, E.,Ago,K.,Nakayashiki,N.,Miyoshi,A., Kashimura, S., Watanabe, G., Osawa, M.: Multiplex ampliˆed product-length polymorphism analysis for repid detection of human mitochondrial DNA variations. Electrophoresis, 22, 3533 3538 (2001). 22) Umetsu, K., Tanaka, M., Yuasa, I., Adachi, N., Miyoshi, A., Kashimura, S., Park,Y,H.,Wei,Y,H.,Watanabe,G., Osawa, M.: Multiplex ampliˆed productlength polymorphism analysis of 36 mitochondrial single-nucleotide polymorphisms for haplogrouping of East Asian populations. Electrophoresis, 26, 91 98 (2005). 23) Umetsu, K., Yuasa, I.: Recent progress in mitochondrial DNA analysis. Legal Med., 7, 259 262 (2005). 24) Kivisild, T., Tolk, H. V., Parik, J., Wang, Y.,Papiha,S.,Bandelt,H.J.,Richard,V.: The emerging limbs and twigs of the East Asian mtdna tree. Mol. Biol. Evol., 19 (10), 1737 1751 (2002). 25) Allard,M.W.,Wilson,M.R.,Monson, K. L., Budowle, B.: Control region sequences for Far East individuals in the Scientiˆc Working Group on DNA Analysis Methods forensic mtdna data set. Legal Med., 6, 11 24 (2004). 26) Lee,H.Y.,Yoo,J.E.,Park,J.,Chung, U., Shin, K. J.: Mitochondrial DNA control region sequences in Koreans: identiˆcation of useful variable sites and phylogenetic analysis mtdna data quality control. Int. J. Legal Med., 120, 5 14 (2006). 27) Shee, C. Y., Chong, M. S. M., Ng, I., Chia, T. F.: Mitochondrial DNA hypervariable region 1 polymorphism in Singapore Chinese population. Legal Med., 7, 127 133 (2005). 28) Budowle, B., Wilson, M. R., DiZinno, J. A., StauŠer, C., Fasano, M. A., Holland, M. M., Monson, K. L.: Mitochondrial DAN region HV1 and HV2 population data. Forensic Sci. Int., 103, 23 35 (1999). 29) Carracedo, A., Aloja, E. D., Dupuy, B., Jangblad, A., Karjalainen, C., Lambert, W., Person, H., PfeiŠer, H., Pˆtzinger, H., Sabatier, M., Syndercombe Court, D., Vide, C.: Reproducibility of mtdna analysis between laboratories: a report of the European DNA proˆling group (EDNAP). Forensic Sci. Int., 97, 165 170 (1998). 30) Lutz, S., Weisser, H. J., Heizmann, J., Pollak, S.: Location and frequency of polymorphic positions in the mtdna control region of individuals from Germany. Int J Legal Med., 111, 67 77 (1998). 31) Parson, W., Parsons, T. J., Scheithauer,
96 Taketo Uchiyama et al. R., Holland, M. M.: Population data for 101 Austrian Caucasian mitochondrial DNA d loop sequences analysis to a forensic case. Int JLegalMed., 111, 124 132 (1998). 32 ) Alfonso-Sanchez, M. A., Martinez- Bouzas, C., Castro, A., Pena, J. A., Fernandez-Fernandez, I., Herrera, R. J., Pancorbo, M. M.: Sequence polymorphisms of the mtdna control region in human isolate: the Georgians from Swanetia. J. Hum. Genet., 51, 429 439 (2006). 33) Malyarchuk, B. A., Grzybowski,T., Derenko, M. V., Czarny, J., Miscicka- Sliwka, D.: Mitochondrial DNA diversity in the Polish Roma. Ann. Hum. Genet., 70,195 206 (2005). 34) Vanecek, T., Vorel, F., Sip, M.: Mitochondrial DNA D loop hypervariable regions: Czech population data. Int. J. Legal Med., 118, 14 18 (2004). 35) Nei, M.: Molecular evolutionary genetics, Columbia University Press, New York (1987). 36) Tajima, F.: Statistical method for testing the neutral mutation hypothesis by DNA population. Genetics., 123, 585 595 (1989). 37) Alves-Silva, J., M. da. Silva Santos., Guimarãaes, P. E. M., Ferreira, A. C. S., Bandelt, H. J., Pena, S. D. J., Prado, V. F.: The ancestry of brazilian mtdna lineages. Am.J.Hum.Genet., 67, 444 461 (2000).