DNA as a Biometric. Biometric Consortium Conference 2011 Tampa, FL

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "DNA as a Biometric. Biometric Consortium Conference 2011 Tampa, FL"

Transcription

1 DNA as a Biometric Biometric Consortium Conference 2011 Tampa, FL September 27, 2011 Dr. Peter M. Vallone Biochemical Science Division National Institute of Standards and Technology Gaithersburg, MD 20899

2 Outline Basics of DNA Typing DNA as a Biometric

3 General Characteristics of Genomic DNA Each individual has a unique DNA profile with exception of monozygotic siblings Each person's DNA is the same in every cell DNA from skin cells will match DNA from blood cells An individual s DNA profile remains the same throughout life Half of your DNA comes from your mother and half from your father implications for determining kinship

4 Sources of Biological Evidence Saliva Blood Semen Urine Hair Teeth Bone Tissue Blood Sample Only a very small amount of blood is needed to obtain a DNA profile best results with >100 cells, but DNA profiles can be recovered from fewer cells

5 Forensic DNA Testing Probe subsets of genetic variation in order to differentiate between individuals (14 to 16 regions in the human genome) DNA typing must be done efficiently and reproducibly (information must hold up in court) Over 10 million profiles in the national FBI database Typically, we are not looking at genes little/no information about race, predisposition to disease, or phenotypic information (eye color, height, hair color) is obtained

6 What Type of Genetic Variation? Sequence Variation single nucleotide polymorphisms (SNPs) insertions/deletions GCTAGTCGATGCTC[G/A]GCGTATGCTGTAGC Length Variation short tandem repeats (STRs) CTAGTCGT[GATA][GATA][GATA]GCGATCGT

7 Short Tandem Repeat (STR) Markers An accordion-like DNA sequence that occurs between genes TCCCAAGCTCTTCCTCTTCCCTAGATCAATACAGACAGAAGACA GGTGGATAGATAGATAGATAGATAGATAGATAGATAGATAGATA GATAGATATCATTGAAAGACAAAACAGAGATGGATGATAGATACA TGCTTACAGATGCACAC = 12 GATA repeats ( 12 is all that is reported) 7 repeats 8 repeats 9 repeats 10 repeats 11 repeats 12 repeats 13 repeats Target region [short tandem repeat] The number of consecutive repeat units can vary between people The frequency of these repeats observed in the general population have been sampled and are used for the statistical representation of a DNA profile

8 Core STR Loci for the United States Position of Forensic STR Markers on Human Chromosomes TPOX 13 Core U.S. STR Loci D3S1358 D5S818 D8S1179 TH01 VWA 1997 FGA CSF1PO D7S820 AMEL Sex-typing D13S317 D16S539 D18S51 D21S11 AMEL

9 Technology Genetics Biology Steps in Forensic DNA Analysis Usually 1-2 day process (a minimum of ~8 hours) Blood Stain Buccal swab Sample Collection & Storage 1.5 h 1.5 h DNA Extraction DNA Quantitation Statistics Calculated DNA Database search Paternity test Reference sample ~3.5 h Multiplex PCR Amplification DNA separation and sizing Applied Use of Information 1.5 h STR Typing Interpretation of Results

10 Identifiler [Applied Biosystems] 15 STR Loci Kit Information is tied together with multiplex PCR and data analysis D8S1179 {15,16} D21S11 D8S1179 {29,29} D7S820 {9,11} CSF1PO {10,11} D3S1358 {16,17} TH01 D3S1358 {6,7} TH01 D13S317 {8,12} D16S539 {10,11} D2S1338 {19,19} D19S433 {14,16} D19S433 D5S818 AMEL D5S818 {9,11} VWA VWA {15,17} TPOX {8,12} D18S51 {11,15} Amel {X,Y} FGA {19,22} D21S11 Multiplying the frequency of each D13S317 TPOX FGA genotype D7S820 at CSF1PO each locus gives us the Random Match Probability (RMP) D16S539 of 1.25x10 D2S for unrelated individuals The chance of an unrelated individual D18S51 having this exact same profile is 1 in 800 trillion This test contains the 13 FBI core loci

11 Kinship Testing DNA profiles can also be used to evaluate the probability of a specific familial relationship As a familial relationship becomes more distant, the ability of DNA (using STRs) to confirm the likelihood of that relationship decreases 1. Parent-offspring 2. Siblings 3. Half siblings = uncle/nephew = grandchild 4. Cousins

12 Dad Autosomal Paternity Example Child Brother Sister Mom

13 DNA as a Biometric

14 Current Biometrics Some commonly measured features Physical Fingerprints (Palm/hand geometry) Iris, retinal Face Odor/scent DNA Behavioral Gait Voice Vein (IR thermogram) Hand geometry Handwriting

15 Characteristics of a Biometric Universality each person should have the characteristic Uniqueness is how well the biometric separates individuals from another Permanence measures how well a biometric resists aging and variance over time Collectability ease of acquisition for measurement Jain, A. K.; Ross, Arun; Prabhakar, Salil [January 2004], "An introduction to biometric recognition", IEEE Transactions on Circuits and Systems for Video Technology 14th [1]: 4 20

16 Characteristics of a Biometric (practical considerations) Performance accuracy, speed, and robustness of technology used Acceptability degree of approval of a technology Circumvention/Spoofing ease of use of a substitute Jain, A. K.; Ross, Arun; Prabhakar, Salil [January 2004], "An introduction to biometric recognition", IEEE Transactions on Circuits and Systems for Video Technology 14th [1]: 4 20

17 DNA Typing as a Biometric Advantages High level of accuracy (Gold Standard) Solid scientific foundation of Forensic DNA Testing (pop stats, molecular biology, court acceptance, protocols, training, education) Kinship determination (unique to DNA) Potential use for: Phenotype (traits; eye/hair color) Biogeographical Ancestry (but not with STR markers) Expensive Challenges Time consuming Sample collection (invasive, stability issues) Technical expertise required for analysis Policy/Privacy/Ethical issues

18 Interest in Rapid DNA Typing DoD (field testing, rapid intelligence, mass fatalities) DHS (kinship determination, border security, immigration) DoJ (law enforcement, arrestees, initial information) Industry (security, authentication) Each customer will have specific requirements sample input information output degrees of accuracy Time required for generating STR profiles will have to be reduced to less than 2 h. Does the application warrant the time and expense?

19 Goals for Rapid DNA Typing Systems Develop a fully integrated system capable of performing DNA testing in less than 1-2 hours Little user interaction (or experience) Rugged Swab in answer out Robust Simple data interpretation 4-16 samples per run Disposable chips (with reagents on board)

20 Rapid DNA Typing Systems Under Development Systems are currently under development These are STR-based and use similar genetic marker systems as law enforcement (CODIS-FBI NDIS) Network Biosystems (Woburn, MA) ZyGEM and Lockheed Martin (Charlottesville,VA) IntegenX (Pleasanton, CA) Forensic Science Service (UK) and Univ of AZ Tomorrow: Special Rapid DNA Session 9:00 AM Session 2 - Rooms 15/16

21 Questions about the limitations of DNA Identical (monozygotic) twins Occurrence ~1 in 285 births Standard forensic DNA tests can not distinguish between identical twins Fingerprints will be different Random Match Probability does not apply to related individuals Combine biometric modes (DNA + fingerprints) If possible, question when enrolling an individual

22 Questions about the limitations of DNA Chimeras (different DNA types within the same person) Example: Blood may exhibit one DNA type, but saliva another, OR a combination of both Inherited, acquired from transplant or transfusion Occurrence??? If the DNA profile indicates a mixture, repeat DNA typing to confirm Question when enrolling an individual Combine biometric modes

23 Birthday Problem 365 possible birthdays Assume no leap year, that all birthdays are equivalent, no bias In a room of 23 people what is the probability that two of them will share a birthday???? 1/365 = 0.27% Answer: There is a ~50% probability of two people sharing a birthday in a room of 23 people. Relevant to multiple occurrences of any birthday Weir, B. The Rarity of DNA Profiles The Annals of Applied Statistics (2007) 1:

24 These are different questions One to one Many to many The estimated frequency at which a particular STR profile would be expected in a population The estimated frequency at which two STR profiles will match in a set of n profiles Kaye, David H., Trawling DNA Databases for Partial Matches: What is the FBI Afraid of? (February 1, 2009). Cornell Journal of Law and Public Policy, Vol. 19, No. 1, 2009; Penn State Legal Studies Research Paper No

25 Thank you for your attention! Questions? Acknowledgements Erica Butts Outside funding agencies: FBI - Evaluation of Forensic DNA Typing as a Biometric Tool NIJ Interagency Agreement with the Office of Law Enforcement Standards

Melissa May. NetBio - Vice President Strategic Planning. Date: 22/10/2013

Melissa May. NetBio - Vice President Strategic Planning. Date: 22/10/2013 Melissa May NetBio - Vice President Strategic Planning Date: 22/10/2013 Heading Fully automated, Field forward Rapid DNA Typing for Military, Intelligence, and Law Enforcement Applications 090413 Requirements:

More information

Paternity Testing. Chapter 23

Paternity Testing. Chapter 23 Paternity Testing Chapter 23 Kinship and Paternity DNA analysis can also be used for: Kinship testing determining whether individuals are related Paternity testing determining the father of a child Missing

More information

Rapid DNA Instrument Update & Enhancement Plans for CODIS

Rapid DNA Instrument Update & Enhancement Plans for CODIS Rapid DNA Instrument Update & Enhancement Plans for CODIS Biometrics Consortium Conference 2013 September 19, 2013 Tampa, Florida Thomas Callaghan PhD FBI Laboratory Rapid DNA Analysis (Law Enforcement

More information

Commonly Used STR Markers

Commonly Used STR Markers Commonly Used STR Markers Repeats Satellites 100 to 1000 bases repeated Minisatellites VNTR variable number tandem repeat 10 to 100 bases repeated Microsatellites STR short tandem repeat 2 to 6 bases repeated

More information

Touch DNA and DNA Recovery. H. Miller Coyle

Touch DNA and DNA Recovery. H. Miller Coyle Touch DNA and DNA Recovery 1 2 What is the link between cell biology & forensic science? Cells are the trace substances left behind that can identify an individual. Cells contain DNA. There are two forms

More information

Scientific Working Group on DNA Analysis Methods. Validation Guidelines for DNA Analysis Methods. Table of Contents

Scientific Working Group on DNA Analysis Methods. Validation Guidelines for DNA Analysis Methods. Table of Contents Scientific Working Group on DNA Analysis Methods Validation Guidelines for DNA Analysis Methods Table of Contents Introduction.2 1. Definitions. 2 2. General Considerations 3 3. Developmental Validation..5

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Forensic Statistics. From the ground up. 15 th International Symposium on Human Identification

Forensic Statistics. From the ground up. 15 th International Symposium on Human Identification Forensic Statistics 15 th International Symposium on Human Identification From the ground up UNTHSC John V. Planz, Ph.D. UNT Health Science Center at Fort Worth Why so much attention to statistics? Exclusions

More information

DHS Rapid and Low-cost DNA Biometrics

DHS Rapid and Low-cost DNA Biometrics Human Factors and Behavioral Sciences Division Research Transition Innovation DHS Rapid and Low-cost DNA Biometrics Christopher Miles Personal Identification Systems Research Director Human Factors/Behavioral

More information

TOP TEN COMPANIES IN FORENSICS TECHNOLOGY SAS020A. David Christofides Project Analyst ISBN:

TOP TEN COMPANIES IN FORENSICS TECHNOLOGY SAS020A. David Christofides Project Analyst ISBN: TOP TEN COMPANIES IN FORENSICS TECHNOLOGY SAS020A David Christofides Project Analyst ISBN: BCC Research 49 Walnut Park, Building 2 Wellesley, MA 02481 866-285-7215, 781-489-7301 www.bccresearch.com Custom

More information

Single Nucleotide Polymorphisms (SNPs)

Single Nucleotide Polymorphisms (SNPs) Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded

More information

DNA & CRIME VICTIMS: WHAT VICTIMS NEED TO KNOW

DNA & CRIME VICTIMS: WHAT VICTIMS NEED TO KNOW DNA & CRIME VICTIMS: WHAT VICTIMS NEED TO KNOW DNA & CRIME VICTIMS: What Victims Need to Know The increasing use of DNA evidence in criminal cases gives victims of crime new hope that offenders will be

More information

DNA and Forensic Science

DNA and Forensic Science DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief

More information

Rapid DNA Analysis DNA: the Ultimate Biometric? Advances in Molecular Processing and Analysis

Rapid DNA Analysis DNA: the Ultimate Biometric? Advances in Molecular Processing and Analysis Rapid DNA Analysis DNA: the Ultimate Biometric? Advances in Molecular Processing and Analysis Presentation at NSF Workshop on Fundamental Research Challenges for Trustworthy Biometrics Dr. Joan Bienvenue

More information

LRmix tutorial, version 4.1

LRmix tutorial, version 4.1 LRmix tutorial, version 4.1 Hinda Haned Netherlands Forensic Institute, The Hague, The Netherlands May 2013 Contents 1 What is LRmix? 1 2 Installation 1 2.1 Install the R software...........................

More information

The Chinese University of Hong Kong School of Life Sciences Biochemistry Program CUGEN Ltd.

The Chinese University of Hong Kong School of Life Sciences Biochemistry Program CUGEN Ltd. The Chinese University of Hong Kong School of Life Sciences Biochemistry Program CUGEN Ltd. DNA Forensic and Agarose Gel Electrophoresis 1 OBJECTIVES Prof. Stephen K.W. Tsui, Dr. Patrick Law and Miss Fion

More information

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to

More information

Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005

Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 26.03.2012 to 25.03.2017

More information

Rapid DNA Analysis in the Police Booking Suite: FBI Initiative for Reference Sample Point-of-Collection Analysis

Rapid DNA Analysis in the Police Booking Suite: FBI Initiative for Reference Sample Point-of-Collection Analysis Rapid DNA Analysis in the Police Booking Suite: FBI Initiative for Reference Sample Point-of-Collection Analysis 13 th European Forensic DNA Working Group Meeting Krakow, Poland May 10, 2012 Clark Jaw

More information

DNA Stability Studies: FTA vs 903

DNA Stability Studies: FTA vs 903 Forensics @ NIST Gaithersburg, MD DNA Stability Studies: FTA vs 93 Margaret C. Kline Overview History of DNA storage studies at NIST Stability at different temperatures and different papers Review Anal

More information

Lecture 38: DNA Fingerprinting

Lecture 38: DNA Fingerprinting Lecture 38: DNA Fingerprinting (DNA technology) The most awesome and powerful tool acquired by man since the splitting of atoms - The Time Magazine (USA) Conventional fingerprint of an individual comes

More information

Easy Collection and Extraction of BioSamples Ahlstrom GenCollect Ahlstrom GenCollect Color

Easy Collection and Extraction of BioSamples Ahlstrom GenCollect Ahlstrom GenCollect Color Easy Collection and Extraction of BioSamples Ahlstrom GenCollect Ahlstrom GenCollect Color Ahlstrom GenCollect and Ahlstrom GenCollect Color Collection of biosamples COST Storage at ambient temperature

More information

Forensic. Sciences. Forensic Sciences. Specialties. Programs. Career Pathways

Forensic. Sciences. Forensic Sciences. Specialties. Programs. Career Pathways Forensic Sciences Specialties Programs Prof. R. E. Gaensslen Director of Graduate Studies Forensic Science University of Illinois - Chicago Career Pathways Forensic Sciences 1 The Hype... the TV version

More information

Y Chromosome Markers

Y Chromosome Markers Y Chromosome Markers Lineage Markers Autosomal chromosomes recombine with each meiosis Y and Mitochondrial DNA does not This means that the Y and mtdna remains constant from generation to generation Except

More information

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA

Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns

More information

Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples

Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples Sudhir K. Sinha, Ph.D.*, Anne H. Montgomery, M.S., Gina Pineda, M.S., and Hiromi Brown, Ph.D.

More information

A Simplified Guide To DNA Evidence

A Simplified Guide To DNA Evidence A Simplified Guide To DNA Evidence Introduction The establishment of DNA analysis within the criminal justice system in the mid- 1980s revolutionized the field of forensic science. With subsequent refinement

More information

Modules 5: Behavior Genetics and Evolutionary Psychology

Modules 5: Behavior Genetics and Evolutionary Psychology Modules 5: Behavior Genetics and Evolutionary Psychology Source of similarities and differences Similarities with other people such as developing a languag, showing similar emotions, following similar

More information

Popstats Unplugged. 14 th International Symposium on Human Identification. John V. Planz, Ph.D. UNT Health Science Center at Fort Worth

Popstats Unplugged. 14 th International Symposium on Human Identification. John V. Planz, Ph.D. UNT Health Science Center at Fort Worth Popstats Unplugged 14 th International Symposium on Human Identification John V. Planz, Ph.D. UNT Health Science Center at Fort Worth Forensic Statistics From the ground up Why so much attention to statistics?

More information

Chapter 13: Meiosis and Sexual Life Cycles

Chapter 13: Meiosis and Sexual Life Cycles Name Period Chapter 13: Meiosis and Sexual Life Cycles Concept 13.1 Offspring acquire genes from parents by inheriting chromosomes 1. Let s begin with a review of several terms that you may already know.

More information

Mitochondrial DNA Analysis

Mitochondrial DNA Analysis Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)

More information

Computer with GeneMapper ID (version 3.2.1 or most current) software Microsoft Excel, Word Print2PDF software

Computer with GeneMapper ID (version 3.2.1 or most current) software Microsoft Excel, Word Print2PDF software Procedure for GeneMapper ID for Casework 1.0 Purpose-This procedure specifies the steps for performing analysis on DNA samples amplified with AmpFlSTR Identifiler Plus using the GeneMapper ID (GMID) software.

More information

DNA & Typing (Unit 11)

DNA & Typing (Unit 11) 117 DNA & Typing (Unit 11) DNA, a long, narrow string-like material, determines an individual s eye color, hair color, stature, bone density and many other traits. Recent advancements in DNA technology

More information

for Lawyers and Investigating Officers

for Lawyers and Investigating Officers Guide to DNA for Lawyers and Investigating Officers This booklet is designed to give lawyers and investigating officers a basic understanding of DNA analysis and interpretation. It aims to assist them

More information

DNA & CRIME VICTIMS: WHAT VICTIM ASSISTANCE PROFESSIONALS NEED TO KNOW

DNA & CRIME VICTIMS: WHAT VICTIM ASSISTANCE PROFESSIONALS NEED TO KNOW DNA & CRIME VICTIMS: WHAT VICTIM ASSISTANCE PROFESSIONALS NEED TO KNOW What Victim Assistance Professionals Need to Know 1 DNA & CRIME VICTIMS: What Victim Assistance Professionals Need to Know As the

More information

Chromosomes, Mapping, and the Meiosis Inheritance Connection

Chromosomes, Mapping, and the Meiosis Inheritance Connection Chromosomes, Mapping, and the Meiosis Inheritance Connection Carl Correns 1900 Chapter 13 First suggests central role for chromosomes Rediscovery of Mendel s work Walter Sutton 1902 Chromosomal theory

More information

Willmar Public Schools Curriculum Map

Willmar Public Schools Curriculum Map Subject Area Science Senior High Course Name Forensics Date June 2010 Timeline Content Standards Addressed Skills/Benchmarks Essential Questions Assessments 1-2 Introduction History and Development of

More information

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur

More information

Name: Class: Date: ID: A

Name: Class: Date: ID: A Name: Class: _ Date: _ Meiosis Quiz 1. (1 point) A kidney cell is an example of which type of cell? a. sex cell b. germ cell c. somatic cell d. haploid cell 2. (1 point) How many chromosomes are in a human

More information

Forensic Anthropology. Introduction

Forensic Anthropology. Introduction Forensic Anthropology Introduction Introduction This course is Biological Anthropology We have covered many themes Primates Evolution Paleoanthropology Genetics Disease Life Cycle Variation Forensics We

More information

Human Mendelian Disorders. Genetic Technology. What is Genetics? Genes are DNA 9/3/2008. Multifactorial Disorders

Human Mendelian Disorders. Genetic Technology. What is Genetics? Genes are DNA 9/3/2008. Multifactorial Disorders Human genetics: Why? Human Genetics Introduction Determine genotypic basis of variant phenotypes to facilitate: Understanding biological basis of human genetic diversity Prenatal diagnosis Predictive testing

More information

patient education Fact Sheet PFS007: BRCA1 and BRCA2 Mutations MARCH 2015

patient education Fact Sheet PFS007: BRCA1 and BRCA2 Mutations MARCH 2015 patient education Fact Sheet PFS007: BRCA1 and BRCA2 Mutations MARCH 2015 BRCA1 and BRCA2 Mutations Cancer is a complex disease thought to be caused by several different factors. A few types of cancer

More information

The College of Forensic Sciences at NAUSS: The pioneer of Forensics in the Arab world

The College of Forensic Sciences at NAUSS: The pioneer of Forensics in the Arab world 12 Arab Journal of Forensic Sciences and Forensic Medicine 2014; Volume 1 Issue (0), 12-16 Naif Arab University for Security Sciences Arab Journal of Forensic Sciences and Forensic Medicine www.nauss.edu.sa

More information

Meiosis and Sexual Life Cycles

Meiosis and Sexual Life Cycles Meiosis and Sexual Life Cycles Chapter 13 1 Ojectives Distinguish between the following terms: somatic cell and gamete; autosome and sex chromosomes; haploid and diploid. List the phases of meiosis I and

More information

Heritability: Twin Studies. Twin studies are often used to assess genetic effects on variation in a trait

Heritability: Twin Studies. Twin studies are often used to assess genetic effects on variation in a trait TWINS AND GENETICS TWINS Heritability: Twin Studies Twin studies are often used to assess genetic effects on variation in a trait Comparing MZ/DZ twins can give evidence for genetic and/or environmental

More information

CURRICULUM GUIDE. When this Forensics course has been completed successfully, students should be able to:

CURRICULUM GUIDE. When this Forensics course has been completed successfully, students should be able to: CURRICULUM GUIDE NAME OF COURSE: FORENSICS COURSE NUMBER: SCI 40 WRITTEN / REVISED: SEPTEMBER, 2011 LEVEL OF COURSE: REPLACMENT NUMBER OF CREDITS: SIX (6) PREREQUISITES: BIOLOGY GRADE LEVELS OFFERED TO:

More information

Basic Principles of Forensic Molecular Biology and Genetics. Population Genetics

Basic Principles of Forensic Molecular Biology and Genetics. Population Genetics Basic Principles of Forensic Molecular Biology and Genetics Population Genetics Significance of a Match What is the significance of: a fiber match? a hair match? a glass match? a DNA match? Meaning of

More information

Introduction to Post PCR Cleanup

Introduction to Post PCR Cleanup Matt Kramer Introduction to Post PCR Cleanup Overview Why post PCR amplification cleanup? Enhancing human identity testing Introduction to QIAGEN MinElute post PCR cleanup technologies MinElute as a tool

More information

Marrying a relative. Is there an increased chance that a child will have genetic problems if its parents are related to each other?

Marrying a relative. Is there an increased chance that a child will have genetic problems if its parents are related to each other? Marrying a relative Is there an increased chance that a child will have genetic problems if its parents are related to each other? The simple answer to this question is Yes, there is an increased chance.

More information

The correct answer is c A. Answer a is incorrect. The white-eye gene must be recessive since heterozygous females have red eyes.

The correct answer is c A. Answer a is incorrect. The white-eye gene must be recessive since heterozygous females have red eyes. 1. Why is the white-eye phenotype always observed in males carrying the white-eye allele? a. Because the trait is dominant b. Because the trait is recessive c. Because the allele is located on the X chromosome

More information

Patient Information. for Childhood

Patient Information. for Childhood Patient Information Genetic Testing for Childhood Hearing Loss Introduction This document describes the most common genetic cause of childhood hearing loss and explains the role of genetic testing. Childhood

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

DNA for Defense Attorneys. Chapter 6

DNA for Defense Attorneys. Chapter 6 DNA for Defense Attorneys Chapter 6 Section 1: With Your Expert s Guidance, Interview the Lab Analyst Case File Curriculum Vitae Laboratory Protocols Understanding the information provided Section 2: Interpretation

More information

Haematopoietic Chimerism Analysis after Allogeneic Stem Cell Transplantation

Haematopoietic Chimerism Analysis after Allogeneic Stem Cell Transplantation Haematopoietic Chimerism Analysis after Allogeneic Stem Cell Transplantation Dr Ros Ganderton, Ms Kate Parratt, Dr Debbie Richardson, Dr Kim Orchard and Dr Liz Hodges Departments of Molecular Pathology

More information

Heredity - Patterns of Inheritance

Heredity - Patterns of Inheritance Heredity - Patterns of Inheritance Genes and Alleles A. Genes 1. A sequence of nucleotides that codes for a special functional product a. Transfer RNA b. Enzyme c. Structural protein d. Pigments 2. Genes

More information

Forensic Anthropology Introduction. Human Biology/Forensics B.M.C. Durfee High School

Forensic Anthropology Introduction. Human Biology/Forensics B.M.C. Durfee High School Forensic Anthropology Introduction Human Biology/Forensics B.M.C. Durfee High School Objectives Describe Forensic Anthropology Describe the history of Forensic Anthropology Identify the three fields of

More information

The Science Detectives- Murder in a Science Lab

The Science Detectives- Murder in a Science Lab CASE STuDY- Evidence Docket Crime Scene Investigation- Scenario: You and your Crime Scene Investigation Unit arrive on the scene of a crime. A man named Dr. Darren Hobbs was found lying on the floor of

More information

DNA databases and human rights

DNA databases and human rights DNA databases and human rights Using DNA to trace people who are suspected of committing a crime has been a major advance in policing. When DNA profiling is used wisely it can help to convict people who

More information

Framework for Biometric Enabled Unified Core Banking

Framework for Biometric Enabled Unified Core Banking Proc. of Int. Conf. on Advances in Computer Science and Application Framework for Biometric Enabled Unified Core Banking Manohar M, R Dinesh and Prabhanjan S Research Candidate, Research Supervisor, Faculty

More information

DNA PROFILING IN FORENSIC SCIENCE

DNA PROFILING IN FORENSIC SCIENCE DA PROFILIG I FORESIC SCIECE DA is the chemical code that is found in every cell of an individual's body, and is unique to each individual. Because it is unique, the ability to examine DA found at a crime

More information

HISTORY AND SCIENCE OF FORENSIC DNA TESTING. BY: Paul Couenhoven

HISTORY AND SCIENCE OF FORENSIC DNA TESTING. BY: Paul Couenhoven HISTORY AND SCIENCE OF FORENSIC DNA TESTING BY: Paul Couenhoven SCIENTIFIC BASICS OF DNA What is DNA? DNA stands for DeoxyriboNucleic Acid. It is the genetic material of a cell. The chromosomes inside

More information

Forensic Science International: Genetics

Forensic Science International: Genetics Forensic Science International: Genetics 3 (2009) e111 e116 Contents lists available at ScienceDirect Forensic Science International: Genetics journal homepage: www.elsevier.com/locate/fsig Announcement

More information

In recent years the number of DNA genetic tests that you can

In recent years the number of DNA genetic tests that you can Inside How accurate are the tests? 2 How useful are the tests? 2 What can Direct-to-Consumer DNA genetic tests tell me? 2 What happens to my personal information? 3 What protections are there in Australia?

More information

The Human Genome Project

The Human Genome Project The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?

More information

Rules for conducting ISAG Comparison Tests (CT) for animal DNA testing.

Rules for conducting ISAG Comparison Tests (CT) for animal DNA testing. Rules for conducting ISAG Comparison Tests (CT) for animal DNA testing. DEFINITIONS Society = ISAG Secretary Executive Committee Conferences Workshops Standing Committee Chair Institutional members Reference

More information

Forensic Genotyping as a Method To Teach Genetics & DNA Science

Forensic Genotyping as a Method To Teach Genetics & DNA Science inquiry & investigation Mendel Meets CSI: Forensic Genotyping as a Method To Teach Genetics & DNA Science The popularity of crime scene dramas provides an opportunity for educators to engage students in

More information

FIVS 316 BIOTECHNOLOGY & FORENSICS Syllabus - Lecture followed by Laboratory

FIVS 316 BIOTECHNOLOGY & FORENSICS Syllabus - Lecture followed by Laboratory FIVS 316 BIOTECHNOLOGY & FORENSICS Syllabus - Lecture followed by Laboratory Instructor Information: Name: Dr. Craig J. Coates Email: ccoates@tamu.edu Office location: 319 Heep Center Office hours: By

More information

DNA paternity and relationship testing services

DNA paternity and relationship testing services analytical quality measurement accuracy regulatory testing chemical measurement bioanalysis standards forensic testing DNA paternity and relationship testing services Contents 1 Why choose LGC to carry

More information

Mixture Interpretation: Defining the Relevant Features for Guidelines for the Assessment of Mixed DNA Profiles in Forensic Casework*

Mixture Interpretation: Defining the Relevant Features for Guidelines for the Assessment of Mixed DNA Profiles in Forensic Casework* J Forensic Sci, July 2009, Vol. 54, No. 4 doi: 10.1111/j.1556-4029.2009.01046.x Available online at: www.blackwell-synergy.com Bruce Budowle, 1 Ph.D.; Anthony J. Onorato, 1 M.S.F.S., M.C.I.M.; Thomas F.

More information

DNA Detection. Chapter 13

DNA Detection. Chapter 13 DNA Detection Chapter 13 Detecting DNA molecules Once you have your DNA separated by size Now you need to be able to visualize the DNA on the gel somehow Original techniques: Radioactive label, silver

More information

DNA Determines Your Appearance!

DNA Determines Your Appearance! DNA Determines Your Appearance! Summary DNA contains all the information needed to build your body. Did you know that your DNA determines things such as your eye color, hair color, height, and even the

More information

The more varied population is older because the mtdna has had more time to accumulate mutations.

The more varied population is older because the mtdna has had more time to accumulate mutations. Practice problems (with answers) This is the degree of difficulty of the questions that will be on the test. This is not a practice test because I did not consider how long it would take to finish these

More information

BOSTON UNIVERSITY SCHOOL OF MEDICINE. Thesis CHARACTERIZATION OF ERROR TRADEOFFS IN HUMAN IDENTITY COMPARISONS: DETERMINING A COMPLEXITY

BOSTON UNIVERSITY SCHOOL OF MEDICINE. Thesis CHARACTERIZATION OF ERROR TRADEOFFS IN HUMAN IDENTITY COMPARISONS: DETERMINING A COMPLEXITY BOSTON UNIVERSITY SCHOOL OF MEDICINE Thesis CHARACTERIZATION OF ERROR TRADEOFFS IN HUMAN IDENTITY COMPARISONS: DETERMINING A COMPLEXITY THRESHOLD FOR DNA MIXTURE INTERPRETATION By JACOB SAMUEL GORDON A.B.,

More information

Crime Scene Genetics: Transforming Forensic Science through Molecular Technologies MELISSA LEE PHILLIPS

Crime Scene Genetics: Transforming Forensic Science through Molecular Technologies MELISSA LEE PHILLIPS Crime Scene Genetics: Transforming Forensic Science through Molecular Technologies MELISSA LEE PHILLIPS Advances in DNA (deoxyribonucleic acid) technology over the past 25 years have led to spectacularly

More information

Breast and Ovarian Cancer

Breast and Ovarian Cancer Breast and Ovarian Cancer Hereditary Breast and Ovarian Cancer A Guide for Patients KNOWING WHAT TO LOOK FOR KNOWING WHERE TO LOOK AND KNOWING WHAT IT MEANS Hereditary Breast and Ovarian Cancer What is

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

The University of Texas Southwestern Medical Center at Dallas Retina Foundation of the Southwest CONSENT TO PARTICIPATE IN RESEARCH

The University of Texas Southwestern Medical Center at Dallas Retina Foundation of the Southwest CONSENT TO PARTICIPATE IN RESEARCH The University of Texas Southwestern Medical Center at Dallas Retina Foundation of the Southwest CONSENT TO PARTICIPATE IN RESEARCH Title of Research: Funding Agency/Sponsor: Study Doctors: Research Personnel:

More information

GAW 15 Problem 3: Simulated Rheumatoid Arthritis Data Full Model and Simulation Parameters

GAW 15 Problem 3: Simulated Rheumatoid Arthritis Data Full Model and Simulation Parameters GAW 15 Problem 3: Simulated Rheumatoid Arthritis Data Full Model and Simulation Parameters Michael B Miller , Michael Li , Gregg Lind , Soon-Young

More information

The following chapter is called "Preimplantation Genetic Diagnosis (PGD)".

The following chapter is called Preimplantation Genetic Diagnosis (PGD). Slide 1 Welcome to chapter 9. The following chapter is called "Preimplantation Genetic Diagnosis (PGD)". The author is Dr. Maria Lalioti. Slide 2 The learning objectives of this chapter are: To learn the

More information

Use of the Agilent 2100 Bioanalyzer and the DNA 500 LabChip in the Analysis of PCR Amplified Mitochondrial DNA Application

Use of the Agilent 2100 Bioanalyzer and the DNA 500 LabChip in the Analysis of PCR Amplified Mitochondrial DNA Application Use of the Agilent 2100 Bioanalyzer and the DNA LabChip in the Analysis of PCR Amplified Mitochondrial DNA Application Homeland Security/Forensics Author Mark Jensen Agilent Technologies, Inc. 2850 Centerville

More information

Efficient Attendance Management: A Face Recognition Approach

Efficient Attendance Management: A Face Recognition Approach Efficient Attendance Management: A Face Recognition Approach Badal J. Deshmukh, Sudhir M. Kharad Abstract Taking student attendance in a classroom has always been a tedious task faultfinders. It is completely

More information

A DNA Fingerprinting Exercise for Any Type of Class. by Sandra G. Porter, Ph.D.

A DNA Fingerprinting Exercise for Any Type of Class. by Sandra G. Porter, Ph.D. 1 A DNA Fingerprinting Exercise for Any Type of Class by Sandra G. Porter, Ph.D. "Hands on" laboratory exercises are excellent teaching tools because they have the potential to reach students with all

More information

Maria Lewis Branch Manager - Field Management and Services Branch Kentucky Child Support Enforcement Program Frankfort, KY

Maria Lewis Branch Manager - Field Management and Services Branch Kentucky Child Support Enforcement Program Frankfort, KY Tuesday: Breakout Session 4 Workshop C Time: 1:00 p.m. - 2:15 p.m. Location: Regency 3 WHO S MY DADDY? AN UPDATE ON PATERNITY ISSUES (CLE) This workshop will cover the paternity establishment process from

More information

DNA: FORENSIC AND LEGAL APPLICATIONS By: Lawrence Koblinsky, Thomas F. Liotti, Jamel Oeser-Sweat

DNA: FORENSIC AND LEGAL APPLICATIONS By: Lawrence Koblinsky, Thomas F. Liotti, Jamel Oeser-Sweat DNA: FORENSIC AND LEGAL APPLICATIONS By: Lawrence Koblinsky, Thomas F. Liotti, Jamel Oeser-Sweat Citation: LAWRENCE KOBLINSKY ET AL., DNA: FORENSIC AND LEGAL APPLICATIONS (John Wiley & Sons, Inc., 2005).

More information

Genetics 1. Defective enzyme that does not make melanin. Very pale skin and hair color (albino)

Genetics 1. Defective enzyme that does not make melanin. Very pale skin and hair color (albino) Genetics 1 We all know that children tend to resemble their parents. Parents and their children tend to have similar appearance because children inherit genes from their parents and these genes influence

More information

Package forensic. February 19, 2015

Package forensic. February 19, 2015 Type Package Title Statistical Methods in Forensic Genetics Version 0.2 Date 2007-06-10 Package forensic February 19, 2015 Author Miriam Marusiakova (Centre of Biomedical Informatics, Institute of Computer

More information

SNP Essentials The same SNP story

SNP Essentials The same SNP story HOW SNPS HELP RESEARCHERS FIND THE GENETIC CAUSES OF DISEASE SNP Essentials One of the findings of the Human Genome Project is that the DNA of any two people, all 3.1 billion molecules of it, is more than

More information

Nature of Genetic Material. Nature of Genetic Material

Nature of Genetic Material. Nature of Genetic Material Core Category Nature of Genetic Material Nature of Genetic Material Core Concepts in Genetics (in bold)/example Learning Objectives How is DNA organized? Describe the types of DNA regions that do not encode

More information

FORENSIC DNA COLLECTION: A CITIZEN S GUIDE TO YOUR RIGHTS SCENARIOS AND RESPONSES

FORENSIC DNA COLLECTION: A CITIZEN S GUIDE TO YOUR RIGHTS SCENARIOS AND RESPONSES FORENSIC DNA COLLECTION: A CITIZEN S GUIDE TO YOUR RIGHTS SCENARIOS AND RESPONSES 1. DNA Dragnets You are between the ages of 18 and 35 and live in a city, town or neighborhood where a homicide has occurred.

More information

G-2d 2 Consent for Clinical DNA Sequencing Iowa Institute of Human Genetics

G-2d 2 Consent for Clinical DNA Sequencing Iowa Institute of Human Genetics G-2d 2 Consent for Clinical DNA Sequencing Iowa Institute of Human Genetics Contact: Richard JH Smith, MD; Colleen Campbell, PhD, MS, CGC DATE HOSP.# NAME BIRTH DATE This consent form describes the clinical

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Evidence Preservation in Sexual Assault: Between the Crime Scene and the Medical Examination

Evidence Preservation in Sexual Assault: Between the Crime Scene and the Medical Examination Evidence Preservation in Sexual Assault: Between the Crime Scene and the Medical Examination Pacific Police Development Program Global Justice Solutions LOCARD S PRINCIPLE VICTIM CRIME SCENE OFFENDER Evidence

More information

Careers for Biologists in the FORENSIC SCIENCES

Careers for Biologists in the FORENSIC SCIENCES Careers for Biologists in the FORENSIC SCIENCES Sarah Seashols, PhD Department of Forensic Science Virginia Commonwealth University www.has.vcu.edu/forensics What is Forensic Science? ME SCENE DO NOT CROSS

More information

Genetics Copyright, 2009, by Dr. Scott Poethig, Dr. Ingrid Waldron, and Jennifer Doherty Department of Biology, University of Pennsylvania 1

Genetics Copyright, 2009, by Dr. Scott Poethig, Dr. Ingrid Waldron, and Jennifer Doherty Department of Biology, University of Pennsylvania 1 Genetics Copyright, 2009, by Dr. Scott Poethig, Dr. Ingrid Waldron, and Jennifer Doherty Department of Biology, University of Pennsylvania 1 We all know that children tend to resemble their parents in

More information

This fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive.

This fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive. 11111 This fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive. In summary Genes contain the instructions for

More information

Extracting evidence from forensic DNA analyses: future molecular biology directions

Extracting evidence from forensic DNA analyses: future molecular biology directions Extracting evidence from forensic DNA analyses: future molecular biology directions Bruce Budowle 1,2 and Angela van Daal 3 1Department of Forensic and Investigative Genetics, University of North Texas

More information

NEBRASKA ADMINISTRATIVE CODE TITLE 272 CHAPTER 20 DNA DATA BASE

NEBRASKA ADMINISTRATIVE CODE TITLE 272 CHAPTER 20 DNA DATA BASE NEBRASKA ADMINISTRATIVE CODE TITLE 272 CHAPTER 20 DNA DATA BASE Adopted July 2, 2012 Title 272 NEBRASKA STATE PATROL CHAPTER 20 REGULATIONS AND PROCEDURES FOR THE DNA DATA BASE ALPHABETICAL TABLE OF CONTENTS

More information

Are DNA tests infallible?

Are DNA tests infallible? International Congress Series 1239 (2003) 873 877 Are DNA tests infallible? G. Penacino *, A. Sala, D. Corach Servicio de Huellas Digitales Genéticas and Cátedra de Genética y Biología Molecular, Fac.

More information

Chapter 13: Meiosis and Sexual Life Cycles

Chapter 13: Meiosis and Sexual Life Cycles Name Period Concept 13.1 Offspring acquire genes from parents by inheriting chromosomes 1. Let s begin with a review of several terms that you may already know. Define: gene locus gamete male gamete female

More information

Validation and Replication

Validation and Replication Validation and Replication Overview Definitions of validation and replication Difficulties and limitations Working examples from our group and others Why? False positive results still occur. even after

More information