One Step mirna Cloning Vector G0760 pfbaavmu6mcs CMVeGFP SV40pA

Transcription

1 One Step mirna Cloning Vector G0760 pfbaavmu6mcs CMVeGFP SV40pA Plasmid Features: Coordinates Feature Tn7L SV40pA (complementary-outside ITRs) AAV2 ITR (130bp) EcoRI mu6 Promoter MCS Pol III Terminator EcoRI CMV Promoter EGFP SV40pA AAV2 ITR (119bp) Gentamicin Tn7R B-lactamase (Ampicillin) Complementary Antibiotic Resistance: Ampicillin and Gentamicin Bacterial Backbone: pfastbac (Invitrogen) Note: To check the integrity of the AAV ITR s perform single restriction enzyme digestions with XmaI, BssHII, and MscI. This plasmid is designed for ease of cloning mirna oligos directly into the pfastbac plasmid backbone. The plasmid may also be used as a template for the mu6 promoter to tail on shrna constructs. Constructs can then be cloned back into this plasmid with EcoRI sites to replace the original mu6 pol III Terminator cassette. Or, alternatively, cloned into the G0451 or G0619 pfbaavmcscmvegfp plasmids. KpnI (1213) PmeI (1218) Ampicillin Tn7L EcoRV (365) 300 SV40pA 600 HindIII (635) BssHII (691) XmaI (717) SmaI (719) XmaI (728) SmaI (730) BssHII (776) MscI (794) 130bp ITR 900 EcoRI (872) mu6 XhoI (1222) SalI (1228) ClaI (1238) HindIII (1243) EcoRV (1251) EcoRI (1255) XmaI (1267) SmaI (1269) BamHI (1273) SpeI (1279) XbaI (1285) NotI (1292) EcoRI (1338) 1200 mcs BamHI (1344) G0760 pfbaavmu6mcscmvegfp 6955bp CMV Promter Red type indicates unique restriction site EGFP Tn7R MscI (4246) Gentamicin bp ITR 2700 SV40pA BssHII (2703) EcoRV (4130) MscI (2958) BssHII (2972) XmaI (3020) SmaI (3022) BssHII (3046) Multiple Cloning Site: KpnI-PmeI-XhoI-SalI-ClaI-HindIII-EcoRV-EcoRI-XmaI-SmaI-BamHI-SpeI-XbaI-NotI. The XhoI and XbaI sites recommended for mirna cloning are unique. Methods for cloning mirna can be found in this manual and are excerpts from Generation of hairpin-based RNAi vectors for biological and therapeutic application. Boudreau RL, Davidson BL. Methods Enzymol. 2012;507: Review. PMID:

2 2 >G0760 pfbaavmu6mcscmvegfp 6955bp CCATTCGCCATTCAGGCTGCAAATAAGCGTTGATATTCAGTCAATTACAAACATTAATAACGAAGAGATGACAGAAAA ATTTTCATTCTGTGACAGAGAAAAAGTAGCCGAAGATGACGGTTTGTCACATGGAGTTGGCAGGATGTTTGATTAAAA ACATAACAGGAAGAAAAATGCCCCGCTGTGGGCGGACAAAATAGTTGGGAACTGGGAGGGGTGGAAATGGAGTTTT TAAGGATTATTTAGGGAAGAGTGACAAAATAGATGGGAACTGGGTGTAGCGTCGTAAGCTAATACGAAAATTAAAAA TGACAAAATAGTTTGGAACTAGATTTCACTTATCTGGTTCGGATCTCCTAGGCGATATCAGTGATCAGATCCAGACAT GATAAGATACATTGATGAGTTTGGACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGA TGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATTGCATTCATTTTATGTTTCAGG TTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATTATGATCCTCTAG TACTTCTCGACAAGCTTACATTATTGAAGCATTTATCAGGGTTATTGTCTCAGACCTGCAGGCAGCTGCGCGCTCGCTC GCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGC GCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTTGTAGTTAATGATTAACCCGCCATGCTACTTATCTAC GTAGCCATGCTCTAGTGAATTCGACGCCGCCATCTCTAGGCCCGCGCCGGCCCCCTCGCACAGACTTGTGGGAGAAG CTCGGCTACTCCCCTGCCCCGGTTAATTTGCATATAATATTTCCTAGTAACTATAGAGGCTTAATGTGCGATAAAAGAC AGATAATCTGTTCTTTTTAATACTAGCTACATTTTACATGATAGGCTTGGATTTCTATAAGAGATACAAATACTAAATTA TTATTTTAAAAAACAGCACAAAAGGAAACTCACCCTAACTGTAAAGTAATTGTGTGTTTTGAGACTATAAATATCCCTT GGAGAAAAGCCTTGTTTGCGTTTAGTGAACCGTCAGATGGTACCGTTTAAACTCGAGGTCGACGGTATCGATAAGCTT GATATCGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCCACAGCGGGGAGATCCAGACATGATA AGATACATTTTTTGAATTCGGATCCTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTC CGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGAC GTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTT GGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTA TGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATG CGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTC AATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATG GGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTGGTTTAGTGAACCGTCAGATCCGCTAGCGCCACC ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCC ACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCAC CGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCG ACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAG GACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAG GGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATAT CATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAG CTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCA CCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGG GATCACTCTCGGCATGGACGAGCTGTACAAGTAAGAGCTCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGCAGC GGCCGACCATGGCCCAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAAT AAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGGATCTCCGGACA CGTGCGGACCGAACTAGAGCATGGCTACGTAGATAAGTAGCATGGCGGGTTAATCATTAACTACAAGGAACCCCTAG TGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCC GGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGGCATGCAAGCTGTAGCCAACCACTAGAACTATAGC TAGAGTCCTGGGCGAACAAACGATGCTCGCCTTCCAGAAAACCGAGGATGCGAACCACTTCATCCGGGGTCAGCAC CACCGGCAAGCGCCGCGACGGCCGAGGTCTTCCGATCTCCTGAAGCCAGGGCAGATCCGTGCACAGCACCTTGCCG TAGAAGAACAGCAAGGCCGCCAATGCCTGACGATGCGTGGAGACCGAAACCTTGCGCTCGTTCGCCAGCCAGGACA GAAATGCCTCGACTTCGCTGCTGCCCAAGGTTGCCGGGTGACGCACACCGTGGAAACGGATGAAGGCACGAACCCA GTTGACATAAGCCTGTTCGGTTCGTAAACTGTAATGCAAGTAGCGTATGCGCTCACGCAACTGGTCCAGAACCTTGAC CGAACGCAGCGGTGGTAACGGCGCAGTGGCGGTTTTCATGGCTTGTTATGACTGTTTTTTTGTACAGTCTATGCCTCG GGCATCCAAGCAGCAAGCGCGTTACGCCGTGGGTCGATGTTTGATGTTATGGAGCAGCAACGATGTTACGCAGCAGC AACGATGTTACGCAGCAGGGCAGTCGCCCTAAAACAAAGTTAGGTGGCTCAAGTATGGGCATCATTCGCACATGTAG GCTCGGCCCTGACCAAGTCAAATCCATGCGGGCTGCTCTTGATCTTTTCGGTCGTGAGTTCGGAGACGTAGCCACCTA CTCCCAACATCAGCCGGACTCCGATTACCTCGGGAACTTGCTCCGTAGTAAGACATTCATCGCGCTTGCTGCCTTCGA CCAAGAAGCGGTTGTTGGCGCTCTCGCGGCTTACGTTCTGCCCAAGTTTGAGCAGCCGCGTAGTGAGATCTATATCTA TGATCTCGCAGTCTCCGGCGAGCACCGGAGGCAGGGCATTGCCACCGCGCTCATCAATCTCCTCAAGCATGAGGCCA ACGCGCTTGGTGCTTATGTGATCTACGTGCAAGCAGATTACGGTGACGATCCCGCAGTGGCTCTCTATACAAAGTTGG GCATACGGGAAGAAGTGATGCACTTTGATATCGACCCAAGTACCGCCACCTAACAATTCGTTCAAGCCGAGATCGGC TTCCCGGCCGCGGAGTTGTTCGGTAAATTGTCACAACGCCGCGAATATAGTCTTTACCATGCCCTTGGCCACGCCCCT CTTTAATACGACGGGCAATTTGCACTTCAGAAAATGAAGAGTTTGCTTTAGCCATAACAAAAGTCCAGTATGCTTTTTC ACAGCATAACTGGACTGATTTCAGTTTACAACTATTCTGTCTAGTTTAAGACTTTATTGTCATAGTTTAGATCTATTTTGT TCAGTTTAAGACTTTATTGTCCGCCCACACCCGCTTACGCAGGGCATCCATTTATTACTCAACCGTAACCGATTTTGCC AGGTTACGCGGCTGGTCTATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTTC CGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAA TACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCG TAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTC

3 AGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTT CCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGT AGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTG CGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTA ACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGA AGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAA CAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGA TCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATtTTGGTCATGAGATTATCA AAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGT CTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACT CCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCAC GCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTA TCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTT GTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCA AGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAG TTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTT CTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAA TACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCT CAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTT CACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGT TGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGA ATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTAAATTGTAAGCGTTAAT ATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTA TAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAGAACGTGGA CTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTT GGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCG GCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCAC GCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTC 3

4 Plasmid Quality Control Transfection: AAV Plasmid Controls Transfection in 293FT Cells 0.7E+06 c/well. 24hrs Post Transfection G0619 pfbaavmcscmvegfp Positive Control 1ug/well G0760 pfbaavmu6mcscmvegfp Positive Control 1ug/well 4

5 Plasmid Quality Control ITR Integrity Digest: G0760 pfbaavmu6mcscmvegfpsv40pa Prep date: 3/29/13 Concentration: 1.8ug/ul Uncut BssHII MscI XmaI XbaI XhoI Expected Fragments from digest of insertless plasmid: Uncut: supercoiled and relaxed. BssHII: 4600, 1927, 269, 85, 74 MscI: 3503, 2164, 1288 XmaI: 4652, 1753, 539, 11 XbaI: 6955 XhoI:

6 Specific Information for cloning mirna in the G0760 pfbaavmu6mcscmvegfp or G0774 pfbaavmu6mcscmvmcherry One Step mirna Plasmids: Background: The restriction sites of these mirna Cloning vectors have been reconfigured to allow the direct cloning of mirna annealed oligo PCR products in one round as opposed to the original method outlined in the references below through TopoBlunt:mU6 and then into the pfbaav vector. One Step mirna plasmids also allow for screening mirna with egfp or mcherry reporters not present in the TopoBlunt:mU6 vector. The mu6 promoter may be used as a template for existing shrna strategies outlined by Boudreau et. al. Please refer to the original publications for working with shrna constructs. References: Generation of hairpin-based RNAi vectors for biological and therapeutic application. Boudreau RL, Davidson BL. Methods Enzymol. 2012;507: Review. PMID: [PubMed - indexed for MEDLINE] sispotr: a tool for designing highly specific and potent sirnas for human and mouse. Boudreau RL, Spengler RM, Hylock RH, Kusenda BJ, Davis HA, Eichmann DA, Davidson BL. Nucleic Acids Res Aug 31. [Epub ahead of print] PMID: [PubMed - as supplied by publisher] sispotr (sirna Sequence Probability-of-Off-Targeting Reduction) Rational design of therapeutic sirnas: minimizing off-targeting potential to improve the safety of RNAi therapy for Huntington's disease. Boudreau RL, Spengler RM, Davidson BL. Mol Ther Dec;19(12): doi: /mt Epub 2011 Sep 27. Protocol: Below are revised excerpts from Generation of hairpin-based RNAi vectors for biological and therapeutic application for mirna design and cloning. Section numbers refer to the numbers in the original publication. GENERATION OF HAIRPIN-BASED RNAi VECTORS FOR BIOLOGICAL AND THERAPEUTIC APPLICATION Ryan L. Boudreau and Beverly Davidson Contents 2. Selecting Candidate sirna Sequences Retrieve sequences for your desired target transcript(s) Select 22-nt long target sites 7 4. Cloning Artificial mirna Expression Vectors Considerations for designing artificial mirnas Oligo design and cloning protocol for artificial mirnas 8 2. Selecting Candidate sirna Sequences 2.1. Retrieve sequences for your desired target transcript(s) Choose your target gene(s) of interest and retrieve the relevant mrna sequence(s) from NCBI, Ensembl, UCSC Genome Browser, or other available databases. We leave it to the reader's responsibility to further investigate target transcripts for variants which may result from RNA processing events (e.g., alternative splicing, alternative polyadenylation, and RNA editing, among others) that may influence the ability to target certain regions within the transcript. In general, we target the coding region; however, targeting the 5 - and 3 -UTR sequences is possible. Careful consideration for the target sequence with regard to the project objectives is important before proceeding with design and screening of inhibitory RNA sequences. 6

7 For instance, the reader should consider whether allele- or splice-isoform-specific silencing is desirable or whether sequence conservation is important, allowing the RNAi vectors to be tested in multiple species Select 22-nt long target sites Identifying potent and highly specific sirna sequences is not trivial. Numerous empirical evaluations of large-scale sirna knockdown data have allowed researchers to establish several sirna design guidelines (Khvorova et al., 2003; Matveeva et al., 2007). For example, one key consideration is that sirna sequences be selected or manipulated to promote accurate loading of the antisense guide strand into RISC, leaving the sense strand to be degraded (Leuschner et al., 2006; Matranga et al., 2005). Furthermore, GC-content and positional nucleotide preferences also influence sirna efficacy. Given the multifaceted nature of designing optimal sirnas, we direct the reader to additional literature on the subject (Birmingham et al., 2007; Davidson and McCray, 2011; Jackson and Linsley, 2010). Also, there are numerous publicly available sirna design tools online. It is important to note that sirna design rules serve more as guidelines, and that sequences adhering to them may not silence and vice versa. NEW: We have developed an online tool, sispotr (sirna Seed Probability of Off-Target Reduction) to assist users with designing sirnas with low off-targeting potential ( 1. sispotr searches user-defined target sequences for sirnas that pass strand-biasing and GC% filters and outputs the candidates with the lowest POTS values. The output provides detailed off-target information for each sirna including i) the number of 3 -UTRs containing each seed site type, ii) the putative off-target transcripts, and iii) counts of each seed site type on a per transcript basis. sispotr also determines if the sirna seed matches that of a known mirna. Recognizing the ease of purchasing pre-validated sirnas, an additional tool allows users to input sirna sequences to obtain relevant off-targeting scores and information. To date, no algorithm guarantees silencing efficacy, and it is most recommend that the user pick three to four candidates for screening. Some investigators screen candidates at a time. Tips and short cuts for working with multiple candidates are outlined in the cloning information below. Here, we will describe a basic strategy for sirna target site selection which incorporates the most important criteria for promoting efficacy, in addition to certain rules that are specific to the design of hairpin-based RNAi expression vectors. We identify 22-nt target sites within the target transcript that adhere to four criteria: (1) high propensity to primarily load the antisense guide strand into RISC, (2) GC content between 20% and 70%, (3) void of restriction enzyme sites relevant to downstream applications (e.g., cloning RNAi expression cassettes into viral vector systems), (4) lacking a stretch of four continuous A or T nucleotides (i.e., AAAA or TTTT). The latter prevents premature transcription termination from Pol III promoters which typically terminate at stretches of four to six T's. Strand biasing is determined by the thermodynamic stabilities present at the ends of the sirna duplex. To achieve faithful loading of the antisense strand, the duplex must be designed such that there is strong G C base pairing present at the 5 -end of the sense (passenger) strand and weak A/G-U base paring at the opposing terminus (Khvorova et al., 2003; Schwarz et al., 2003). The RISC complex selects the strand with the weakest 5 -end thermodynamic stability, in this case, the antisense strand (Fig. 14.1). Hence, we select target sequences that have G or C nucleotides at positions 3 and 4 (note: positions 1 and 2 correspond to the dinucleotide 3 - overhang of the antisense strand) and A, T, or C nucleotides at positions 20, 21, and 22. The C is allowed at the latter positions because we can destabilize the resulting G C base pairs by converting them to G U base pairs (G and U weakly pair in RNA) without altering the antisense strand sequence. Next, the GC content of the 22-nt site is calculated by dividing the number of G or C nucleotides by 22. For instance, the target site shown in Fig has 12 G or C nucleotides, resulting in a GC content of 55% which is within the acceptable range. Finally, we avoid stretches of A's and T's and relevant restriction enzyme sites for reasons mentioned above. Note: the user must also avoid creating these elements upon incorporating the sirna into shrna or artificial mirna scaffolds. 4. Cloning Artificial mirna Expression Vectors 4.1. Considerations for designing artificial mirnas Artificial mirnas, or mirna shuttles, are designed to mimic naturally occurring pri-mirnas, for which the Drosha-DGCR8 and Dicer cleavage sites have been mapped and experimentally validated. With this information, the identity of the small RNA duplex which is processed from the initial stem-loop transcript is known. For artificial mirnas, this region is replaced by sirna duplexes, thus creating a mirna-based hairpin which serves to shuttle sirna sequences into the RNAi pathway. An important consideration for designing artificial mirnas is to maintain the structural and sequence recognition motifs required for appropriate processing. Drosha-DGCR8 binds to regions of single-stranded nature located at the base of the pri-mirna stem loop (Han et al., 2004; Zeng and Cullen, 2005). Thus, including nts of the flanking sequences (5 and 3 ) native to the pri-mirna will help to ensure that the stem-loop base folds properly to promote cleavage at the intended site. Artificial mirnas have been generated using a number of naturally occurring pri-mirnas as scaffolds for sirna sequences (Chung et al., 2006; Tsou et al., 2011; Zeng et al., 2002). Here, we will describe a method to generate artificial mirnas based on the natural human mir-30 pri-mirna transcript. For ease of cloning, we only include a minimal amount of natural mir-30 flanking sequences, while additional 5 - and 3 -sequences are derived from the mouse U6 expression vector. We have characterized these vectors for appropriate expression and processing using small transcript northern blot, small RNA RT- 7

8 PCR and RACE analyses (Boudreau et al., 2008; Chen et al., 2005). We recommend that newly designed mirna shuttles be similarly defined with these techniques, since simply switching promoters, restriction enzyme sites, or expression contexts (e.g., embedding the mirna-based stem loop in the 3 -UTR or intron of a reporter gene) can alter the pri-mirna structure and subsequent processing Oligo design and cloning protocol for artificial mirnas The following steps are outlined in Fig Figure Artificial mirna cloning scheme. The details for designing artificial mirnas and cloning them into the mu6 expression vector are described in the text (Section 4.2, Steps 1 8). Shown here is the example of incorporating the egfptargeted sirna into an artificial mirna scaffold. How to use the sispotr tool: Input sequence(s) for sirna design at Click the appropriate button to paste or upload the sequence(s). Single sequences can be in plain or FASTA format. Multiple 8

9 sequences require FASTA formatting. Select the number of candidates desired in the output. (Advanced) Modify input parameters: GC Content (%Min/Max): Filters candidate sequences based on specified GC content range. 5' Passenger G/C Number: Forces the passenger strand to have high 5' end stability. This decreases likelihood of loading the unintended (passenger) strand. Additional parameters to promote guide strand loading are automatically included in the design. Pol III Expression: Removes sequences with 4 T/U's. Stretches of 4 or more U's can serve as a termination signal for RNA Pol III. Since many shrna/artificial mirna expression vectors use Pol III promoters (e.g. U6, H1) to drive expression, these sequences should be avoided to prevent pre-mature transcript termination. Run sispotr Browse additional off-target information (Highly Recommended): Click "Off-Target Details" to: BLAST against transcript databases. View the overall number of off-targets and the distribution of more potent seed sitetypes (7mer-1A, 7mer-M8, 8mer) View/download list of all predicted off-targets with site-type information. Additional considerations: sirna sequences with POTS numbers less than 50 generally show less toxic effects. We suggest that you avoid sequences within 30 base pairs of a start or stop codon. When possible, you choose sequences with the lowest G/C content. Below is a step-by-step example incorporating the sispotr output and the steps listed in figure 14.3 above to create the mirna primers. Example of sispotr output: Start rank position POTS percentile_worse sirna_seq (antisense) passenger_strand_seq (sense) % UUAGCGCAGUCCUGGCUGCAU GCAGCCAGGACUGCGCUAANN UAGCGCA 7Mer G/C content 61.9% Step 1. Start with the artificial mirna backbone sequence. The mir-30-based artificial mirna backbone consists of constant regions that are partially derived from the human mir-30 pri-mirna. DNA CTCGAGTGAGCG CTGTAAAGCCACAGATGGG CGCCTACTAGT 5 flanking (XhoI and linker) 19nt loop 3 flanking (linker and SpeI) RNA CUCGAGUGAGCG CUGUAAAGCCACAGAUGGG CGCCUACUAGU 5 flanking (XhoI and linker) 19nt loop 3 flanking (linker and SpeI The backbone is engineered with flanking restriction enzyme sites for cloning purposes. The 5 -XhoI and 3 -SpeI sites were chosen since their respective GAG and ACT nucleotides correspond to natural mir-30 stem-loop sequences. The distal (relative to the loop) single nucleotide bulge pictured in Fig is formed by the 5 -and 3 -flanks, while the proximal bulge consists of the 3 -end of the antisense strand; thus, the opposing nucleotide must be manipulated to maintain the bulge for proper Drosha-DGCR8 processing (see Step 3 below). Step 2. Insert sense and antisense sequences. Insert the sense sequence (i.e., target site positions 1 22) immediately after the 5 - flank sequence and the antisense sequence (i.e., the reverse complement of the target site) directly after the loop sequence. CUCGAGUGAGCGGCAGCCAGGACUGCGCUAANNCUGUAAAGCCACAGAUGGGUUAGCGCAGUCCUGGCUGCAUCGCCUACUAGU Step 2.1. Delete N s and add a and matched u on either side of the 19nt loop. 20nt 22nt CUCGAGUGAGCGGCAGCCAGGACUGCGCUAAaCUGUAAAGCCACAGAUGGGuUUAGCGCAGUCCUGGCUGCAUCGCCUACUAGU 9

10 Step 3. Add to 20nt to equal 22nt. Match inside base pair on 20nt to complement corresponding bp in 22nt. Manipulate the 5 -bulge nucleotide to induce a mismatch. The bulge is natural to the human mir-30 pri-mirna transcript, and thus, we aim to maintain this structure to promote proper downstream cleavage by Drosha-DGCR8. In the example, the G nucleotide in the sense strand bulge position (5 ) is converted to an A nucleotide which will create a mismatch with the opposing C bulge nucleotide in the antisense region (3 ). In generating artificial mirnas harboring different sirna sequences, the user should alter the 5 -bulge nucleotide so that it does not pair with the opposing 3 -bulge nucleotide. This can be done following these simple guidelines: A: if the 3 -bulge site is an A, the 5 -bulge nucleotide can be changed from T to either C, G, or A. C: if the 3 -bulge site is a C, the 5 -bulge nucleotide can be changed from G to either A, T, or C. G: if the 3 -bulge site is a G, the 5 -bulge nucleotide can be changed from C to either A or G. T: if the 3 bulge site is a T, the 5 -bulge nucleotide can be changed from A to either C or T. 20nt 22nt CUCGAGUGAGCG cugcagccaggacugcgcuaaacuguaaagccacagauggguuuagcgcaguccuggcugcaucgccuacuagu Step 4. Convert C's to T's at the sense 3 -end to impart duplex instability. See Step 2 in shrna cloning protocol (Section 3.2).Note: at this point, it is good practice to ensure the hairpin sequence is void of stretches of four or more T's and any restriction enzyme sites (e.g., internal XhoI, SpeI, and EcoRI sites) relevant to downstream applications. Step 5. Convert all T's to U's, if not already complete, and fold RNA using UNAfold. available at to confirm that the mirna transcript forms the desired secondary structure. Note: select RNA as the input nucleotide type at the user interface and leave the remaining parameters set to Predicted Dicer Cut Sites Instability Promotes AS in RISC Stability Promotes AS into RISC and keeps S out of RISC Predicted Drosha Cut sites default. UNAfold generally predicts several possible secondary structures for each input; however, the correct version of the mirna should be at the top as the most stable structure. In this case, the fold should resemble the artificial mirna depicted here. Extra bulges indicate that revisions are needed. Step 6. Convert all U s to T s. Design and order DNA oligos. The artificial mirna DNA template is made by annealing two oligos that overlap in the loop region and performing a polymerase extension reaction to create the double-stranded DNA cassette. Oligo 1 consists of the XhoI site, 5 -flank, sense sequence, and loop in forward orientation, while Oligo 2 is the reverse complement of the loop, antisense, 3 -flank and SpeI site. We add four A nucleotides to the 5 -end of each oligo; thus, Oligo 1 will begin with 5 -AAAACTCGAG -3 and Oligo 2 with 5 -AAAAACTAGT -3. These additional bases are required for 10

11 efficient restriction enzyme digestion near the ends of the DNA cassette following the polymerase extension. The resulting DNA oligos can be ordered at reasonable cost from a variety of commercial vendors (e.g., Integrated DNA Technologies, Sigma-Aldrich, or Invitrogen) using the smallest synthesis scale available and standard desalting purification. Upon receipt, the oligos can be reconstituted in purified water to make a 100-μM stock. Hairpin 86mer CTCGAGTGAGCGcTGCAGCCAGGACTGCGCTAAaCTGTAAAGCCACAGATGGGtTTAGCGCAGTCCTGGCTGCATCGCCTACTAGT Hairpin-broken into two primers to be annealed and extended: (Random A s added to the ends for digest) Oligo 1 mirna For: 5 AAAACTCGAGTGAGCGcTGCAGCCAGGACTGCGCTAAaCTGTAAAGCCACAGATGGG 3 58mer mirna Rev: 3 CTGTAAAGCCACAGATGGGtTTAGCGCAGTCCTGGCTGCATCGCCTACTAGT 5 57mer Oligo 2 (rev and comp:) 5 AAAAACTAGTAGGCGATGCAGCCAGGACTGCGCTAAaCCCATCTGTGGCTTTACAG 3 Step 7. Anneal and polymerase extend Oligo 1 and Oligo 2. Reaction conditions 5 μl 10 reaction buffer with MgCl 2 1 μl Oligo 1 (100 μm) 1 μl Oligo 2 (100 μm) 1 μl dntps (10 mm) 0.5 μl enzyme mix (i.e., polymerase) 41.5 μl dh 2 O Incubate the reaction in a thermocycler: 94 C for 2 min (denaturation) 54 C for 1 min (annealing) 72 C for 15 min (extension) Step 8. PCR purification, digestion, and clone directly into G0760 pfbaavmu6mcscmvegfp or G0774 pfbaavmu6mcscmvmcherry. Step 8.1. Purify the extended product using a PCR Purification kit (QIAquick; Qiagen or other) as per the manufacturer's instructions and elute in μl water. Timesaving Tips for working with candidates: Anneal and extend the oligos pairs individually as above. Run a sample on a gel to ensure that the extension worked for each pair and that they are the proper size and roughly the same molar ratio. Pool 5ul of each confirmed double stranded hairpin pair and proceed to digest, and ligate the product as if it is one sample. This reduces the sample handling greatly for several steps. Pick minipreps from the resulting ligation. Process minipreps and sequence. At the University of Iowa, setting up sequencing reactions in a plate format with multiple samples greatly reduces the cost. Screen sequences for all of the original intended mirna hairpin sequences. Typically, the return is %. Step 8.2. Digest the product with XhoI and SpeI by adding the following to the 30 μl eluate: 4 μl 10 restriction enzyme buffer (NEB2; New England Biolabs) 4 μl 10 BSA (10 mg/ml) 1 μl SpeI (10 units/μl) 1 μl XhoI (20 units/μl) Incubate reaction at 37 C for 4 h to overnight. Step 8.3. Digest 3 4 μg of the G0760 pfbaavmu6mcscmvegfp or G0774 pfbaavmu6mcscmvmcherry expression plasmid with XhoI and XbaI. This plasmid contains the mouse U6 promoter followed by a multiple cloning site (MCS) and a Pol III termination signal (six T's) (Fig. 14.4). XbaI- (vector) and SpeI (artificial mirna)-cleaved sites produce compatible sticky ends for ligation. Although there is a SpeI site in the G0760 pfbaavmu6mcscmvegfp and G0774 pfbaavmu6mcscmvmcherry multiple cloning sites, we have found in prior studies that ligation to the XbaI site produces a stem loop which is more efficiently processed, yielding higher antisense RNA levels and more potent gene silencing (Boudreau et al., 2008). Step 8.4. Gel purify the digested fragments. We typically run the digested artificial mirna inserts on a 2% agarose gel and excise the 100-bp band. The digested pfbaavmu6mcscmvegfp (or mcherry) is run on a 1% agarose gel and the 7-kb fragment 11

12 is excised. Gel extraction can be performed by various means. Step 8.5. Perform ligation and bacterial transformation using standard protocols. We ligate 6 ng of insert to 50 ng of vector and incubate at room temperature for 1 h before transformation. The pfbaav plasmid backbone is both ampicillin and gentamicin resistant, and thus, transformed bacteria should be grown on LB agar plates containing a final concentration of 100ug/ml ampicillin and 7ug/ml gentamicin. We highly recommend the use of both antibiotics. The gentamicin resistance is contained within the transposable elements. The ampicillin resistance is outside the transposable elements. The possibility for recombination at the transposable elements or ITRs exists anytime you amplify the plasmid. Recombination at the transposable elements may lead to amp resistant false positives that contain no gene of interest on ampicillin only plates. Because the pfbaavmu6mcscmvegfp vector is digested with two non-cohesive enzymes (XhoI and XbaI), the likelihood of intramolecular vector ligation is minimal, and few, if any, A/G-resistant colonies grow on vector-only control plates. However, we recommend the vector be treated with alkaline phosphatase after restriction enzyme digestion to further minimize the potential for background colonies. We typically pick four to six colonies per artificial mirna construct and grow each of them overnight in 3 ml liquid LB cultures containing 100ug/ml ampicillin and 7ug/ml gentamicin. The following day, minipreps are performed using a miniprep kit which yields plasmid DNA of sufficient quality for cell culture applications. Step 8.6. Screen for positive clones by EcoRI digestion and gel electrophoresis. Note: cloning an artificial mirna into the XhoI and XbaI sites removes the internal EcoRI (in the MCS), and thus, positive clones can be screened for by EcoRI digestion. pfbaavmu6mcscmvegfp or mcherry vector-only plasmid will yield 6489bp, 383bp, and 83bp fragments indicating a negative clone; we recommend digesting the parental pfbaavmu6 vector alongside the potential artificial mirna clones to serve as a reference. The positive constructs with successful insertion of an artificial mirna will yield 6489bp and 483bp bands. Step 8.7. Sequence positive clones using the mu6 forward primer or CMVR primer. Although the orientation of the mu6mirna cassette is independent of the CMVeGFP or CMVmCherry and can be in either orientation, we generally choose those in the forward orientation for ease of sequence and map preparation. Many people make mistakes when putting together sequences and maps of inserts in the reverse orientation from the body of the plasmid. The NotI site in in the cassette in conjunction with an enzyme outside the cassette such as XmaI can be used to conveniently determine orientation. For example, a double digest with NotI and XmaI will yield expected fragments of 4652bp, 1728bp, 581bp, and 11bp with the cassette in the Forward orientation and 4652bp, 2119bp, 190bp, and 11bp with the cassette in the Reverse orientation. Suggested Sequencing Primers: mu6-f ACAGACTTGTGGGAGAAGC CMV-R GTAGGAAAGTCCCATAAGGTCA 4.3. Materials for artificial mirna cloning G0760 pfbaavmu6mcscmvegfp plasmid G0774 pfbaavmu6mcscmvmcherry plasmid Overlapping DNA oligos for artificial mirna Expand high-fidelity Polymerase and buffers (Roche) Restriction enzymes and buffers (XhoI, SpeI, XbaI, EcoRI, NotI, XmaI, BssHII, and MscI) Gel electrophoresis equipment and reagents Gel extraction kit DNA ligase and buffer Chemical competent DH5a and Stbl3 bacterial cells Ampicillin and Gentamicin-containing LB agar growth plates Miniprep kit 12

13 Information and Cloning Suggestions for Working with pfbaav Plasmids: Characteristics of AAV: Adeno-Associated virus (AAV) is a non-pathogenic helper dependant parvovirus. This is one of the most promising vehicles for gene delivery. Recombinant AAV vectors have predominantly episomal gene expression. AAV has long term expression in terminally differentiated cells. It can infect a wide range of cells, including nondividing cells. Insert Size: The major disadvantage of the AAV vectors is the small genome, which limits the size of the transgene (from ITR to ITR) to about 4.7 Kb. Please consider the size of the promoter, polya, any reporters, and your gene of interest when planning the cloning into an AAV shuttle vector. When the length of inserted DNA between the 2 ITRs is close the maximal allowed, i.e., 4.7Kb, the packaging efficiency decreases significantly. AAV Production: The University of Iowa Viral Vector Core uses two systems for AAV production: A Triple Transfection System and the Baculovirus System. The Triple Transfection System may be used with any paav plasmid including the pfbaav plasmids. A phelper plasmid isolated from adenovirus, a Rep/Cap plasmid, and the AAV ITR plasmid package containing the gene of interest are transfected into 40 x 150mm plates of adherent 293FT cells per prep. This system is more labor intensive for production and purification but can be completed within three to four weeks of receiving the plasmid. The services provided for production are: Transfection. Large-scale amplification of AAV vectors. The AAV vector is purified using either CsCl or an iodixanol gradient followed by ionexchange or affinity chromatography. A physical titer in viral genomes per ml (vg/ml) is assessed by QPCR. Sample required: 550ug of AAV plasmid expressing the gene of interest at a concentration greater than 0.25ug/ul per prep. One disadvantage to the investigator in the triple transfection system is having to provide 500ug of DNA for each subsequent prep and the possibility of recombination during the maxi prep process. Each maxi prep should be digested and evaluated for integrity. The Baculovirus System can only be used with pfbaav plasmids with transposable elements to incorporate the ITRs and gene of interest into the Bacmid DNA. This system also relies on the gentamicin selection marker within the transposable elements. The system was developed by Dr. Robert Kotin at the National Institute of Health. The system is described in the following publication: Insect Cells as a Factory to Produce Adeno-Associated Virus Type 2 Vectors Human Gene Therapy 13: (November 1, 2002). The Baculovirus System takes 5-6 weeks for production but has many advantages. The Baculovirus System can tolerate more toxic proteins driven by mammalian promoters as these promoters will not be active in the insect cells. This system is also generally more robust with higher titers, cost-effective, and less labor intensive for production. Once we have a Baculovirus stock of the investigator package, we can make additional preps readily and we have tested the Baculovirus stock to be stable for years. The services provided for production are: Transposition of the gene interest into the DH10Bac bacmid DNA. Everything in the pfbaav plasmid between the transposable elements (Tn7, ITR, Promoter, gene of interest, pa, ITR, gentamicin resistance, Tn7) is incorporated into the large 135,000kb bacmid DNA. Your plasmid must be gentamicin resistant for the transposition to work. Growth and midi prep preparation of Bacmid DNA. Transfection of the Bacmid DNA with gene of interest into Sf9 cells. Approximately 12mls of the P1 stage Baculovirus is harvested 5 days later. 13

14 Titer of the Baculovirus P1 stock. We are able to make 1-3 preps of final AAV virus using the P1 stock depending on the titer of the stock and the desired MOI of infection for the final AAV prep. For multiple AAV virus preps the P1 stock is amplified to a larger volume P2 Baculovirus stock and titered. The final AAV virus is prepared in bioreactor bags on a rocker platform by dual infection with the package Baculovirus and the desired Rep/Cap Baculovirus into Sf9 cells. The Baculovirus provides phelper function. The culture is harvested 3 days later. The AAV vector is purified using either CsCl or an iodixanol gradient followed by ion-exchange or affinity chromatography. A physical titer in viral genomes per ml (vg/ml) is assessed by QPCR. Sample required: 10ug of pfbaav plasmid expressing the gene of interest at a concentration greater than 0.25ug/ul. Bacterial Backbone: Invitrogen pfastbac. For information on the pfastbac backbone and the Baculovirus System, please review the Invitrogen manual: ITRs (Inverted Terminal Repeats): The ITRs for AAV were engineered into the Invitrogen pfastbac backbone by Dr. Robert Kotin. Orientation and Updates: The MCS and BgHpA were inserted in the antisense direction relative to the Invitrogen backbone and ITRs. Please note that the backbone and ITRs were re-sequenced and updated in 2012 and there are several changes. Please discard any older sequences. The nomenclature of 5 ITR (119bp) and 3 ITR (130bp) have been retained on some maps to identify the sequences. The orientation of the ITRs makes no difference to the formation of the viral vector. Recombination: Recombination is a possibility at both the transposable elements (Tn7L and Tn7R) and the Inverted Terminal Repeats (ITRs) in the pfbaav plasmid. In order to check for and reduce the chance of recombination, we have the following recommendations. Antibiotic Resistance: The gentamicin resistant gene lies within the transposable elements and may be lost if the transposable elements recombine. We suggest using both ampicillin and gentamicin selection on plates and in your liquid media throughout the cloning process and during amplification to midi or maxi preps. Ampicillin concentration: 100ug/ml final Gentamicin Sulfate concentration: 7ug/ml final E. Coli Competent Cell Recommendations: We recommend using a stable E. coli strain such as SURE2, Stable2, or Stable3 for transformation of your final plasmid product. These competent cell strains have been engineered to stop unwanted rearrangement events and lack the components of the pathways that catalyze the rearrangement and deletion of nonstandard secondary and tertiary structures, including cruciforms (caused by inverted repeats) and Z-DNA, that occur frequently in eukaryotic cells. Cloning, however, can be difficult in these strains. We recommend DH5a competent cells for sub-cloning. Quality Control ITR Digest: We require a quality control digest of the plasmid upon submission to ensure that there is no recombination before vector production is started. The ITRs in the pfbaav plasmids have several convenient restriction sites to determine whether the ITRs are intact without sequencing. Sequencing the ITRs can be difficult due to their hairpin secondary structure. We suggest a single digest each of BssHII, MscI, and XmaI. It is a good idea to also run un-cut and linearized plasmid next to these digests. Determine your fragment sizes for each digest and check carefully to see that you get what you expect and no extraneous bands. Be sure to check your final midi or maxi product (not just your miniprep) as recombination is possible during any amplification process. 14

15 Sequencing pfbaav plasmids and ITRs The majority of the plasmid and insert can be sequenced normally. Sequencing of the ITRs is difficult but possible. Sequencing of the ITRs or other difficult secondary structures may be aided by requesting Extended Denaturation or by requesting Betaine Chemistry for AAV ITRs in the comments section at the University of Iowa Sequencing Core. Non-UI investigators should consult with their own sequencing facility for help if sequencing of the ITRs is desired. We routinely request Extended Denaturation for all AAV plasmid sequencing. There is no one set of primers that will always sequence through the ITRs. The ITR primers listed below have been used with success in many cases. Try sequencing in both directions: from the plasmid in and from your insert out. Suggested Sequencing Primers for a variety of pfbaav plasmids: Below is a general list of commonly used primers at the University of Iowa Viral Vector Core. Please check to make sure the primers work for the shuttle plasmid you have received. There are many free primer design programs available to design primers that will sequence your insert. BgHpA For BgHpA Rev pfbaav (119bp ITR) pfb587f (130bp ITR) pfb214f (130bp ITR) pfb158f (130bp ITR) EGFP-141Rev EGFP-651For IRES Rev mu6 For CMV Rev CMV For IRESfor TGAGGAAATTGCATCGCATTGTCT AGGAAAGGACAGTGGGAGTG GCCTTGCTGTTCTTCTACGG CTCTACAAATGTGGTATGGCTG GGGGTGGAAATGGAGTTT CATAACAGGAAGAAAAATGCCCCG GAACTTCAGGGTCAGCTTGCCGTA TCACATGGTCCTGCTGGAGTT CTCACATTGCCAAAAGACG ACAGACTTGTGGGAGAAGC GTAGGAAAGTCCCATAAGGTCA GTGGGAGGTCTATATAAGCAGAGCTCG GTTGTGAGTTGGATAGTTGTGG 15

16 Please contact us with any questions: Viral Vector Core University of Iowa 500 Newton Road 221 Eckstein Medical Research Building Iowa City, IA Tel: (319) Updated 1/14/15 SJS 16