MICB ABI PRISM 310 SEQUENCING GUIDE SEQUENCING OF PLASMID DNA
|
|
|
- Daniela Todd
- 9 years ago
- Views:
Transcription
1 Plasmid DNA Preparation MICB ABI PRISM 310 SEQUENCING GUIDE SEQUENCING OF PLASMID DNA Introduction: I have always used the classic Alkaline Lysis miniprep method to isolate plasmid DNA. (See below) If you prefer miniprep kits, then any commercial plasmid prep kit should be fine. ABI recommends Qiagen purification kits like the Qiagen QIAprep Spin Miniprep Kit (50) Cat.#27104 for plasmid minipreps. If you are using the Qiagen QIAprep Spin Miniprep Kit ALWAYS BOIL the isolated DNA prior to quantitation. We have noticed that Qiagen Miniprep DNA is sometimes somewhat "insoluble" and boiling the sample resolves this problem.i have also successfully used Sigma's GenElute Plasmid Purification MiniPrep Kit, Product Code PLN-10 (10) or PLN-70 (70 purifications). No matter which method you use, remember to dissolve your sample DNA in ddh 2 O and not TE as EDTA inhibits the ABI sequencing reaction. Finally, always use 100% ethanol for precipitations. Impurities in 95% ethanol will inhibit the sequencing reaction. Alkaline Lysis Method (DD & DT Modifications) Reagents Needed: Lysis Buffer 6.25 ml 2M Tris ph8 25mM 10 ml 0.5M EDTA 10mM 50 ml 0.5M Glucose 50mM ml double distilled water Store refridgerated. NaOH / SDS 4 ml 5M NaOH 0.2M 2 ml 20% SDS 0.2% ml double distilled water (prepare fresh, DO NOT place on ice) Potassium Acetate Solution 300 ml 5M KAc 57.5 ml Glacial Acetic Acid ml double distilled water Store refridgerated Phenol:Chloroform:Isoamyl Alcohol (25:24:1) buffer saturated Sigma-Aldrich Cat# P-3803 Chloroform:Isoamyl Alcohol (24:1) Sigma-Aldrich Cat# C-0549 or prepare RNaseA (Ribonuclease A) Sigma-Aldrich Cat# R-4875 Preamble: The solutions used in this mini-prep procedure are those of the large scale plasmid prep. In this mini-prep procedure various steps are combined and shortened to speed up the procedure. This method works very well to OK with most but NOT ALL plasmid / bug combinations. BEWARE! (ul = microlitre) Procedure: Using a fresh overnight culture of the plasmid containing bacteria, add 1.5 ml of this culture to an eppendorf tube. Pellet the bacteria by microcentrifugation for 1 min and then aspirate off the culture media. Add 200 ul of the LYSIS BUFFER and resuspend the pellet by vortexing. Make sure that the pellet is totally resuspended. Add 200 ul of the NaOH / SDS solution and mix by inverting until the solution becomes clear. Add 200 ul of POTASSIUM ACETATE solution and vortex until a white precipitate forms. Microcentrifuge for 5 min at top speed (>12,000 rpm). Remove the liquid into a fresh eppendorf tube. Add 500 ul of Phenol:Chloroform:Isoamyl Alcohol (25:24:1) and vortex vigorously. Microcentrifuge for 5 min and then very carefully remove 500 ul of the upper aqueous phase into a fresh eppendorf tube. Be particularly careful NOT to remove any of the organic interphase. Remember... don't get greedy, leave behind 100 ul of the aqueous layer, there is plenty of DNA in the first 500 ul. To the aqueous layer add 500 ul of Chloroform:Isoamyl Alcohol (24:1) vortex vigorously, microcentrifuge for 2 minutes and remove 450 ul of the top aqueous layer into a fresh eppendorf tube. (This step will remove any contaminating phenol). Precipitate out plasmid DNA from the 450 ul aqueous layer by adding 500 ul of isopropyl alcohol and allowing the sample to sit at room temperature for 5 mins. Pellet plasmid DNA by microcentrifugation for 5 mins. Aspirate the isopropyl alcohol, recentrifuge briefly and reaspirate any trace amount of alcohol. Air dry the plasmid DNA pellets at room temperature for mins. Redissolve the plasmid DNA in 50 ul of double distilled water. Add 1 ul RNase A (10mg/ml) to remove residual RNA. Quantitate DNA and prepare sequencing samples. MICB Sequencing Facility, March page 1 of 6
2 ABI PRISM 310 SEQUENCING OF PLASMID DNA Primer Selection Most commercially designed plasmid vectors have sequencing primers flanking the MCS (multiple cloning site). The most common primers are listed below. Note that primers vary slightly by manufacturer. T7 (17-mer) (Stratagene) 5 AATACGACTCACTATAG 3 T7 (22-mer) (Sratagene) 5 GTAATACGACTCACTATAGGGC 3 T3 (17-mer) (Stratagene) 5 ATTAACCCTCACTAAAG 3 T3 (20-mer) (Stratagene) 5 AATTAACCCTCACTAAAGGG 3 SP6 (Gibco-BRL) 5 ATTTAGGTGACACTATAG 3 M13 forward (Stratagene) 5 GTAAAACGACGGCCAG 3 M13 forward (Gibco-BRL) 5 CCCAGTCACGACGTTGTAAAACG 3 M13 reverse (Stratagene) 5 GGAAACAGCTATGACCATG 3 M13 reverse (Gibco-BRL) 5 AGCGGATAACAATTTCACACAGG 3 M13 (-20) (Stratagene) 5 GTAAAACGACGGCCAGT 3 If you need to prepare your own sequencing primer then YOU WILL NEED TO CONFIRM that your primer is suitable ie that it does not form primer-dimer pairs, that it does not self compliment, that it s Tm is not too low etc. This is best done using a primer analysis program. For more info see and try their FASTPCR demo program. In general these are the preferred characteristics of your primer: 1)18-30 nt in length 2)40-60% GC content 3)Tm between 50 o C-70 o C 4)No primer-dimer pair formation particularly at the 3 end of the primer 5)Confirm that the primer is unique within your sequence Remember that even though your primer meets all the above criteria THERE ARE NO GUARANTEES it will work. The ultimate test is the sequencing. If your sequencing primer is NOT ideal then you can try to increase the primer concentration in the sequencing reaction from 5 pmol to 10 pmol. You may also request a modified annealing temperature, Ta. Sequencing Sample Preparation TIPS: 1. If your plasmid preparation includes a phenol/chloroform extraction be careful to remove all traces of phenol and chloroform as these will inhibit the sequencing reaction. 2. Amount of plasmid DNA to use depends on the size of the plasmid. The larger the plasmid being sequenced the smaller the moles of plasmid present. Therefore use the following as a guideline: plasmid size 2-3Kb use 150 ng plasmid size 3-5Kb use 200 ng plasmid size 5-8Kb use 300 ng plasmid size > 8Kb use 400 ng 3. Pay attention to your pipetter. Monitor the pipetting to confirm that the amounts look correct. 4. Sequencing data will start nucleotides from the 3 end of the primer site. Total volume of plasmid DNA and primer must be 3 ul. This should be placed in a 200 ul thin-walled PCR tube. The tube should be labeled with your initials and a sequential number ON THE SIDE of the tube. The tube and a completed SEQUENCING REQUEST FORM should then be brought to the Sequencing Room ON6042. Place the request form in the holder at the door and the tube in the RED rack located in the freezer. MICB Sequencing Facility, March page 2 of 6
3 MICB ABI PRISM 310 SEQUENCING GUIDE SEQUENCING OF PCR PRODUCT DNA PCR Product Analysis Sequencing from PCR products is usually more problematic than sequencing from a plasmid. None-the-less by using a clean PCR product and a good primer excellent sequence will be obtained. The most important aspect of PCR product sequencing is to ensure that the PCR product is a pure, single band of sufficient quantity. This can be done by running part of the product on an 1-3% agarose gel, staining with ethidium bromide (EtBr) to view the PCR DNA (Fig 1). This gel should be loaded carefully as it will later be used to predict the relative amount of purified product that will be used for sequencing. You should avoid sequencing product where: 1) Multiple PCR product are observed (eg lanes labelled * in Fig 1) 2) Significant artifactual smears are observed (eg lanes labelled # in Fig 1) 3) Where the PCR product band is diffuse (eg lanes in Fig 1) 4) Where the PCR product band is very faint (eg lanes labelled & in Fig 1) 5) One band two products? (eg lanes labelled + in Fig 1) Fig1. PCR Products (5 of 50ul) separated on an EtBr stained agarose gel && & # # &* + # * * # # & Cleaning Up PCR Products Gel Elution: The classic method of purifying PCR products is to do GEL ELUTION. The band of interest is excised, PCR DNA separated from the agarose, ethidum bromide removed and purified PCR DNA reprecipitated. Commercial kits like Qbiogene s Clean-Gene II (Cat. # ) are available for this purpose. Note that there is a size limit. Alternatively, the PCR DNA band can be eluted into a well containing 5x TBE that has been cut out in front of the PCR DNA band. Ethidium bromide is then extracted from the PCR DNA using isoamyl alcohol and purified PCR DNA is then reprecipitated. In both cases the procedure is relatively long and the amount of PCR DNA must be relatively large; however, if a PCR fragment MUST be sequenced and multiple bands are present then this may be the only way. Where multiple bands are NOT a problem then a quicker more efficient method of purifying the PCR DNA for sequencing is the ExoSAP-IT kit. ExoSAP-IT Kit (US78200) for rapid efficient clean-up of PCR DNA: from Amersham Pharmacia Biotech [Available from the MICB BioBar] ExoSAP-IT Procedure: To 5 ul of your PCR product add 1 ul ExonucleaseI and 1 ul Shrimp Alkaline Phosphatase. Incubate at 37 o C for 15 min and then 80 o C for 15 min. You would then use ul of this ExoSAP purified PCR product for sequencing. The amount is dependent on the intensity of the PCR product band on the ethidium bromide stained gel (5ul of a 50ul rxn). (See circled samples in Fig 1. Numbers below indicate microlitres (ul) ExoSAP purified PCR product to be used for sequencing) MICB Sequencing Facility, March page 3 of 6
4 ABI PRISM 310 SEQUENCING OF PCR PRODUCT DNA Sequencing Primer Selection Q Can I sequence using the same primers used to generate the PCR product? A Ideally you would want to use a nested primer distinct from the PCR primer; however, in many cases using the same primer will give good sequence. The primer (particularly it s 3 end) must be able to bind the PCR product DNA strongly to initial elongation. If the end of the PCR product DNA obscured by tertiary folding and if the primer can not bind well to the template under sequencing conditions, then no sequence will be obtained. REMEMBER that elongation parameters in sequencing could be significantly different from those of the PCR. Ultimately the quality of the DNA, the quality of the primer and the sequencing elongation parameters will determine whether satifactory sequence will be obtained. Primer Selection If you need to prepare your own sequencing primer then YOU WILL NEED TO CONFIRM that your primer is suitable,- that it does not form primer-dimer pairs, that it does not self compliment, that it s Tm is not too low etc. This is best done using a primer analysis program. For more info see and try their FASTPCR demo program. In general these are the preferred characteristics of your primer: 1) nt in length 2) 40-60% GC content 3) Tm between 50 o C-70 o C 4) No primer-dimer pair formation particularly at the 3 end of the primer 5) Confirm that the primer is unique within your sequence Remember that even though your primer meets all the above criteria THERE ARE NO GUARANTEES it will work. The ultimate test is the sequencing. If your sequencing primer is NOT ideal then you can try increase the primer concentration in the sequencing reaction from 5 pmol to 10 pmol. You may also request a modified annealing temperature, Ta. Sequencing Reaction Setup TIPS: 1. Purify your PCR DNA (see Page 1 of 3 Cleaning up PCR products) 2. Amounts of purified PCR DNA to use depend on the size. The larger the PCR product being sequenced the smaller the moles present. Therefore use the following as a guideline: PCR product size bp use 1-3 ng PCR product size bp use 3-10 ng PCR product size bp use 5-20 ng PCR product size bp use ng PCR product size >2000bp use ng ExoSAP-IT cleaned PCR product use 0.5-2ul (See Fig.1 & ExoSAP-IT on page 1of 3) 3. Pay attention to your pipetter. Monitor the pipetting to confirm that the amounts look correct. 4. Sequencing data will start nucleotides from the 3 end of the primer site. Total volume of PCR DNA and primer must be 3 ul. This should be placed in a 200 ul thin-walled PCR tube. The tube should be labeled with your initials and a sequential number ON THE SIDE of the tube. The tube and a completed SEQUENCING REQUEST FORM should then be brought to the Sequencing Room ON6042. Place the request form in the holder at the door and the tube in the RED rack located in the freezer. MICB Sequencing Facility, March page 4 of 6
5 Overall Profiles The three principle sequencing profiles are shown below. Figure 1: Good Sequence Profile Strong, but not excessive, peaks initially gradually decreasing in height. MICB ABI PRISM 310 SEQUENCING GUIDE BASICS ON ELECTROPHEROGRAMS Figure 2: Too Much DNA Sequence Profile Excessive peaks initially with a rapid decline after some 130 bp. The excessive initial peaks will tend to obscure the start of the sequence. Figure 3: Failed Sequence Profile Failure may be due to any of the factors listed: 1. Too little DNA template 2. Poor or degraded primer 3. Poor reaction setup and execution 4. Poor loading of sample on the sequencer 5. Problem with the sequencer *For EXTERNAL samples we control for 3-5 T Artifact With the BIGDYE reaction mix there is a propensity to have a large T (red-peak) artifact in the nt region. This artifact can be removed with repeated ethanol precipitations. The presence and intensity of the T-artifact peak is a good indicator of how well or poorly ethanol is being removed during ethanol purification of elongated sequencing fragments. Figure 4: No T artifact Figure 5: Small T artifact Figure 6: Large T artifact Assessing Ambiguous (N) Nucleotide If tertiary structure causes specific sequence fragments to run faster or slower than predicted, the ABI software will generate an N. This problem can easily be seen on the electropherogram and the correct nucleotides can be manually assigned. Figure 7: TNNAG is really TCAAG Figure 6: T artifact obscured sequence ATTCTAATTC MICB Sequencing Facility, March page 5 of 6
6 SEQUENCING REQUEST FORM MICB RM ON6042 Name: Phone #: Account to Charge Investigator: Dept. Bldg. Rm# Date Submitted (mm/dd/yy): / / *Help us conserve machine time MICB Sequencing Facility, March page 6 of 6
PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System)
Plant Genomic DNA Extraction using CTAB
Plant Genomic DNA Extraction using CTAB Introduction The search for a more efficient means of extracting DNA of both higher quality and yield has lead to the development of a variety of protocols, however
Kevin Bogart and Justen Andrews. Extraction of Total RNA from Drosophila. CGB Technical Report 2006-10 doi:10.2506/cgbtr-200610
Kevin Bogart and Justen Andrews Extraction of Total RNA from Drosophila CGB Technical Report 2006-10 doi:10.2506/cgbtr-200610 Bogart K and Andrews J. 2006. Extraction of Total RNA from Drosophila. CGB
TIANquick Mini Purification Kit
TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer
HighPure Maxi Plasmid Kit
HighPure Maxi Plasmid Kit For purification of high pure plasmid DNA with high yields www.tiangen.com PP120109 HighPure Maxi Plasmid Kit Kit Contents Storage Cat.no. DP116 Contents RNaseA (100 mg/ml) Buffer
ISOLATE II PCR and Gel Kit. Product Manual
ISOLATE II PCR and Gel Kit Product Manual 2 Product Manual www.bioline.com/isolate PCR and Gel Kit ISOLATE II PCR and Gel Kit ISOLATE II PCR and Gel Kit 1 Kit contents 04 2 Description 04 3 Storage 04
Troubleshooting Sequencing Data
Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page
Chromatin Immunoprecipitation (ChIP)
Chromatin Immunoprecipitation (ChIP) Day 1 A) DNA shearing 1. Samples Dissect tissue (One Mouse OBs) of interest and transfer to an eppendorf containing 0.5 ml of dissecting media (on ice) or PBS but without
UltraClean Soil DNA Isolation Kit
PAGE 1 UltraClean Soil DNA Isolation Kit Catalog # 12800-50 50 preps New improved PCR inhibitor removal solution (IRS) included Instruction Manual (New Alternative Protocol maximizes yields) Introduction
Troubleshooting Guide for DNA Electrophoresis
Troubleshooting Guide for Electrophoresis. ELECTROPHORESIS Protocols and Recommendations for Electrophoresis electrophoresis problem 1 Low intensity of all or some bands 2 Smeared bands 3 Atypical banding
LAB 11 PLASMID DNA MINIPREP
LAB 11 PLASMID DNA MINIPREP STUDENT GUIDE GOAL The objective of this lab is to perform extraction of plasmid DNA and analyze the results. OBJECTIVES After completion, the student should be able to: 1.
NimbleGen DNA Methylation Microarrays and Services
NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the
Procedure for RNA isolation from human muscle or fat
Procedure for RNA isolation from human muscle or fat Reagents, all Rnase free: 20% SDS DEPC-H2O Rnase ZAP 75% EtOH Trizol Chloroform Isopropanol 0.8M NaCitrate/1.2M NaCl TE buffer, ph 7.0 1. Homogenizer-probe
Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website
Biomolecular Core Facility AI Dupont Hospital for Children, Rockland Center One, Room 214 Core: (302) 651-6712, Office: (302) 651-6707, [email protected] Katia Sol-Church, Ph.D., Director Jennifer Frenck
HiPer Total RNA Extraction Teaching Kit
HiPer Total RNA Extraction Teaching Kit Product Code: HTBM012 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1 hour Agarose Gel Electrophoresis: 1 hour Storage Instructions:
Aurora Forensic Sample Clean-up Protocol
Aurora Forensic Sample Clean-up Protocol 106-0008-BA-D 2015 Boreal Genomics, Inc. All rights reserved. All trademarks are property of their owners. http://www.borealgenomics.com [email protected]
GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps)
1 GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps) (FOR RESEARCH ONLY) Sample : Expected Yield : Endotoxin: Format : Operation Time : Elution Volume : 50-400 ml of cultured bacterial
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab)
In vitro analysis of pri-mirna processing by Drosha-DGCR8 complex (Narry Kim s lab) 1-1. Preparation of radiolabeled pri-mirna transcript The RNA substrate for a cropping reaction can be prepared by in
Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products
Genolution Pharmaceuticals, Inc. Revolution through genes, And Solution through genes. Life Science and Molecular Diagnostic Products www.genolution1.com TEL; 02-3010-8670, 8672 Geno-Serum Hepatitis B
Application Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
Sanger Sequencing. Troubleshooting Guide. Failed sequence
Sanger Sequencing Troubleshooting Guide Below are examples of the main problems experienced in ABI Sanger sequencing. Possible causes for failure and their solutions are listed below each example. The
ELUTION OF DNA FROM AGAROSE GELS
ELUTION OF DNA FROM AGAROSE GELS OBTECTIVE: To isolate specific bands or regions of agarose-separated DNA for use in subsequent experiments and/or procedures. INTRODUCTION: It is sometimes necessary to
ZR DNA Sequencing Clean-up Kit
INSTRUCTION MANUAL ZR DNA Sequencing Clean-up Kit Catalog Nos. D40 & D4051 Highlights Simple 2 Minute Bind, Wash, Elute Procedure Flexible 6-20 µl Elution Volumes Allow for Direct Loading of Samples with
Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011
Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)
Genomic DNA Extraction Kit INSTRUCTION MANUAL
Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview
Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation
BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.
DNA Sequencing Troubleshooting Guide
DNA Sequencing Troubleshooting Guide Successful DNA Sequencing Read Peaks are well formed and separated with good quality scores. There is a small area at the beginning of the run before the chemistry
Soybean Seeds Sampling and DNA Extraction. Report on the Validation of a DNA Extraction Method from Soybean Seeds
Soybean Seeds Sampling and DNA Extraction Report on the Validation of a DNA Extraction Method from Soybean Seeds 14 May 2007 Directorate General-Joint Research Centre Institute for Health and Consumer
Wizard SV Gel and PCR Clean-Up System
TECHNICAL BULLETIN Wizard SV Gel and PCR Clean-Up System Instruc ons for Use of Products A9280, A9281, A9282 and A9285 Revised 12/10 TB308 Wizard SV Gel and PCR Clean-Up System All technical literature
Sanger Sequencing: Sample Preparation Guide
Sanger Sequencing: Sample Preparation Guide Use this as a guide to prepare your samples for Sanger sequencing at AGRF CONTENTS 1 Overview... 2 1.1 Capillary Separation (CS) or electrophoretic separation
Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280.
Technical Bulletin Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280. PRINTED IN USA. Revised 4/06 AF9TB141 0406TB141 Wizard DNA Clean-Up System All technical literature is available on
Introduction. Preparation of Template DNA
Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
EZ Load Molecular Rulers. Catalog Numbers 170-8351 20 bp 170-8352 100 bp 170-8353 100 bp PCR 170-8354 500 bp 170-8355 1 kb 170-8356 Precision Mass
EZ Load Molecular Rulers Catalog Numbers 170-8351 20 bp 170-8352 100 bp 170-8353 100 bp PCR 170-8354 500 bp 170-8355 1 kb 170-8356 Precision Mass EZ Load Molecular Rulers Quantity DNA sufficient for 100
50 g 650 L. *Average yields will vary depending upon a number of factors including type of phage, growth conditions used and developmental stage.
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] Phage DNA Isolation Kit Product # 46800, 46850 Product Insert
How To Get Rid Of Small Dna Fragments
AxyPrep TM Mag FragmentSelect-I Protocol (Fragment Size Selection for Illumina Genome Analyzer and Life Technologies SoLiD) Introduction The AxyPrep Mag FragmentSelect-I purification kit utilizes a unique
QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.
QUANTITATIVE RT-PCR Application: Quantitative RT-PCR is used to quantify mrna in both relative and absolute terms. It can be applied for the quantification of mrna expressed from endogenous genes, and
Olympic B3 Summer Science Camp 2015 Weller, Smith, Putnam L3
Chestnut Leaf DNA Extraction Protocol Introduction: we will extract the nucleic acid from leaf tissue by grinding it in a reducing medium (the beta-mercaptoethanol chemical is a reducing agent, it smells
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)
CLONING IN ESCHERICHIA COLI
CLONING IN ESCHERICHIA COLI Introduction: In this laboratory, you will carry out a simple cloning experiment in E. coli. Specifically, you will first create a recombinant DNA molecule by carrying out a
Real-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
DNA Sample preparation and Submission Guidelines
DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send
How To Use An Enzymatics Spark Dna Sample Prep Kit For Ion Torrent
SPARK DNA Sample Prep Kit Ion Torrent (SPK0002-V08) Frequently Asked Questions Under what circumstances would I use SPARK DNA Sample Prep Kit for Ion Torrent? Enzymatics SPARK DNA Sample Prep Kit for Ion
RiboZol RNA Extraction Reagents
RiboZol RNA Extraction Reagents Code Description Size N580-30ML-SAMPLE Ribozol TM RNA Extraction Reagent 30 ml N580-30ML Ribozol TM RNA Extraction Reagent 30 ml N580-100ML Ribozol TM RNA Extraction Reagent
UltraClean Forensic DNA Isolation Kit (Single Prep Format)
UltraClean Forensic DNA Isolation Kit (Single Prep Format) Catalog No. Quantity 14000-10 10 preps 14000-S 1 prep Instruction Manual Please recycle Version: 10302012 1 Table of Contents Introduction...
FOR REFERENCE PURPOSES
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
The fastest spin-column based procedure for purifying up to 10 mg of ultra-pure endotoxin-free transfection-grade plasmid DNA.
INSTRUCTION MANUAL ZymoPURE Plasmid Gigaprep Kit Catalog Nos. D4204 (Patent Pending) Highlights The fastest spin-column based procedure for purifying up to 10 mg of ultra-pure endotoxin-free transfection-grade
ab185916 Hi-Fi cdna Synthesis Kit
ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1
BacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053
INSTRUCTION MANUAL ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 Highlights Simple 10 Minute Bind, Wash, Elute Procedure Flexible 15-20 µl Elution Volumes Allow for Direct Loading of Samples
Terra PCR Direct Polymerase Mix User Manual
Clontech Laboratories, Inc. Terra PCR Direct Polymerase Mix User Manual Cat. Nos. 639269, 639270, 639271 PT5126-1 (031416) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain
UltraClean PCR Clean-Up Kit
UltraClean PCR Clean-Up Kit Catalog No. Quantity 12500-50 50 Preps 12500-100 100 Preps 12500-250 250 Preps Instruction Manual Please recycle Version: 02212013 1 Table of Contents Introduction... 3 Protocol
All-in-One mirna qrt-pcr Detection System Handbook
All-in-One mirna qrt-pcr Detection System Handbook For quantitative detection of mature mirna All-in-One mirna First-Strand cdna Synthesis Kit Cat. No. AMRT-0020 (20 mirna reverse transcription reactions)
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination
Introduction to cloning
1 of 14 Introduction to cloning Aim The aim of this protocol is to serve as a general guideline to mainstream molecular cloning of Gene of Interest ( GOI ). Overview GOI Sequence Transformation into Bacteria
Agencourt RNAdvance Blood Kit for Free Circulating DNA and mirna/rna Isolation from 200-300μL of Plasma and Serum
SUPPLEMENTAL PROTOCOL WHITE PAPER Agencourt RNAdvance Blood Kit for Free Circulating DNA and mirna/rna Isolation from 200-300μL of Plasma and Serum Bee Na Lee, Ph.D., Beckman Coulter Life Sciences Process
Transformation Protocol
To make Glycerol Stocks of Plasmids ** To be done in the hood and use RNase/DNase free tips** 1. In a 10 ml sterile tube add 3 ml autoclaved LB broth and 1.5 ul antibiotic (@ 100 ug/ul) or 3 ul antibiotic
RNA Extraction and Quantification, Reverse Transcription, and Real-time PCR (q-pcr)
RNA Extraction and Quantification, Reverse Transcription, and Real-time Preparation of Samples Cells: o Remove media and wash cells 2X with cold PBS. (2 ml for 6 well plate or 3 ml for 6cm plate) Keep
DNA Isolation Kit for Cells and Tissues
DNA Isolation Kit for Cells and Tissues for 10 isolations of 00 mg each for tissue or 5 x 10 7 cultured cells Cat. No. 11 81 770 001 Principle Starting material Application Time required Results Benefits
PicoMaxx High Fidelity PCR System
PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED
1/12 Dideoxy DNA Sequencing
1/12 Dideoxy DNA Sequencing Dideoxy DNA sequencing utilizes two steps: PCR (polymerase chain reaction) amplification of DNA using dideoxy nucleoside triphosphates (Figures 1 and 2)and denaturing polyacrylamide
PrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
Amplicon Template Preparation and Sequencing
Please note: the shared protocols described herein may not have been validated by Pacific Biosciences and are provided as-is and without any warranty. Use of these protocols is offered to those customers
How To Make A Tri Reagent
TRI Reagent For processing tissues, cells cultured in monolayer or cell pellets Catalog Number T9424 Store at room temperature. TECHNICAL BULLETIN Product Description TRI Reagent is a quick and convenient
1) Vector Preparation sg 1371 w/blp1 Ef1α puro t29 BFP (602 ng/ul)
1) Vector Preparation sg 1371 w/blp1 Ef1α puro t29 BFP (602 ng/ul) a) Digest 5 ug of vector with Thermo Scientific FastDigest BstX1 and Blp1 for 1h at 37ºC. Set up reaction as follows: 100 ul Reaction
Technical Manual No. 0173 Update Date 10112010
TissueDirect TM Multiplex PCR System Technical Manual No. 0173 Update Date 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed
Automation in Genomics High-throughput purification of nucleic acids from biological samples. Valentina Gualdi Operational Scientist PGP
Automation in Genomics High-throughput purification of nucleic acids from biological samples Valentina Gualdi Operational Scientist PGP OVERVIEW Nucleic acid purification technologies general aspects Genomic
DNA ligase. ATP (or NAD+)
DNA Ligase enzyme catalysing formation of phosphodiesteric bound between group 3 -OH of one end of DNA molecule and group 5 -phosphate of the second end of DNA DNA ligase ATP (or NAD+) Ligase cofactors
Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform
Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 3 Sample Prep Workflow, 4 Best Practices, 5 DNA Input Recommendations,
Updated: July 2005. 5' End label RNA markers 18.113 (18mer) and 44.12 (24mer) with Kinase and 32P-gamma-ATP. Gel purify labeled markers.
RNA Cloning Method Flowchart Extract total RNA containing small RNAs. Check quality on denaturing gel with EtBr staining 5' End label RNA markers 18.113 (18mer) and 44.12 (24mer) with Kinase and 32P-gamma-ATP.
qstar mirna qpcr Detection System
qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr
AxyPrep TM Mag PCR Clean-up Protocol
AxyPrep TM Mag PCR Clean-up Protocol Intro The AxyPrep Mag PCR Clean-up kit utilizes a unique paramagnetic bead technology for rapid, high-throughput purification of PCR amplicons. Using this kit, PCR
For information regarding shipping specifications, please refer to the following link: http://dna.macrogen.com/eng/help/orderg.jsp
Macrogen Sample Submission Guide Macrogen has served over 10 years in sequencing field using the cutting edge technology and delivering fast and reliable results. We use high throughput Applied Biosystems
Recommended Procedures for the Extraction of RNA. Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010
Recommended Procedures for the Extraction of RNA Jan Pedersen USDA, APHIS, VS, National Veterinary Services Laboratories, Ames, IA 50010 RNA Extraction Isolates RNA from other cellular components in the
RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl
Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl
TransformAid Bacterial Transformation Kit
Home Contacts Order Catalog Support Search Alphabetical Index Numerical Index Restriction Endonucleases Modifying Enzymes PCR Kits Markers Nucleic Acids Nucleotides & Oligonucleotides Media Transfection
STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR)
STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR) [email protected] Av/ Puerta de Hierro s/n. 28040 Madrid. Tel: (34) 913944082
Investigating a Eukaryotic Genome: Cloning and Sequencing a Fragment of Yeast DNA
Investigating a Eukaryotic Genome: Cloning and Sequencing a Fragment of Yeast DNA Credits: This lab was created by Sarah C.R. Elgin and developed and written by Kathleen Weston-Hafer. Specific protocols
DNA Core Facility: DNA Sequencing Guide
DNA Core Facility: DNA Sequencing Guide University of Missouri-Columbia 216 Life Sciences Center Columbia, MO 65211 http://biotech.missouri.edu/dnacore/ Table of Contents 1. Evaluating Sequencing Data..
Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity
Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity Today you analyze the results of your bacterial transformation from last week and determine the efficiency
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
Hepatitis B Virus Genemer Mix
Product Manual Hepatitis B Virus Genemer Mix Primer Pair for amplification of HBV Specific DNA Fragment Includes Internal Negative Control Primers and Template Catalog No.: 60-2007-12 Store at 20 o C For
RNA PowerSoil Total RNA Isolation Kit Sample (Catalog No. 12866-S) Information for Ordering Product Catalog No. Quantity 12866-25 25 Preps
RNA PowerSoil Total RNA Isolation Kit Sample (Catalog No. 12866-S) Information for Ordering Product Catalog No. Quantity 12866-25 25 Preps Instruction Manual New protocol instructions: (Steps 3-5) Phenol:chloroform:isoamyl
Classic Immunoprecipitation
292PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name Classic Immunoprecipitation Utilizes Protein A/G Agarose for Antibody Binding (Cat.
LAB 7 DNA RESTRICTION for CLONING
BIOTECHNOLOGY I DNA RESTRICTION FOR CLONING LAB 7 DNA RESTRICTION for CLONING STUDENT GUIDE GOALS The goals of this lab are to provide the biotech student with experience in DNA digestion with restriction
DNA Sequencing Handbook
Genomics Core 147 Biotechnology Building Ithaca, New York 14853-2703 Phone: (607) 254-4857; Fax (607) 254-4847 Web: http://cores.lifesciences.cornell.edu/brcinfo/ Email: [email protected] DNA Sequencing
Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform
Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 2 Sample Prep Workflow, 3 Best Practices, 4 DNA Input Recommendations, 6
RNA Fragment DeepSeq Library Preparation Protocol
RNA Fragment DeepSeq Library Preparation Protocol I) LIGATION Recommended input: RNA between 0.05-2 pmol; must have 3' OH 1. Thaw 10X T4 RNA Ligase Reaction Buffer, 50% PEG8000, 20 mm DTT, 7 um App Adaptor
MasterPure RNA Purification Kit
Cat. No. MCR85102 Connect with Epicentre on our blog (epicentral.blogspot.com), Facebook (facebook.com/epicentrebio), and Twitter (@EpicentreBio). www.epicentre.com Lit. # 114 6/2012 1 EPILIT114 Rev. A
ncounter Gene Expression Assay Manual Total RNA and Cell Lysate Protocols
ncounter Gene Expression Assay Manual Total RNA and Cell Lysate Protocols v.20090807 For research use only. Not for use in diagnostic procedures. Limited License Subject to the terms and conditions of
Global MicroRNA Amplification Kit
Global MicroRNA Amplification Kit Store kit at -20 C on receipt (ver. 3-060901) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in
All-in-One First-Strand cdna Synthesis Kit
All-in-One First-Strand cdna Synthesis Kit For reliable first-strand cdna synthesis from all RNA sources Cat. No. AORT-0020 (20 synthesis reactions) Cat. No. AORT-0050 (50 synthesis reactions) User Manual
DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE
DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE We recommend for the sequence visualization the use of software that allows the examination of raw data in order to determine quantitatively how good has
A Brief Guide to Interpreting the DNA Sequencing Electropherogram Version 3.0
A Brief Guide to Interpreting the DNA Sequencing Electropherogram Version 3.0 Plant-Microbe Genomics Facility The Ohio State University 484 W.12 th Ave., Columbus, OH 43210 Ph: 614/247-6204 FAX: 614/247-8696
DNA IQ System Database Protocol
TECHNICAL BULLETIN DNA IQ System Database Protocol Instruc ons for Use of Products DC6700 and DC6701 Revised 11/13 TB297 DNA IQ System Database Protocol All technical literature is available at: www.promega.com/protocols/
Southern Blot Analysis (from Baker lab, university of Florida)
Southern Blot Analysis (from Baker lab, university of Florida) DNA Prep Prepare DNA via your favorite method. You may find a protocol under Mini Yeast Genomic Prep. Restriction Digest 1.Digest DNA with
Chromatin Immunoprecipitation
Chromatin Immunoprecipitation A) Prepare a yeast culture (see the Galactose Induction Protocol for details). 1) Start a small culture (e.g. 2 ml) in YEPD or selective media from a single colony. 2) Spin
ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas
ExpressArt Bacterial H-TR cdna synthesis kit With extreme selectivity against rrnas suitable for 2 to 4 µg total RNA Catalogue No. 8004-A30 (30 rxns) Reagents Materials are provided for 30 cdna synthesis
