Investigating a Eukaryotic Genome: Cloning and Sequencing a Fragment of Yeast DNA
|
|
|
- Homer McKenzie
- 10 years ago
- Views:
Transcription
1 Investigating a Eukaryotic Genome: Cloning and Sequencing a Fragment of Yeast DNA Credits: This lab was created by Sarah C.R. Elgin and developed and written by Kathleen Weston-Hafer. Specific protocols were optimized by Kathleen Weston-Hafer and Wilhelm Cruz. This document was written and assembled by April Bednarski. Funding: This work was funded in part by a Professorship Award to Washington University in support of Sarah C.R. Elgin from Howard Hughes Medical Institute (HHMI) Correspondence: April Bednarski: [email protected] Copyright 2006 Washington University in Saint Louis
2 Cloning and Sequencing a Fragment of Yeast DNA Beginning of Instructor Pages Instructor Pages - - 2
3 Purpose The purpose of this laboratory is to introduce students to the molecular biology techniques used to clone a gene. An important part of this lab is helping students understand the set-up and analysis of control experiments. In the sequence analysis portion of the lab, students gain experience with online bioinformatics tools (BLAST and the Saccharomyces Genome Database). Analysis of DNA fragments recovered is designed to gain some insight into the organization of eukaryotic genomes. Educational Context This lab was created to accompany lecture topics in genomics, bacterial cloning, and molecular biology. The main topics covered in lecture that relate to this lab are bacterial cloning and cycle sequencing. This lab was tailored for undergraduates who are in the first semester of a three-semester introductory biology sequence. This course focuses on molecular biology, bacterial genetics, and introductory biochemistry. This lab begins to introduce students to the differences between eukaryotic genomes. The curriculum was designed for 500 students divided into lab sections of 20, but can be adapted to accommodate any number of students. The following terms and techniques are discussed in this laboratory: restriction endonuclease plasmid vector competent cells ampicillin resistance gene restriction enzyme digest ligation transformation sterile plating plasmid isolation genome DNA gel electrophoresis cycle sequencing BLAST search Summary This section contains a brief summary of the exercises contained in this lab. More thorough discussion of the materials follow in General Materials. The detailed protocol for each exercise is in the Student pages. For the cloning procedure, students use a pbs plasmid that contains a gene for ampicillin resistance. The plasmid is purchased in a form that has been cut with EcoRI restriction endonuclease and treated with phosphatase to prevent plasmid reclosure in the ligation reaction. The insert DNA is prepared by digesting yeast genomic DNA with EcoRI. In lab, students set up a ligation reaction to ligate a fragment from the yeast genome obtained from the EcoRI digest into the pbs plasmid. They then transform E. coli cells with this recombinant plasmid and plate the cells onto LB/ampicillin plates. Since the plasmid contains a gene that codes for an ampicillin resistance protein, only E. coli cells that have been transformed with the plasmid will be able to grow on the LB/ampicillin plates. Figures that describe the above steps are Instructor Pages - - 3
4 in the Student pages. As a control, students also set up a ligation reaction that contains no insert. By using this control in a transformation reaction, they can get a background reading of the frequency of vector reclosure without insert by counting any resulting colonies. Since the vector is treated with phosphatase, this background is usually very low. Sample data is provided in the following section. In the next lab session, students view their LB/ampicillin plates to determine if they obtained any colonies. Generally students have colonies on their experimental plate. Instructors have grown an overnight 4 ml culture in LB/ampicillin using one of their colonies. Students then use this liquid culture to purify the recombinant plasmid. Once they have obtained pure plasmid DNA, they set up an overnight restriction digest with EcoRI. They also set up a reaction containing only plasmid DNA and buffer to use as a control. Finally, students also use their purified plasmid DNA to set up a reaction to sequence the insert. In the next lab period, students run the restriction digest and control on an agarose gel next to a size marker to determine the presence and size of the insert. The reaction containing no EcoRI represents uncut plasmid on the gel. The students then view their sequencing results and submit the obtained sequences to a BLAST search. From the search results, students determine the identity of the cloned fragment. Approximately 50% of the yeast genome is estimated to contain genetic information, so not all students clone a gene. Many students will instead clone a segment of DNA that contains control elements or repetitive sequences. Students then use the Saccharomyces Genome Database to learn more about their cloned fragment. More background information and animations are available on the following Websites: Cloning: Select Techniques PCR: Cycle sequencing: Sanger sequencing: Select Genome Sequencing Center Video Tour in the first paragraph. This 30 min video provides a video tour of the Washington University Genome Sequencing Center with explanations and animations of each step of the sequencing process, which includes PCR and cycle sequencing. Instructor Pages - - 4
5 Time Table The table below provides a general outline for student lab time to perform the experiments. The table does not include the time it may take in lab for students to view and discuss their results or to complete their lab reports. Technique Student Lab Notes Time Ligation and Transformation min Plates incubate overnight 37 C. Instructor then starts overnight cultures from these colonies. Plasmid Isolation 1 hr Restriction Digest 15 min Overnight incubation 37 C Sequencing 15 min Time for results vary** Gel Electrophoresis 1 1 ½ hr Sequence Analysis 30 min * Can remove and store at 4 C until students can view results in lab ** Time for results and sample preparation directions will vary depending on what facility prepares the sequencing results. Refer to the sequencing core facility you choose to use for more information. Instructor Pages - - 5
6 General Materials and Equipment: micropipettors µl, µl, and µl sterile tips for pipetmen markers for labeling vortexer microcentrifuge water bath thermocycler 37 C incubator with shaker agarose gel electrophoresis box and power supply -80 C freezer (for storing competent cells) Glass spreaders (for plating cells) Bunsen burners ethanol (for sterilizing glass spreaders) Materials Preparation Protocols LB agar plates 10 g tryptone 5 g yeast extract 5 g sodium chloride 15 g agar Dilute to 1 L. Adjust to ph 7.0 with 1 M NaOH. Autoclave, then pour into 15 mm petri dishes (25 ml per plate) before solution cools. LB/ampicillin plates 1 liter of LB agar, autoclaved Cool to 55 C Add 10 ml of 10 mg/ml filter-sterilized ampicillin Pour into petri dishes before solution cools. LB sterile media 10 g tryptone 5 g yeast extract 5 g sodium chloride Dilute to 1 L. Adjust to ph 7.0 with NaOH. Autoclave and store sterile at room temperature. LB/ampicillin sterile media 1 liter of LB sterile media Cool to 55 C Add 10 ml of 10 mg/ml filter-sterilized ampicillin. Store sterile at room temperature. 1% agarose gel 0.5 g agarose Instructor Pages - - 6
7 Dissolve agarose in 50 ml TBE Microwave for 1 min. Cool for 5 min. Add 1 µl ethidium bromide ( 10 mg/ml) Pour gel. agarose gel loading buffer 25 mg bromophenol blue 4 g sucrose dh 2 O to 10 ml agarose gel running buffer TBE (Tris Borate EDTA) 218 g Tris base 110 g boric acid 9.3 g EDTA Dissolve in 1.9 L dh 2 O. Bring to ph 8.3 with NaOH. EcoRI-cut yeast genomic DNA (INSERT DNA) 40 µl Yeast genomic DNA (100 ng/µl) 4 µl EcoRI (10 U/µL) 10 µl 10x EcoRI buffer 46 µl dh2o Incubate overnight at 37 C. Remove EcoRI using a QIAQuick PCR Purification kit. Follow the directions in the kit. Elute with 100 µl dh2o for 4.0 µg DNA to yield 0.04 µg/µl. Store cut yeast genomic DNA at -20 C. Sequencing mix Make a 1.6 µm stock solution of the primer. For each reaction, add 2 µl of primer, 8 µl of BigDye Student directions state to add 10 µl of their plasmid prep to 10 µl of the Big Dye/primer mix. Run the samples in the thermocycler using the program: Denature, 3 min Denature, 1 min Anneal, 1 min Elongation, 1 min Program 40 cycle of steps 2 4 Instructor Pages - - 7
8 Ordering Information General chemicals not listed here can be ordered from Sigma ( Unless otherwise noted, the amounts given below will provide enough materials for 20 reactions, with excess. Yeast Genomic DNA (100 µl, 100 ng/µl) Invitrogen ( Catalog number EcoRI restriction enzyme and buffer (5,000 U, 10 U/µL) Invitrogen Catalog number pbluescript II XR Predigested Vector (0.02 µg/µl) Stratagene Catalog number QIAQuick PCR Purification Kit (250) Qiagen Catalog number QIAPrep Spin Miniprep Kit (250) (Contains solutions #1 - #3 discussed on page 6 of the student directions.) Qiagen Catalog number Transformax EC 100 E. coli competent cells (10 x 50 µl, chemically competent order 4 sets or a total of 40 tubes of 50 µl each for 20 reactions) Epicentre Biotechnologies Catalog number CC02810 Fastlink DNA ligase kit (DNA ligase 200 U at 2 U/µL, ATP 10 mm, 200 µl, 10X buffer) Epicentre Biotechnologies Catalog number LK6201H T7 Promoter Sequencing Primer (2 µg, 5 µg/ml) Gibco BRL Catalog number ( ) Taq polymerase and buffer Invitrogen ( Catalog number PCR-grade dh 2 O Invitrogen ( Catalog number Big Dye Terminator v1.1 Cycle Sequencing Kit Applied Biosystems ( Product number dntp mix (10 mm) Invitrogen ( Catalog number Instructor Pages - - 8
9 Instructor Preparation Lab 1: Ligation and Transformation Prepare INSERT DNA (See EcoRI digest under Protocols). Each student (or group) will use 1 µl. Aliquot VECTOR DNA. Each student (or group) will use 2 µl. Set out 10 mm ATP from ligation kit on ice. Each student (or group) uses 2 µl. Prepare two Ligase tubes per student (or group). These will be their reaction tubes. They should contain 1 µl ligase, 1 µl 10x ligase buffer, and 5 µl dh 2 O. Student directions state to add 1 µl of ATP (from the FastLink ligase kit), 1 µl of INSERT DNA, and 1 µl of VECTOR DNA for a final reaction volume of 10 µl. Need two tubes of competent E. coli cells (50 µl each) per student (or group). Keep at -80 C until needed. Place LB/ampicillin plates at 37 C. Need 2 per student (or group). Set water bath to 70 C. Lab 2: Plasmid Isolation, Restriction Digest, and Sequencing Reaction Start overnight 4 ml liquid cultures (in LB/amp) from student cloning plates the evening before lab. Sequencing mix - need one BigDye tube per student (or student group) Companies for DNA sequencing: Lab 3: Gel Electrophoresis and Sequence Analysis Organize DNA sequence results on lab computers so they are easily accessible by students. Instructor Pages - - 9
10 Colonies obtained from cloning: + insert plate = colonies - insert plate = 0 2 colonies Gel picture of EcoRI digest Sample Data and Results Lanes 1 and 12 contain 1 kb DNA ladder. The pbluescript vector runs at 3000 bp when cut (linear). It runs slightly faster when supercoiled (uncut). Lanes 3, 5, 7, and 9 contain uncut recombinant plasmid. Lanes 2, 4, 6, 8, and 10 contain the cut samples. Lane 2 = 3 kb vector and ~1 kb insert Lane 4 = 3 kb vector and ~200 bp insert Lane 6 = 3 kb vector (no insert) Lane 8 = 3 kb vector and possibly 3 kb insert (since uncut vector is running so high) Lane 10 = 3 kb vector and ~4 kb insert Instructor Pages
11 Sequence and BLAST results from Insert sequence (from Lane 2 on gel above): TACGGCGATAGGGTACCGGGCCCCCCCTCGGCGCGCAGGCATCGATAAGCTGG ATATCGAATTCAAGAGCTGCTAGACAATCGGATGCTCTTGAACCAGAGGTAAAGG ATTTAAGTGAACTACCTAGAGCTGAAAAAACCGATTTGACTAATATTTGGATTAGA ACAGCAGCACAAGAATGAGGCATTGCTGGAAGCAAAGATATCTAAGAAAGCCAA TAAAAGTAAGAGGGGCAAGAAGTTAAATAAAAAGGCTCTGGAAGACAAACTGGC CAACTCTATTTCATCCATGGACAGGGATCGTTTAGTGAAGGCCTTGAATTTTACC AATCGTCTGGACGGTAAAATTGCCAAGTCCATTTCTCGTGCCAAGTACATTCAAA ATACAAGAAAGGCTGGCTGGGATAGCACCAATGAGACTATAAAAAAAGAGCTGG CTTTTTTGAACGGAGGGTTGTCTGTGCAGGCTAAAAGTGCTAGTGAAGGTAATGC TGAAAAGGAAGATGAGGAGATCCCAGAAGTTTTTGACTCTTTAGCAGAGGATAAC ACAGTGCAGAAGACTCCTACATATAGATTCGGCGTCCTGCCAGACGATGTTGAA GAATAGAATATTTTCATATGATAGGTCCTAGGAATACACGATTCTTGTACGCATTC TTCTTTTTTCTATCTTCTTTCATTCTTTGTTCATTACATAACATGGCTTTAGCTTAGT TTTATTTTATTTTTTATATATCTGGATGTATACTATTATTGAAAAACTTCATTAATAG TTACCAACTTTCCATATTAAGTTGATTAAGAAAAAGAAATTATTATGGGTAAGCTG AAACCGTGTGATGCATGTCGTTTAAAGATTGTGTAATAAAGGGGACCGCAACGCT TTCTTATATAGATTACCGCCCCACAAAGGAGTACTATGATATTCTCTGCGCATTTT TTGTGGCTGGGTTTGAATCCAGCGTTGGGGAAAGGCACCTCTTGGCTATCCTAC GCTTCATTACCGAAGATCCTCTTGGGGGCTTTTCAAGCTTCCCTATTACAAGCATT TAACCCACACGGGACCCAGGGAAACGCCCACATGAAGGCCCTAATAATGGGGC CCAAGGGGACATTCCAGGCCGAGGCAGGACCCCAGGAAAAGGGAAGCGCGCG AAAGGGAAGCCGCCTCGTAAGACACACTGGGAAACTCTAGGTCAAAAAGACACA Blastn hit P number = 6.3 x Gene name = ECM 1 Instructor Pages
12 Lab report ANSWERS based on sample data (lanes 2 and 3 of gel shown above) 1. In the table below, indicate your results for this experiment. Count the number of colonies on each plate and record them. If there are more than 500 colonies just record >500 ; if there is a lawn record lawn. Plate Reaction contained: Your results 1 (-) Cells + vector, no 2 insert, + ligase 2 (+) Cells + vector, + insert, + ligase If this experiment worked correctly, you will see colonies on plate #2. Explain the presence of bacterial growth that you see on plate #1. Based on the presence or absence of bacterial growth on plate #1, can you say that your experiment was successful or not? Explain. The two colonies on the (-) plate could be from several different things: Contamination by amp-resistant bacteria. Amp in plate may not be at a high enough concentration to inhibit growth. Most likely, the phosphatase treatment of the vector was not 100% efficient and some vector was able to ligate in the absence of insert. This background shows that it is likely that approximately 2 colonies on the (+) plate contain vector without insert. Instructor Pages
13 Here is a representation of a gel similar to the one you ran in lab: The white bands represent ethidium stained DNA fragments. Lane 1 = Uncut pbs vector Lane 2 = pbs vector digested with EcoR I Lanes 3-15 = EcoR I digestions of picked clones (plasmid DNA) 2. Why does the predominant band in the uncut pbs lane migrate with a different mobility compared to the linear ~3 kb EcoR I digested plasmid? (Hint... electrophoretic mobility is based on both size and shape.) The uncut vector is supercoiled, so migrates faster than linear DNA. 3. Which clones do not appear to contain inserts? Explain why you chose these clones. Lanes 2, 4, 10, 11 Only the vector band is present. 4. Provide an explanation for the pattern seen in lane 6. There are two inserts. The three bands are the vector at 3 kb and two inserts less than 3 kb. Instructor Pages
14 Analysis of Your Gel Electrophoresis Results These questions should be answered based on the students results, so answers will vary. The answers provided here are based on lanes 2 and 3 of the gel picture provided under the section Sample Data. Examine the photograph of the agarose gel and answer the following questions. 1. Were you able to isolate plasmid DNA? (Do you see bands on the gel?) yes 2. Describe the results of your "uncut" sample (how many bands and what size(s)). 1 band approximately 4 kb. It is running a little faster. 3. Describe the results of your EcoRI digested DNA (how many bands and what size(s)). 2 bands at 3 kb and approximately 1 kb. 4. Was the plasmid you isolated a recombinant plasmid? Explain how you got your answer. Yes, a recombinant plasmid contains DNA that has been combined from two sources. We have the vector DNA (3 kb) and a second band, which should be yeast DNA (will sequence to confirm). Instructor Pages
15 Analysis of the Yeast Genome Insert Sequence Sequence Information Form Sequence information: Name of file Sequence Cloned in Class Sample file (student name or initials) P-value of top hit from the BLAST search Chromosome and coordinates (bp) Gene name 6.3e-194 Chromosome to bp ECM1 Crick or Watson strand? Watson Gene product: What is the function of the gene product? Unknown, interacts with MTR2 in 60S ribosomal protein subunit export Where is the gene product found in the cell? Can yeast survive without this gene? nucleus yes Instructor Pages
16 1. Compare you results with results from other students. Did everyone clone a gene? What are the implications of the class results? Not all DNA in the genome codes for a gene. 2. Which organism has more non-gene DNA, yeast or humans? (See table below.) humans Human Genome vs. Yeast Genome Fact Table: Human Yeast Number of chromosomes 22 + X and Y 16 Total size (bp) 3,000,000,000 12,067,000 Total genes (estimated) ~25,000 ~6,200 Repetitive elements 43% 10% Pseudogenes ~8, (non-gene ORF s) % of genome that is coding ~1% ~50% The average length of a gene is ~1000 bp (although some yeast genes are much shorter and some human genes are much longer). Based on this length, what is the maximum number of genes that the human and yeast genomes could have? Which genome is closer to having its maximum number of genes? Humans could have 3,000,000 genes, but only have 25,000. Yeast could have 12,067, but only have 6,200. Yeast are much closer to having the maximum number of genes. Instructor Pages
17 Cloning and Sequencing a Fragment of Yeast DNA Beginning of Student Pages Student Pages - -1
18 Cloning and Sequencing a Fragment of Yeast DNA Purpose: The purpose of this lab is to clone and sequence a small fragment of the yeast genome using Eschericia coli bacteria then determine what gene(s) this fragment contains. The process will enable us to investigate the organization of the yeast genome. Background: Molecular cloning allows DNA fragments to be isolated and amplified. The basis of the technology is the in vitro joining of autonomously replicating vector DNA molecules with DNA insert fragments from the desired source organism. The in vitro joining is usually performed by a DNA ligation reaction (catalyzed by DNA ligase) between compatible restriction endonuclease-generated ends on vector and source DNA fragments. This experiment is designed to illustrate how recombinant plasmids are made and analyzed. The recombinant plasmids made in this week's experiment are a combination of yeast genomic DNA and bacterial plasmid DNA. The yeast genomic DNA is referred to as the insert, and the plasmid DNA is the vector. In this kind of cloning experiment the researcher is interested in analyzing the yeast DNA, and feels the analysis will be easier if the yeast genome is separated into small parts that can be individually analyzed. The end result, if the entire yeast genome is cloned into separate chimeric plasmids, will be the creation of a yeast genomic library. This is the strategy used in big sequencing experiments, for example sequencing the entire yeast genome. The genome is first separated into manageable parts, each part is sequenced, and then the separate sequences are aligned to determine the sequence of the entire genome. To create the recombinant plasmid, you will use a small (~3 kb) double-stranded plasmid DNA vector called pbluescript (pbs; figure 1 below). Like all good vectors, pbs contains the necessary information to support its autonomous G replication in a host (E. coli in this case). In addition, the plasmid carries a selectable marker (ampicillin-resistance) to allow easy identification and recovery of host cells harboring the plasmid. Finally, the plasmid has a small region, called the multiple cloning site, that contains unique cutting sites for various restriction endonucleases. The pbs was cut once with the restriction endonuclease EcoR I to generate 5' overhangs. The cut plasmid was subsequently treated with a phosphatase which removes the 5' phosphate from the cut end, thereby preventing plasmid vector re-ligation (remember that a DNA ligase reaction requires a 5 -phosphate and a 3 -hydroxyl as substrates). The insert DNA is from the yeast Saccharomyces cerevisiae. S. cerevisiae genomic DNA was cut with the restriction endonuclease EcoR I but NOT treated with phosphatase. Student Pages - -2
19 Figure 1 A simplified diagram of the pbluescript (pbs) vector. The source and vector DNA samples are mixed together in the presence of buffer, ATP, and DNA ligase. The result should be the formation of a collection of recombinant plasmids that each contain the vector DNA and some fragment of yeast genomic DNA (Figure 2). In the next step, the ligation products will be mixed with E. coli cells that were pretreated with CaCl 2 to permeabilize their Figure 2 A random fragment of yeast DNA is inserted into the vector DNA specifically at EcoR1 sites and ligated to the vector DNA by DNA ligase. cell membranes, thereby facilitating uptake of DNA molecules from the external media. (Cells prepared in this manner are known as competent cells; the process of the DNA entering the cell is called transformation.) At the end of the transformation reaction, the cell mixture will be spread on selective LB + ampicillin plates, allowing the bacteria that have taken up plasmid DNA to replicate while killing the bacteria that failed to take up a plasmid. The result will be the growth of colonies, each colony representing an independent transformation event. This means that each colony is made of up of bacteria that all carry the same recombinant plasmid, but the bacteria in different colonies carry recombinant plasmids that differ from each other in the specific fragment of yeast genomic DNA contained in the plasmid. Student Pages - -3
20 Lab 1: Ligation and Transformation Exercise 1: Ligation 1. Obtain 2 microcentrifuge tubes from your lab instructor that contain DNA ligase and reaction buffer. Label each tube with your initials. In addition, label one tube + and the other - corresponding to wheather INSERT DNA will be added to that tube or not. 2. To each tube, add 1 µl of VECTOR DNA. 3. To the + tube, add 1 µl of INSERT DNA. 4. To the - tube, add 1 µl of dh 2 O. 5. To each tube, add 1 µl of ATP to start the ligation reaction. 6. Gently tap each tube with your finger to mix. Briefly (about seconds), centrifuge the tubes using your table-top centrifuge to collect the liquid in the bottom of the tube. 7. Incubate the tubes for 5 minutes at room temperature. 8. Incubate the tubes for 15 minutes at 70 C to inactivate the DNA ligase. 9. Briefly centrifuge the tubes and place them on ice. Exercise 2: Transformation 1. Obtain two microcentrifuge tubes from your lab instructor that contain chemically competent E. coli cells and quickly place them on ice. It is extremely important that thesse cells do not warm to room temperature! Label the tubes + and Transfer 1.5 µl from the + ligation reaction tube into the + tube containing the E. coli. Carefully, tap the tube with your finger to mix the contents. Do NOT vortex. 3. Likewise, transfer 1.5 µl from the - ligation reaction tube into the - tube containing the E. coli. Tap the tube with your finger to mix the contents. 4. Incubate for 5 minutes on ice. 5. Near the end of the 5 minute incubation, obtain two LB + ampicillin plates from your lab instructor and label them with your group s initials and + or - corresponding to your two tubes. Having the plates pre-warmed to 37 C improves the success of this experiment. Student Pages - -4
21 6. Using sterile technique, spread 50 µl of the cells on the appropriately labeled pre-warmed LB+ampicillin plate. 7. Hand your plates to your lab instructor for overnight incubation at 37 C. Lab 2: Plasmid Isolation and Restriction Digest Today you will use with an overnight culture of bacteria that was started from one unique colony selected from your transformation plates. Using this culture, you should follow the procedure written below to isolate the plasmid DNA from those cells. As you know, an overnight bacterial culture contains approximately 10 8 cells/ml, and those cells can each contain mulitple copies of the plasmid, so the plasmid DNA has already been amplified a lot. To purify your plasmid DNA, you will use a standard alkaline lysis bacterial plasmid miniprep procedure (from the QiaPrep kit) that allows isolation of plasmid DNA free of the bacterial chromosomal DNA. The protocol involves five steps. First, the bacterial cells are harvested by centrifugation. Second, the cells are resuspended in a buffered solution (Solution #1) and lysed by the addition of Solution #2 containing NaOH and sodium dodecyl sulfate (SDS, a common detergent). The NaOH also serves to denature double-stranded chromosomal and plasmid DNA. The third step is the neutralization (with Solution #3) of the alkaline lysis solution to allow doublestranded DNA to reform. The strands from each small circular plasmid DNA will remain interlocked and will quickly reanneal to reform a double-stranded plasmid. However, the complementary strands of the larger linear chromosomal DNA fragments will not reanneal properly and will become irreversibly denatured and insoluble. In addition, the potassium ions in the neutralization solution (#3) cause the detergent to precipitate with insoluble denatured proteins and improperly reassociated chromosomal DNA, carbohydrates and cellular debris. This unwanted material is pelleted by centrifugation in the fourth step, leaving a supernatant containing the desired plasmid DNA. The fifth step is the collection of the plasmid DNA using a column. After isolating plasmid DNA from your bacteria, you will set up a restriction endonuclease digestion. A portion of your newly isolated plasmid DNA will be mixed with EcoR I and buffer. Your restriction digests will be incubated for several hours at 37 C and the resulting fragments size-fractionated by agarose gel electrophoresis next week in lab. Finally, you will also use the plasmid DNA to set up a sequencing reaction to sequence the insert. Exercise 1: Plasmid DNA Isolation: 1. Transfer 1000 µl of your overnight culture to a clean 1.5 ml microcentrifuge tube. 2. Pellet cells by spinning in a high speed microcentrifuge for 1 minute. 3. Remove the supernatant using a P-1000 pipetman (pipet supernatant into tip jar). Student Pages - -5
22 4. Add 250 µl of Solution #1 to the cell pellet. 5. Vortex the tube to resuspend the cell pellet. Make sure that no pellet remains visible on the bottom of the tube. 6. Add 250 µl of Solution #2. Close the cap and tip the tube back and forth to mix (Do not vortex!). Let the tube sit at room temperature for one minute. The mixture should become clear (loss of turbidity due to cells lysis) and viscous (long DNA polymers spill out of the broken cells). 7. Add 350 µl of Solution #3. Close the cap and tip the tube back and forth again to mix (Do not vortex here either). You should see a white precipitate form. Continue tipping back and forth for 30 seconds. 8. Spin the tube in a high speed microcentrifuge for 10 minutes to pellet the debris (including chromosomal DNA, proteins, carbohydrates). 9. Label a clean spin column with your sample name and initials. Carefully remove the entire volume of the supernatant and transfer to the spin column. Be careful not to transfer any of the pellet or floating particles. Discard the tube with the precipitate. 10. Spin the DNA-binding spin column / microcentrifuge tube in the microcentrifuge on your bench for one minute. All of the liquid will be forced through the column and the DNA in the liquid will bind to the resin on the column. Discard the liquid in the microcentrifuge tube and put the column back into the same tube. 11. Transfer 700 µl of Solution #4 onto the column. Spin the tube in the microcentrifuge on your bench for one minute. This step serves to wash any nonspecifically bound material off of the column. The plasmid DNA remains bound to the column during this wash step. 12. Discard the liquid in the microcentrifuge tube and replace the column back in the same tube. 13. Spin the column / microcentrifuge tube (empty) in the high speed microcentrifuge (on the side bench) for one minute. This spin results in the removal of any residual liquid from the column. The plasmid DNA remains bound to the column. 14. Discard the microcentrifuge tube and place the column (still with your plasmid DNA) in a new, labeled microcentrifuge tube. 15. Elute (wash off) your plasmid DNA from the column by pipeting 35 µl of dh 2 O onto the column. Spin the column / microcentrifuge tube in the high speed microcentrifuge for one minute. Your plasmid DNA is now in the liquid in the Student Pages - -6
23 microcentrifuge tube; the column can be discarded. Use this DNA to set up both the restriction digestion and the sequencing reactions as specified below. Exercise 2: Restriction Endonuclease Digestion 1. Transfer 5 µl of your plasmid DNA into a clean microcentrifuge tube marked E for EcoR I digestion. Transfer another 5 µl of your plasmid DNA into a second microcentrifuge tube marked U for the uncut control. Add your initials and section letter onto the side or top of the tubes. 2. Add 15 µl of EcoR I restriction digestion mix (buffer + EcoRI) to the tube labeled E. Add 15 µl of mock restriction digestion mix (buffer but no enzyme) to the tube labeled U. This mock digestion serves as a negative control to determine if the EcoR I digestion worked. 3. Give your tubes to your instructor for overnight incubation at 37 C. Later you will electrophorese your samples to see the result of the DNA isolation and EcoRI digestion. Exercise 3: Sequencing Reaction 1. Obtain a tube containing the sequencing mix (2 µl of the primer and 8 µl of the BigDye Terminator mix) from your lab instructor. 2. Transfer 10 µl of your plasmid DNA into the sequencing mix. 3. Return your tube to your instructor. Samples will be placed in a PCR machine for 40 rounds of cycle sequencing and the products will be analyzed on a DNA sequencing machine. You will receive the sequence data from the fragment you have cloned. Student Pages - -7
24 Agarose Gel Electrophoresis of Plasmid DNA and Computer Analysis of Yeast Genome Inserts This lab period you will see the results of the plasmid isolation and restriction endonuclease digestion that you did previously. Recall that we are hoping to isolate recombinant plasmids that contain pbs vector sequence, and some fragment of yeast genome DNA. The two pieces of DNA were put together by ligating ends originally created by EcoRI digestion, so EcoRI recognition sites should be present at the junctions between vector and insert DNA. For the DNA agarose gel, DNA will be loaded into the wells of the gel and a current will be applied with the positive electrode connected to the bottom of the gel. Since DNA is negatively charged, all of the DNA will run from the wells toward the bottom of the gel. The smaller pieces of DNA will be able to migrate more quickly through the agarose, and so will be farther from the wells at the end of the electrophoresis. To visualize the DNA, we will use a chemical called ethidium bromide. Two useful properties of ethidium bromide are that it naturally intercalates into DNA (thereby tagging DNA molecules), and that it fluoresces when exposed to UV light. The "glowing" spots on the gel show the position of DNA molecules in the gel. In our experiment the ethidium bromide is contained in the agarose gel, so the DNA mixes with it as it electrophoreses. Remember that intercalating agents like ethidium bromide are mutagens, so you must protect yourself from exposure by wearing gloves when handling gels or samples containing ethidium bromide. While the gels are running, you will be able to analyze the sequence that was obtained of your cloned yeast DNA fragment. After viewing your sequence results, you will be able to submit the sequence to a BLAST search to look for matching sequences in the Saccharomyces (yeast) Genome Database (maintained at Stanford University). Exercise 1: Electrophoresis of restriction digestions Did I succeed in cloning a fragment of yeast DNA? 1. Add 3 µl of 10 X loading dye to your E tube (containing your EcoRI-cut DNA) and to your U tube (control uncut DNA). Spin each sample for about 30 seconds in the microcentrifuge on your bench. 2. If desired, use the 10 µl of the practice sample to practice gel loading using the gels in petri dishes at your bench. 3. At the real gel at the front of the lab, load the entire E sample into one well and the entire U sample into another well, following the instructor's directions on specifically which wells to use. Student Pages - -8
25 4. The gel will run approximately 1 hour at 200 V. After electrophoresis is complete, the gel will be placed on a UV light box and photographed for analysis. Student Pages - -9
26 Exercise 2: Computer Analysis of Yeast DNA Inserts Searching for information about your cloned DNA What gene is it? Is it a gene at all? 1. Go to the Saccharomyces Genome Database at 2. Select the BLAST program from the links along the bar at the top of the page. When the BLAST page opens, you should see a box to enter your sequence data. You can just copy and paste the sequence results (in FASTA format) into that box. Next, change the Filter to none. Finally, hit Run BLAST to scan your sequence against the yeast genome. FASTA format and the BLAST program will be explained in class. When you submit your sequence for BLAST, the program will search the DNA sequence of the entire yeast genome to find the sequence you obtained from cloning. When it gets a match, a page will open with the results of your match and will contain links that you can use to find out more about the sequence that your clone matches (for example, gene name, location in the genome, possible function etc.) 3. On the results page, you will see some scores as well as a probability number (P-value). You can think of the P-value as the probability that the hit you found was found by random chance and is not significant (so you want the P-value to be very low!). Start filling out the Sequence Information Form as you complete the following steps. 4. It is hard to derive much information about the sequence on this page, so select ORF Map to see a map of the open reading frames in this area of the genome. 5. The match to your sequence is located between the red dotted lines. If there is a red or blue box in that location, you have cloned part of a gene. The key to the colors used in this diagram is directly below the diagram. The gene names are short combinations of letters and numbers near the red or blue box. If the dotted lines do not intersect with a gene, skip the next step and work on questions 10 and 11. Non-coding DNA is discussed in the lab report. 6. Click on the colored box representing the gene, and a new page will come up with information about that gene. Use this information to answer the questions about the gene product on the Sequence Information Form. Student Pages - -10
27 Name Section Lab Report: Molecular Cloning and Analysis of Yeast Genomic Clones 1. In the table below, indicate your results for this experiment. Count the number of colonies on each plate and record them. If there are more than 500 colonies just record >500 ; if there is a lawn record lawn. Plate Reaction contained: Your results 1 (-) Cells + vector, no insert, + ligase 2 (+) Cells + vector, + insert, + ligase 2. If this experiment worked correctly, you will see colonies on Plate #2. Explain the presence of bacterial growth that you see on plates #1. Based on the presence or absence of bacterial growth on plates 1 and 2, can you say that your experiment was successful or not? Explain. Student Pages - -11
28 Name Section Here is a representation of a gel similar to the one you ran in lab: The white bands represent ethidium stained DNA fragments. Lane 1 = Uncut pbs vector Lane 2 = pbs vector digested with EcoR I Lanes 3-15 = EcoR I digestions of picked clones (plasmid DNA) 3. Why does the predominant band in the uncut pbs lane migrate with a different mobility compared to the linear ~3 kb EcoR I digested plasmid? (Hint... electrophoretic mobility is based on both size and shape.) 4. Which clones do not appear to contain inserts? Explain why you chose these clones. 5. Provide an explanation for the pattern seen in lane 6. Student Pages - -12
29 Analysis of Your Gel Electrophoresis Results Examine the photograph of the agarose gel and answer the following questions. 6. Were you able to isolate plasmid DNA? (Do you see bands on the gel?) 7. Describe the results of your "uncut" sample [how many bands and what size(s)]. 8. Describe the results of your EcoRI digested DNA [how many bands and what size(s)]. 9. Was the plasmid you isolated a recombinant plasmid? Explain your reasoning. Student Pages - -13
30 Analysis of the Yeast Genome Insert Sequence Sequence Information Form Sequence information: Name of file Sequence Cloned in Class P-value of top hit from the BLAST search Chromosome and coordinates (bp) Gene name Crick or Watson strand? Gene product: What is the function of the gene product? Where is the gene product found in the cell? Can yeast survive without this gene? Student Pages - -14
31 10. Why didn t everyone clone a gene? 11. When this experiment was previously performed with 1000 cloning reactions, 500 clones contained a gene, 2 clones contained a rrna gene, and 20 clones contained a trna gene. What do these results reveal about the contents of the yeast genome? 12. Which organism has more non-gene DNA, yeast or humans? (See table and questions below.) Human Genome vs. Yeast Genome Fact Table: Human Yeast Number of chromosomes 22 + X and Y 16 Total size (bp) 3,000,000,000 12,067,000 Total genes (estimated) ~25,000 ~6,200 Repetitive elements 43% 10% Pseudogenes ~8, (non-gene ORF s) % of genome that is coding ~1% ~50% The average length of a gene is ~1000 bp (although some yeast genes are much shorter and some human genes are much longer). Based on this length, what is the maximum number of genes the human and yeast genomes could have? Which genome is closer to having its maximum number of genes? Student Pages - -15
Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity
Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity Today you analyze the results of your bacterial transformation from last week and determine the efficiency
Transformation Protocol
To make Glycerol Stocks of Plasmids ** To be done in the hood and use RNase/DNase free tips** 1. In a 10 ml sterile tube add 3 ml autoclaved LB broth and 1.5 ul antibiotic (@ 100 ug/ul) or 3 ul antibiotic
CLONING IN ESCHERICHIA COLI
CLONING IN ESCHERICHIA COLI Introduction: In this laboratory, you will carry out a simple cloning experiment in E. coli. Specifically, you will first create a recombinant DNA molecule by carrying out a
Bacterial Transformation with Green Fluorescent Protein. Table of Contents Fall 2012
Bacterial Transformation with Green Fluorescent Protein pglo Version Table of Contents Bacterial Transformation Introduction..1 Laboratory Exercise...3 Important Laboratory Practices 3 Protocol...... 4
LAB 11 PLASMID DNA MINIPREP
LAB 11 PLASMID DNA MINIPREP STUDENT GUIDE GOAL The objective of this lab is to perform extraction of plasmid DNA and analyze the results. OBJECTIVES After completion, the student should be able to: 1.
TransformAid Bacterial Transformation Kit
Home Contacts Order Catalog Support Search Alphabetical Index Numerical Index Restriction Endonucleases Modifying Enzymes PCR Kits Markers Nucleic Acids Nucleotides & Oligonucleotides Media Transfection
The Techniques of Molecular Biology: Forensic DNA Fingerprinting
Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins
Application Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
Plant Genomic DNA Extraction using CTAB
Plant Genomic DNA Extraction using CTAB Introduction The search for a more efficient means of extracting DNA of both higher quality and yield has lead to the development of a variety of protocols, however
Lab 5: DNA Fingerprinting
Lab 5: DNA Fingerprinting You are about to perform a procedure known as DNA fingerprinting. The data obtained may allow you to determine if the samples of DNA that you will be provided with are from the
Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011
Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)
TIANquick Mini Purification Kit
TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer
Cloning GFP into Mammalian cells
Protocol for Cloning GFP into Mammalian cells Studiepraktik 2013 Molecular Biology and Molecular Medicine Aarhus University Produced by the instructors: Tobias Holm Bønnelykke, Rikke Mouridsen, Steffan
Southern Blot Analysis (from Baker lab, university of Florida)
Southern Blot Analysis (from Baker lab, university of Florida) DNA Prep Prepare DNA via your favorite method. You may find a protocol under Mini Yeast Genomic Prep. Restriction Digest 1.Digest DNA with
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
The fastest spin-column based procedure for purifying up to 10 mg of ultra-pure endotoxin-free transfection-grade plasmid DNA.
INSTRUCTION MANUAL ZymoPURE Plasmid Gigaprep Kit Catalog Nos. D4204 (Patent Pending) Highlights The fastest spin-column based procedure for purifying up to 10 mg of ultra-pure endotoxin-free transfection-grade
LAB 7 DNA RESTRICTION for CLONING
BIOTECHNOLOGY I DNA RESTRICTION FOR CLONING LAB 7 DNA RESTRICTION for CLONING STUDENT GUIDE GOALS The goals of this lab are to provide the biotech student with experience in DNA digestion with restriction
UltraClean PCR Clean-Up Kit
UltraClean PCR Clean-Up Kit Catalog No. Quantity 12500-50 50 Preps 12500-100 100 Preps 12500-250 250 Preps Instruction Manual Please recycle Version: 02212013 1 Table of Contents Introduction... 3 Protocol
HighPure Maxi Plasmid Kit
HighPure Maxi Plasmid Kit For purification of high pure plasmid DNA with high yields www.tiangen.com PP120109 HighPure Maxi Plasmid Kit Kit Contents Storage Cat.no. DP116 Contents RNaseA (100 mg/ml) Buffer
Green Fluorescent Protein (GFP): Genetic Transformation, Synthesis and Purification of the Recombinant Protein
Green Fluorescent Protein (GFP): Genetic Transformation, Synthesis and Purification of the Recombinant Protein INTRODUCTION Green Fluorescent Protein (GFP) is a novel protein produced by the bioluminescent
Chromatin Immunoprecipitation
Chromatin Immunoprecipitation A) Prepare a yeast culture (see the Galactose Induction Protocol for details). 1) Start a small culture (e.g. 2 ml) in YEPD or selective media from a single colony. 2) Spin
Genomic DNA Extraction Kit INSTRUCTION MANUAL
Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview
Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280.
Technical Bulletin Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280. PRINTED IN USA. Revised 4/06 AF9TB141 0406TB141 Wizard DNA Clean-Up System All technical literature is available on
DNA: A Person s Ultimate Fingerprint
A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)
Troubleshooting Guide for DNA Electrophoresis
Troubleshooting Guide for Electrophoresis. ELECTROPHORESIS Protocols and Recommendations for Electrophoresis electrophoresis problem 1 Low intensity of all or some bands 2 Smeared bands 3 Atypical banding
ELUTION OF DNA FROM AGAROSE GELS
ELUTION OF DNA FROM AGAROSE GELS OBTECTIVE: To isolate specific bands or regions of agarose-separated DNA for use in subsequent experiments and/or procedures. INTRODUCTION: It is sometimes necessary to
HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:
HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone
UltraClean Forensic DNA Isolation Kit (Single Prep Format)
UltraClean Forensic DNA Isolation Kit (Single Prep Format) Catalog No. Quantity 14000-10 10 preps 14000-S 1 prep Instruction Manual Please recycle Version: 10302012 1 Table of Contents Introduction...
Bacterial Transformation and Plasmid Purification. Chapter 5: Background
Bacterial Transformation and Plasmid Purification Chapter 5: Background History of Transformation and Plasmids Bacterial methods of DNA transfer Transformation: when bacteria take up DNA from their environment
UltraClean Soil DNA Isolation Kit
PAGE 1 UltraClean Soil DNA Isolation Kit Catalog # 12800-50 50 preps New improved PCR inhibitor removal solution (IRS) included Instruction Manual (New Alternative Protocol maximizes yields) Introduction
NimbleGen DNA Methylation Microarrays and Services
NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
ISOLATE II PCR and Gel Kit. Product Manual
ISOLATE II PCR and Gel Kit Product Manual 2 Product Manual www.bioline.com/isolate PCR and Gel Kit ISOLATE II PCR and Gel Kit ISOLATE II PCR and Gel Kit 1 Kit contents 04 2 Description 04 3 Storage 04
GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps)
1 GRS Plasmid Purification Kit Transfection Grade GK73.0002 (2 MaxiPreps) (FOR RESEARCH ONLY) Sample : Expected Yield : Endotoxin: Format : Operation Time : Elution Volume : 50-400 ml of cultured bacterial
TECHNICAL BULLETIN. HIS-Select Nickel Affinity Gel. Catalog Number P6611 Storage Temperature 2 8 C
HIS-Select Nickel Affinity Gel Catalog Number P6611 Storage Temperature 2 8 C TECHNICAL BULLETIN Product Description HIS-Select Nickel Affinity Gel is an immobilized metalion affinity chromatography (IMAC)
PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System)
Transformation of the bacterium E. coli. using a gene for Green Fluorescent Protein
Transformation of the bacterium E. coli using a gene for Green Fluorescent Protein Background In molecular biology, transformation refers to a form of genetic exchange in which the genetic material carried
DNA SPOOLING 1 ISOLATION OF DNA FROM ONION
DNA SPOOLING 1 ISOLATION OF DNA FROM ONION INTRODUCTION This laboratory protocol will demonstrate several basic steps required for isolation of chromosomal DNA from cells. To extract the chromosomal DNA,
50 g 650 L. *Average yields will vary depending upon a number of factors including type of phage, growth conditions used and developmental stage.
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] Phage DNA Isolation Kit Product # 46800, 46850 Product Insert
Cloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems
Promega Notes Number 71, 1999, p. 10 Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems By Kimberly Knoche, Ph.D., and Dan Kephart, Ph.D. Promega Corporation Corresponding
ZR DNA Sequencing Clean-up Kit
INSTRUCTION MANUAL ZR DNA Sequencing Clean-up Kit Catalog Nos. D40 & D4051 Highlights Simple 2 Minute Bind, Wash, Elute Procedure Flexible 6-20 µl Elution Volumes Allow for Direct Loading of Samples with
Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION
Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION Susan Carson Heather B. Miller D.Scott Witherow ELSEVIER AMSTERDAM BOSTON HEIDELBERG LONDON NEW YORK OXFORD PARIS SAN DIEGO SAN
UltraClean Forensic DNA Isolation Kit (Single Prep Format)
UltraClean Forensic DNA Isolation (Single Prep Format) Catalog No. Quantity 14000-10 10 preps 14000-20 20 preps 14000-S 1 prep Instruction Manual F Please recycle Version: 06152009 1 Table of Contents
PowerFecal DNA Isolation Kit
PowerFecal DNA Isolation Kit Catalog No. Quantity 12830-50 50 Preps Instruction Manual Inhibitor Removal Technology (IRT) is a registered trademark of MO BIO Laboratories, Inc. and is covered by the following
STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR)
STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR) [email protected] Av/ Puerta de Hierro s/n. 28040 Madrid. Tel: (34) 913944082
MICB ABI PRISM 310 SEQUENCING GUIDE SEQUENCING OF PLASMID DNA
Plasmid DNA Preparation MICB ABI PRISM 310 SEQUENCING GUIDE SEQUENCING OF PLASMID DNA Introduction: I have always used the classic Alkaline Lysis miniprep method to isolate plasmid DNA. (See below) If
RT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
Classic Immunoprecipitation
292PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name Classic Immunoprecipitation Utilizes Protein A/G Agarose for Antibody Binding (Cat.
FOR REFERENCE PURPOSES
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
Introduction. Preparation of Template DNA
Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;
GENETIC TRANSFORMATION OF BACTERIA WITH THE GENE FOR GREEN FLUORESCENT PROTEIN (GFP)
GENETIC TRANSFORMATION OF BACTERIA WITH THE GENE FOR GREEN FLUORESCENT PROTEIN (GFP) LAB BAC3 Adapted from "Biotechnology Explorer pglo Bacterial Transformation Kit Instruction Manual". (Catalog No. 166-0003-EDU)
One Shot TOP10 Competent Cells
USER GUIDE One Shot TOP10 Competent Cells Catalog Numbers C4040-10, C4040-03, C4040-06, C4040-50, and C4040-52 Document Part Number 280126 Publication Number MAN0000633 Revision A.0 For Research Use Only.
Troubleshooting Sequencing Data
Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page
Terra PCR Direct Polymerase Mix User Manual
Clontech Laboratories, Inc. Terra PCR Direct Polymerase Mix User Manual Cat. Nos. 639269, 639270, 639271 PT5126-1 (031416) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain
In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab)
In vitro analysis of pri-mirna processing by Drosha-DGCR8 complex (Narry Kim s lab) 1-1. Preparation of radiolabeled pri-mirna transcript The RNA substrate for a cropping reaction can be prepared by in
ab185916 Hi-Fi cdna Synthesis Kit
ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1
Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides
Western Blot Analysis with Cell Samples Grown in Channel-µ-Slides Polyacrylamide gel electrophoresis (PAGE) and subsequent analyses are common tools in biochemistry and molecular biology. This Application
ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053
INSTRUCTION MANUAL ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 Highlights Simple 10 Minute Bind, Wash, Elute Procedure Flexible 15-20 µl Elution Volumes Allow for Direct Loading of Samples
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)
Crime Scenes and Genes
Glossary Agarose Biotechnology Cell Chromosome DNA (deoxyribonucleic acid) Electrophoresis Gene Micro-pipette Mutation Nucleotide Nucleus PCR (Polymerase chain reaction) Primer STR (short tandem repeats)
Aurora Forensic Sample Clean-up Protocol
Aurora Forensic Sample Clean-up Protocol 106-0008-BA-D 2015 Boreal Genomics, Inc. All rights reserved. All trademarks are property of their owners. http://www.borealgenomics.com [email protected]
Wizard SV Gel and PCR Clean-Up System
TECHNICAL BULLETIN Wizard SV Gel and PCR Clean-Up System Instruc ons for Use of Products A9280, A9281, A9282 and A9285 Revised 12/10 TB308 Wizard SV Gel and PCR Clean-Up System All technical literature
AGAROSE GEL ELECTROPHORESIS:
AGAROSE GEL ELECTROPHORESIS: BEST PRACTICES (BACK TO THE BASICS) Unit of Tropical Laboratory Medicine April 2009 Marcella Mori WORKFLOW OF AGAROSE GEL ELECTROPHORESIS: THREE STEPS Agarose gel electrophoresis
Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform
Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 2 Sample Prep Workflow, 3 Best Practices, 4 DNA Input Recommendations, 6
RESTRICTION ENZYME ANALYSIS OF DNA
University of Massachusetts Medical School Regional Science Resource Center SUPPORTING MATHEMATICS, SCIENCE AND TECHNOLOGY EDUCATION 222 Maple Avenue, Stoddard Building Shrewsbury, MA 01545-2732 508.856.5097
How To Make A Tri Reagent
TRI Reagent For processing tissues, cells cultured in monolayer or cell pellets Catalog Number T9424 Store at room temperature. TECHNICAL BULLETIN Product Description TRI Reagent is a quick and convenient
1/12 Dideoxy DNA Sequencing
1/12 Dideoxy DNA Sequencing Dideoxy DNA sequencing utilizes two steps: PCR (polymerase chain reaction) amplification of DNA using dideoxy nucleoside triphosphates (Figures 1 and 2)and denaturing polyacrylamide
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
Purification of Plasmid DNA
Purification of Plasmid DNA Introduction: The growth of colonies on antibiotic medium provides phenotypic evidence that cells have been transformed. To confirm this at the genotypic level, plasmid DNA
BacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
Transformation Kit BACTERIAL TRANSFORMATION: GREEN FLUORESCENT PROTEIN. Partnership for Biotechnology and Genomics Education
Transformation Kit BACTERIAL TRANSFORMATION: GREEN FLUORESCENT PROTEIN Partnership for Biotechnology and Genomics Education Barbara Soots Linda Curro Education Coordinator University of California Davis
How To Use An Enzymatics Spark Dna Sample Prep Kit For Ion Torrent
SPARK DNA Sample Prep Kit Ion Torrent (SPK0002-V08) Frequently Asked Questions Under what circumstances would I use SPARK DNA Sample Prep Kit for Ion Torrent? Enzymatics SPARK DNA Sample Prep Kit for Ion
Frozen-EZ Yeast Transformation II Catalog No. T2001
INSTRUCTIONS Frozen-EZ Yeast Transformation II Catalog No. T2001 Highlights High transformation efficiency that yields approximately 10 5-10 6 transformants per μg plasmid DNA (circular). Frozen storage
DNA ligase. ATP (or NAD+)
DNA Ligase enzyme catalysing formation of phosphodiesteric bound between group 3 -OH of one end of DNA molecule and group 5 -phosphate of the second end of DNA DNA ligase ATP (or NAD+) Ligase cofactors
HiPer Total RNA Extraction Teaching Kit
HiPer Total RNA Extraction Teaching Kit Product Code: HTBM012 Number of experiments that can be performed: 10 Duration of Experiment Protocol: 1 hour Agarose Gel Electrophoresis: 1 hour Storage Instructions:
DNA Electrophoresis Lesson Plan
DNA Electrophoresis Lesson Plan Primary Learning Outcomes: Students will learn how to properly load a well in an agarose gel. Students will learn how to analyze the results of DNA electrophoresis. Students
Preparing Samples for Sequencing Genomic DNA
Preparing Samples for Sequencing Genomic DNA FOR RESEARCH ONLY Topics 3 Introduction 5 Kit Contents and Equipment Checklist 7 Fragment the Genomic DNA 11 Perform End Repair 12 Add A Bases to the 3' End
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix
CLONING & MAPPING DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix LIBRARY PREP FOR NET GEN SEQUENCING PROTEIN
DNA Isolation Kit for Cells and Tissues
DNA Isolation Kit for Cells and Tissues for 10 isolations of 00 mg each for tissue or 5 x 10 7 cultured cells Cat. No. 11 81 770 001 Principle Starting material Application Time required Results Benefits
restriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas
ExpressArt Bacterial H-TR cdna synthesis kit With extreme selectivity against rrnas suitable for 2 to 4 µg total RNA Catalogue No. 8004-A30 (30 rxns) Reagents Materials are provided for 30 cdna synthesis
Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website
Biomolecular Core Facility AI Dupont Hospital for Children, Rockland Center One, Room 214 Core: (302) 651-6712, Office: (302) 651-6707, [email protected] Katia Sol-Church, Ph.D., Director Jennifer Frenck
PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,
Supplemental Text/Tables PCR Amplification and Sequencing PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Foster City, CA). Each PCR reaction contained 20 ng genomic
PicoMaxx High Fidelity PCR System
PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED
User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube
User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally
Procedures For DNA Sequencing
Procedures For DNA Sequencing Plant-Microbe Genomics Facility (PMGF) Ohio State University 420 Biological Sciences Building 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204 FAX: 614/292-6337
Objectives: Vocabulary:
Introduction to Agarose Gel Electrophoresis: A Precursor to Cornell Institute for Biology Teacher s lab Author: Jennifer Weiser and Laura Austen Date Created: 2010 Subject: Molecular Biology and Genetics
Introduction to cloning
1 of 14 Introduction to cloning Aim The aim of this protocol is to serve as a general guideline to mainstream molecular cloning of Gene of Interest ( GOI ). Overview GOI Sequence Transformation into Bacteria
GENOME RUSSIA PROJECT BLOOD SAMPLES COLLECTION, DNA EXTRACTION AND DNA QUALITY CONTROL PROTOCOLS
ST-PETERSBURG STATE UNIVERSITY THEODOSIUS DOBZHANSKY CENTER FOR GENOME BIOINFORMATICS GENOME RUSSIA PROJECT BLOOD SAMPLES COLLECTION, DNA EXTRACTION AND DNA QUALITY CONTROL PROTOCOLS 2015 The object of
Agrobacterium tumefaciens-mediated transformation of Colletotrichum graminicola and Colletotrichum sublineolum
Agrobacterium tumefaciens-mediated transformation of Colletotrichum graminicola and Colletotrichum sublineolum Flowers and Vaillancourt, 2005. Current Genetics 48: 380-388 NOTE added by L. Vaillancourt:
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
Enzymes: Amylase Activity in Starch-degrading Soil Isolates
Enzymes: Amylase Activity in Starch-degrading Soil Isolates Introduction This week you will continue our theme of industrial microbiologist by characterizing the enzyme activity we selected for (starch
Taq98 Hot Start 2X Master Mix
Taq98 Hot Start 2X Master Mix Optimized for 98C Denaturation Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608) 831-9012 [email protected]
Effects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual
Effects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual I. Purpose...1 II. Introduction...1 III. Inhibition of Bacterial Growth Protocol...2 IV. Inhibition of in vitro
Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu
Expression and Purification of Recombinant Protein in bacteria and Yeast Presented By: Puspa pandey, Mohit sachdeva & Ming yu DNA Vectors Molecular carriers which carry fragments of DNA into host cell.
Pharmaceutical Biotechnology. Recombinant DNA technology Western blotting and SDS-PAGE
Pharmaceutical Biotechnology Recombinant DNA technology Western blotting and SDS-PAGE Recombinant DNA Technology Protein Synthesis Western Blot Western blots allow investigators to determine the molecular
STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY REAL-TIME POLYMERASE CHAI REACTIO (PCR)
STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY REAL-TIME POLYMERASE CHAI REACTIO (PCR) [email protected] Av/ Puerta de Hierro s/n. 28040 Madrid. Tel: (34) 913944082
Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541
PRODUCT INFORMATION Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 Lot _ Store at -20 C Expiry Date _ www.thermoscientific.com/onebio CERTIFICATE OF ANALYSIS The Phusion Site-Directed Mutagenesis
