BIOO LIFE SCIENCE PRODUCTS

Size: px
Start display at page:

Download "BIOO LIFE SCIENCE PRODUCTS"

Transcription

1 BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit and protocol, so it is important to always use the protocol included with the kit. NEXTflex Small RNA Barcode Primers Set A (Illumina Compatible) Catalog #: (96 reactions) BIOO Scientific Corp V14.07

2 TABLE OF CONTENTS GENERAL INFORMATION... 1 Product Overview... 1 Contents, Storage and Shelf Life... 1 Warnings and Precautions... 1 APPENDIX A... 2 Oligonucleotide Sequences... 2 RELATED PRODUCTS... 3 Illumina Compatible DNA NGS Kits and Adapters... 3 DNA Fragmentation... 4 Illumina Compatible RNA NGS Kits and Adapters... 5 The NEXTflex Small RNA Barcode Primers are intended for laboratory use only. NEXTflex is a trademark of Bioo Scientific.

3 GENERAL INFORMATION GENERAL INFORMATION Product Overview The NEXTflex Small RNA Barcode Primers are designed to prepare multiplexed small RNA libraries for sequencing using Illumina platforms. The index is designed within the NEXTflex barcode primers and incorporated during PCR. Pooling of samples may be performed either after PCR or after gel validation. Contents, Storage and Shelf Life The NEXTflex Small RNA Barcode Primers contain 12 barcoded primers with enough material for 8 reactions each when using the NEXTflex Small RNA Sequencing Kit v2 (catalog numbers and ) or 4 reactions each when using the NEXTflex Small RNA Sequencing Kit* (catalog numbers and ). The shelf life of all reagents is 12 months when stored at -20 C. *If using the NEXTflex Small RNA Sequencing Kit (catalog numbers and ) please make sure to use manual version or later. Please contact Bioo Scientific at the phone number or address shown at the end of this document for the latest manual. Kit Contents Volume NEXTflex Barcode Primer µl Warnings and Precautions Bioo Scientific strongly recommends that you read the following warnings and precautions. Periodically, optimizations and revisions are made to the components and manual. Therefore, it is important to follow the protocol included with the kit. If you need further assistance, you may contact your local distributor or Bioo Scientific at [email protected]. Do not use the kit past the expiration date. Try to maintain a laboratory temperature of C (68 77 F). Vortex and micro centrifuge each tube prior to use, to ensure material has not lodged in the cap or the side of the tube. The NEXTflex Small RNA Barcode Primers are intended for laboratory use only. NEXTflex is a trademark of Bioo Scientific. Bioo Scientific makes no warranty of any kind, either expressed or implied, except that the materials from which its products are made are of standard quality. There is no warranty of merchantability of this product, or of the fitness of the product for any purpose. Bioo Scientific shall not be liable for any damages, including special or consequential damage, or expense arising directly or indirectly from the use of this product. BIOO LIFE SCIENCE PRODUCTS 1

4 APPENDIX A APPENDIX A Possible Causes Recommended Action Oligonucleotide Sequences Poor RNA quality NEXTflex Small RNA Barcode Primers Set A Check the RNA quality before beginning the protocol. NAME SEQUENCE (5 3 ) NEXTflex Barcode Primer CAAGCAGAAGACGGCATACGAGATXXXXXX 1 GTGACTGGAGTTCCTTGGCACCCGAGAATTCCA 1 XXXXXX denotes the index region of adapter. The index sequences and their respective reverse complements of each primer are listed below. NEXTflex Barcode Primer Barcode Sequence Reverse Complement* Barcode Primer 1 CGTGAT ATCACG Barcode Primer 2 ACATCG CGATGT Barcode Primer 3 GCCTAA TTAGGC Barcode Primer 4 TGGTCA TGACCA Barcode Primer 5 CACTGT ACAGTG Barcode Primer 6 ATTGGC GCCAAT Barcode Primer 7 GATCTG CAGATC Barcode Primer 8 TCAAGT ACTTGA Barcode Primer 9 CTGATC GATCAG Barcode Primer 10 AAGCTA TAGCTT Barcode Primer 11 GTAGCC GGCTAC Barcode Primer 12 TACAAG CTTGTA *The reverse complement is the sequence that is reported in the index read. BIOO LIFE SCIENCE PRODUCTS 2

5 RELATED PRODUCTS RELATED PRODUCTS Illumina Compatible DNA NGS Kits and Adapters Product Catalog Number NEXTflex 16S V4 Amplicon-Seq kit NEXTflex 16S V4 Amplicon-Seq kit NEXTflex 16S V4 Amplicon-Seq kit NEXTflex 16S V4 Amplicon-Seq kit NEXTflex 16S V4 Amplicon-Seq kit NEXTflex 16S V4 Amplicon-Seq kit NEXTflex 16S V1-V3 Amplicon-Seq kit NEXTflex 16S V1-V3 Amplicon-Seq kit NEXTflex 16S V1-V3 Amplicon-Seq kit NEXTflex 16S V1-V3 Amplicon-Seq kit NEXTflex 16S V1-V3 Amplicon-Seq kit NEXTflex 16S V1-V3 Amplicon-Seq kit NEXTflex DNA Barcodes NEXTflex DNA Barcodes NEXTflex DNA Barcodes NEXTflex DNA Barcodes NEXTflex-96 DNA Barcodes NEXTflex DNA Sequencing Kit (8 reactions) NEXTflex DNA Sequencing Kit (48 reactions) NEXTflex Rapid DNA Sequencing Kit (8 reactions) NEXTflex Rapid DNA Sequencing Kit (48 reactions) NEXTflex Bisulfite-Seq kit (8 reactions) NEXTflex Bisulfite-Seq kit (48 reactions) NEXTflex Bisulfite-Seq Barcodes NEXTflex Bisulfite-Seq Barcodes NEXTflex Msp 1 (8 reactions) NEXTflex Msp 1 (48 reactions) NEXTflex ChIP-Seq Kit (8 reactions) NEXTflex ChIP-Seq Kit (48 reactions) NEXTflex ChIP-Seq Barcodes NEXTflex ChIP-Seq Barcodes NEXTflex ChIP-Seq Barcodes NEXTflex ChIP-Seq Barcodes NEXTflex-96 ChIP-Seq Barcodes NEXTflex PCR-Free DNA Sequencing Kit (8 reactions) NEXTflex PCR-Free DNA Sequencing Kit (48 reactions) NEXTflex PCR-Free Barcodes NEXTflex PCR-Free Barcodes NEXTflex PCR-Free Barcodes NEXTflex PCR-Free Barcodes NEXTflex Methyl-Seq 1 kit (8 reactions) BIOO LIFE SCIENCE PRODUCTS 3

6 NEXTflex Methyl-Seq 1 kit (48 reactions) DNA Fragmentation Product Catalog Number AIR DNA Fragmentation Kit (10 reactions) AIR DNA Fragmentation Kit (40 reactions) BIOO LIFE SCIENCE PRODUCTS 4

7 Illumina Compatible RNA NGS Kits and Adapters Product Catalog Number NEXTflex Poly(A) Beads (8 reactions) NEXTflex Poly(A) Beads (48 reactions) NEXTflex Poly(A) Beads (100 reactions) NEXTflex RNA-Seq Barcodes NEXTflex RNA-Seq Barcodes NEXTflex RNA-Seq Barcodes NEXTflex RNA-Seq Barcodes NEXTflex-96 RNA-Seq Barcodes NEXTflex RNA-Seq Kit (8 reactions) NEXTflex RNA-Seq Kit (48 reactions) NEXTflex Directional RNA-Seq Kit V2 (8 reactions) NEXTflex Directional RNA-Seq Kit V2 (48 reactions) NEXTflex Rapid RNA-Seq Kit (8 reactions) NEXTflex Rapid RNA-Seq Kit (48 reactions) NEXTflex Rapid Directional RNA-Seq Kit (8 reactions) NEXTflex Rapid Directional RNA-Seq Kit (48 reactions) NEXTflex qrna-seq Kit 4 barcodes (8 reactions) NEXTflex qrna-seq Kit 24 barcodes - Set A (48 reactions) NEXTflex qrna-seq Kit 24 barcodes - Set B (48 reactions) NEXTflex qrna-seq Kit 24 barcodes - Set C (48 reactions) NEXTflex qrna-seq Kit 24 barcodes - Set D (48 reactions) NEXTflex Rapid Directional qrna-seq Kit 4 barcodes (8 reactions) D NEXTflex Rapid Directional qrna-seq Kit 24 barcodes - Set A (48 reactions) D NEXTflex Rapid Directional qrna-seq Kit 24 barcodes - Set B (48 reactions) D NEXTflex Rapid Directional qrna-seq Kit 24 barcodes - Set C (48 reactions) D NEXTflex Rapid Directional qrna-seq Kit 24 barcodes - Set D (48 reactions) D NEXTflex Small RNA Sequencing Kit (24 reactions) NEXTflex Small RNA Sequencing Kit (48 reactions) NEXTflex Small RNA Barcodes Set A NEXTflex Small RNA Barcodes Set B NEXTflex Small RNA Barcodes Set C NEXTflex Small RNA Barcodes Set D Bioo Scientific offers library prep kits and barcodes for the Ion Torrent, 5500 SOLiD and SOLiD 4 sequencing platforms. For more information about any of these kits visit our website at Bioo Scientific Corporation 7050 Burleson Road Austin, TX USA Tel: Fax: (512) Made in USA BIOO Research Products Group [email protected] BIOO LIFE SCIENCE PRODUCTS 5

FOR REFERENCE PURPOSES

FOR REFERENCE PURPOSES BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit

More information

Introduction Bioo Scientific

Introduction Bioo Scientific Next Generation Sequencing Catalog 2014-2015 Introduction Bioo Scientific Bioo Scientific is a global life science company headquartered in Austin, TX, committed to providing innovative products and superior

More information

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing.

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing. User manual imegen Anchovies II ID kit Anchovies species (E. encrasicolus and E. japonicus) DNA detection by sequencing Reference: Made in Spain The information in this guide is subject to change without

More information

TruSeq DNA Methylation Library Preparation Guide

TruSeq DNA Methylation Library Preparation Guide TruSeq DNA Methylation Library Preparation Guide Kit Contents 3 Consumables and Equipment 4 Preparation 5 Quality Control of Bisulfite-Converted DNA 6 TruSeq DNA Methylation Kit Protocol 7 Sequencing the

More information

ab185916 Hi-Fi cdna Synthesis Kit

ab185916 Hi-Fi cdna Synthesis Kit ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1

More information

Illumina TruSeq DNA Adapters De-Mystified James Schiemer

Illumina TruSeq DNA Adapters De-Mystified James Schiemer 1 of 5 Illumina TruSeq DNA Adapters De-Mystified James Schiemer The key to sequencing random fragments of DNA is by the addition of short nucleotide sequences which allow any DNA fragment to: 1) Bind to

More information

How To Use An Enzymatics Spark Dna Sample Prep Kit For Ion Torrent

How To Use An Enzymatics Spark Dna Sample Prep Kit For Ion Torrent SPARK DNA Sample Prep Kit Ion Torrent (SPK0002-V08) Frequently Asked Questions Under what circumstances would I use SPARK DNA Sample Prep Kit for Ion Torrent? Enzymatics SPARK DNA Sample Prep Kit for Ion

More information

Creatine Kinase (CK) Enzymatic Assay Kit Manual Catalog #: 3460-07

Creatine Kinase (CK) Enzymatic Assay Kit Manual Catalog #: 3460-07 Creatine Kinase (CK) Enzymatic Assay Kit Manual Catalog #: 3460-07 TABLE OF CONTENTS GENERAL INFORMATION... 2 Product Description... 2 Procedure Overview... 2 Kit Contents, Storage and Shelf Life... 3

More information

Genomic DNA Extraction Kit INSTRUCTION MANUAL

Genomic DNA Extraction Kit INSTRUCTION MANUAL Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview

More information

The RNAi Consortium (TRC) Broad Institute

The RNAi Consortium (TRC) Broad Institute TRC Laboratory Protocols Protocol Title: One Step PCR Preparation of Samples for Illumina Sequencing Current Revision Date: 11/10/2012 RNAi Platform,, [email protected] Brief Description: This

More information

CompleteⅡ 1st strand cdna Synthesis Kit

CompleteⅡ 1st strand cdna Synthesis Kit Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:

More information

RealLine HCV PCR Qualitative - Uni-Format

RealLine HCV PCR Qualitative - Uni-Format Instructions for use PCR KIT FOR EXTRACTION OF RNA AND REAL TIME PCR DETECTION KIT FOR HEPATITIS C VIRUS RNA Research Use Only Qualitative Uni Format VBD0798 48 tests valid from: December 2013 Rev11122013

More information

How To Write An Ipa

How To Write An Ipa LIBRARY PREPARATION NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) Instruction Manual NEB #E7300S/L 24/96 reactions Sign up for the NEBNext e-newsletter Scan this code or visit www.neb.com/

More information

PreciseTM Whitepaper

PreciseTM Whitepaper Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis

More information

TaqMan Fast Advanced Master Mix. Protocol

TaqMan Fast Advanced Master Mix. Protocol TaqMan Fast Advanced Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED

More information

Path-ID Multiplex One-Step RT-PCR Kit

Path-ID Multiplex One-Step RT-PCR Kit USER GUIDE Path-ID Multiplex One-Step RT-PCR Kit TaqMan probe-based multiplex one-step real-time RT-PCR detection of RNA targets Catalog Numbers 4428206, 4428207, 4440022 Publication Part Number 4440907

More information

Introduction to next-generation sequencing data

Introduction to next-generation sequencing data Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS

More information

PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200

PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System)

More information

UltraClean Soil DNA Isolation Kit

UltraClean Soil DNA Isolation Kit PAGE 1 UltraClean Soil DNA Isolation Kit Catalog # 12800-50 50 preps New improved PCR inhibitor removal solution (IRS) included Instruction Manual (New Alternative Protocol maximizes yields) Introduction

More information

Application Guide... 2

Application Guide... 2 Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied

More information

ZR DNA Sequencing Clean-up Kit

ZR DNA Sequencing Clean-up Kit INSTRUCTION MANUAL ZR DNA Sequencing Clean-up Kit Catalog Nos. D40 & D4051 Highlights Simple 2 Minute Bind, Wash, Elute Procedure Flexible 6-20 µl Elution Volumes Allow for Direct Loading of Samples with

More information

SEQUENCING. From Sample to Sequence-Ready

SEQUENCING. From Sample to Sequence-Ready SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major

More information

Reverse Transcription System

Reverse Transcription System TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/

More information

qpcr Quantification Protocol Guide

qpcr Quantification Protocol Guide qpcr Quantification Protocol Guide FOR RESEARCH USE ONLY Topics 3 Introduction 5 User-Supplied Consumables and Equipment 7 Select Template 8 Dilute qpcr Template 9 Dilute Libraries 10 Prepare Reaction

More information

UltraClean Forensic DNA Isolation Kit (Single Prep Format)

UltraClean Forensic DNA Isolation Kit (Single Prep Format) UltraClean Forensic DNA Isolation Kit (Single Prep Format) Catalog No. Quantity 14000-10 10 preps 14000-S 1 prep Instruction Manual Please recycle Version: 10302012 1 Table of Contents Introduction...

More information

ncounter Gene Expression Assay Manual Total RNA and Cell Lysate Protocols

ncounter Gene Expression Assay Manual Total RNA and Cell Lysate Protocols ncounter Gene Expression Assay Manual Total RNA and Cell Lysate Protocols v.20090807 For research use only. Not for use in diagnostic procedures. Limited License Subject to the terms and conditions of

More information

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.

New Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc. New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System

More information

Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products

Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products Genolution Pharmaceuticals, Inc. Revolution through genes, And Solution through genes. Life Science and Molecular Diagnostic Products www.genolution1.com TEL; 02-3010-8670, 8672 Geno-Serum Hepatitis B

More information

RT-PCR: Two-Step Protocol

RT-PCR: Two-Step Protocol RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed

More information

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011 Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)

More information

GenScript BloodReady TM Multiplex PCR System

GenScript BloodReady TM Multiplex PCR System GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI

More information

Host OS Compatibility Guide

Host OS Compatibility Guide Host OS Compatibility Guide Last Updated: December 16, 2014 For more information go to vmware.com. Host Operating System Compatibility Microsoft Windows 7 Supported s Windows 7 vsphere Client (Windows)4.1

More information

MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C

MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

How To Get Rid Of Small Dna Fragments

How To Get Rid Of Small Dna Fragments AxyPrep TM Mag FragmentSelect-I Protocol (Fragment Size Selection for Illumina Genome Analyzer and Life Technologies SoLiD) Introduction The AxyPrep Mag FragmentSelect-I purification kit utilizes a unique

More information

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 INSTRUCTION MANUAL ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 Highlights Simple 10 Minute Bind, Wash, Elute Procedure Flexible 15-20 µl Elution Volumes Allow for Direct Loading of Samples

More information

14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2

14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2 www.medical-genetics.de Routine HLA typing by Next Generation Sequencing Kaimo Hirv Center for Human Genetics and Laboratory Medicine Dr. Klein & Dr. Rost Lochhamer Str. 9 D-8 Martinsried Tel: 0800-GENETIK

More information

Mercodia Diabetes Antigen Control Rat/Mouse (Low, Medium, High)

Mercodia Diabetes Antigen Control Rat/Mouse (Low, Medium, High) Mercodia Diabetes Antigen Control Rat/Mouse (Low, Medium, High) Direction for Use 10-1220-01 Manufactured by Mercodia AB Sylveniusgatan 8A SE-754 50 Uppsala Sweden INTENDED USE Mercodia Diabetes Antigen

More information

First Strand cdna Synthesis

First Strand cdna Synthesis 380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences

More information

Bioanalyzer Applications for

Bioanalyzer Applications for Bioanalyzer Applications for Next-Gen Sequencing: Updates and Tips March 1 st, 2011 Charmian Cher, Ph.D Field Applications Scientist Page 1 Agenda 1 2 3 Next-gen sequencing library preparation workflow

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

One Shot TOP10 Competent Cells

One Shot TOP10 Competent Cells USER GUIDE One Shot TOP10 Competent Cells Catalog Numbers C4040-10, C4040-03, C4040-06, C4040-50, and C4040-52 Document Part Number 280126 Publication Number MAN0000633 Revision A.0 For Research Use Only.

More information

Agencourt RNAdvance Blood Kit for Free Circulating DNA and mirna/rna Isolation from 200-300μL of Plasma and Serum

Agencourt RNAdvance Blood Kit for Free Circulating DNA and mirna/rna Isolation from 200-300μL of Plasma and Serum SUPPLEMENTAL PROTOCOL WHITE PAPER Agencourt RNAdvance Blood Kit for Free Circulating DNA and mirna/rna Isolation from 200-300μL of Plasma and Serum Bee Na Lee, Ph.D., Beckman Coulter Life Sciences Process

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

AffinityScript QPCR cdna Synthesis Kit

AffinityScript QPCR cdna Synthesis Kit AffinityScript QPCR cdna Synthesis Kit INSTRUCTION MANUAL Catalog #600559 Revision C.01 For In Vitro Use Only 600559-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this

More information

Software Getting Started Guide

Software Getting Started Guide Software Getting Started Guide For Research Use Only. Not for use in diagnostic procedures. P/N 001-097-569-03 Copyright 2010-2013, Pacific Biosciences of California, Inc. All rights reserved. Information

More information

Taq98 Hot Start 2X Master Mix

Taq98 Hot Start 2X Master Mix Taq98 Hot Start 2X Master Mix Optimized for 98C Denaturation Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608) 831-9012 [email protected]

More information

mircute mirna qpcr Detection Kit (SYBR Green)

mircute mirna qpcr Detection Kit (SYBR Green) mircute mirna qpcr Detection Kit (SYBR Green) For detection of mirna using real-time RT-PCR (SYBR Green I) www.tiangen.com QP110302 mircute mirna qpcr Detection Kit (SYBR Green) Kit Contents Cat. no. FP401

More information

RevertAid Premium First Strand cdna Synthesis Kit

RevertAid Premium First Strand cdna Synthesis Kit RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

NimbleGen DNA Methylation Microarrays and Services

NimbleGen DNA Methylation Microarrays and Services NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the

More information

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing

More information

USER GUIDE. Encore PART NOS. 8041 and 8042. SP Rapid Library Systems

USER GUIDE. Encore PART NOS. 8041 and 8042. SP Rapid Library Systems USER GUIDE Encore PART NOS. 8041 and 8042 SP Rapid Library Systems Patents, Licensing and Trademarks 2012 2013 NuGEN Technologies, Inc. All rights reserved. The Encore, Ovation and Applause families of

More information

PicoMaxx High Fidelity PCR System

PicoMaxx High Fidelity PCR System PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED

More information

UltraClean PCR Clean-Up Kit

UltraClean PCR Clean-Up Kit UltraClean PCR Clean-Up Kit Catalog No. Quantity 12500-50 50 Preps 12500-100 100 Preps 12500-250 250 Preps Instruction Manual Please recycle Version: 02212013 1 Table of Contents Introduction... 3 Protocol

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

Instruction manual for product # PNAC-2001. Version 1.2

Instruction manual for product # PNAC-2001. Version 1.2 PNAClamp BRAF Mutation Detection Kit For in vitro diagnostic use Instruction manual for product # PNAC-2001 Version 1.2 Store at -20 C. Instruction Version: Ver. 1.2 Date of Revision: 2012 February 1 /

More information

ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas

ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas ExpressArt Bacterial H-TR cdna synthesis kit With extreme selectivity against rrnas suitable for 2 to 4 µg total RNA Catalogue No. 8004-A30 (30 rxns) Reagents Materials are provided for 30 cdna synthesis

More information

Stratagene QPCR Mouse Reference Total RNA

Stratagene QPCR Mouse Reference Total RNA Stratagene QPCR Mouse Reference Total RNA Instruction Manual Catalog #750600 Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 750600-12 LIMITED PRODUCT WARRANTY This warranty limits

More information

Mir-X mirna First-Strand Synthesis Kit User Manual

Mir-X mirna First-Strand Synthesis Kit User Manual User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.

More information

Automated Lab Management for Illumina SeqLab

Automated Lab Management for Illumina SeqLab Automated Lab Management for Illumina SeqLab INTRODUCTION Whole genome sequencing holds the promise of understanding genetic variation and disease better than ever before. In response, Illumina developed

More information

Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR

Protocol. Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Protocol Introduction to TaqMan and SYBR Green Chemistries for Real-Time PCR Copyright 2008, 2010 Applied Biosystems. All rights reserved. Ambion and Applied Biosystems products are for Research Use Only.

More information

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)

More information

User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube

User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally

More information

How to Run the PacBio RS II Instrument. 1. Run Instrument. 1.1 How to Run the RS II Instrument

How to Run the PacBio RS II Instrument. 1. Run Instrument. 1.1 How to Run the RS II Instrument How to Run the PacBio RS II Instrument 100 338 600 01 1. Run Instrument 1.1 How to Run the RS II Instrument Welcome to Pacific Biosciences' How to Run the PacBio RS II Instrument training module. This

More information

TruSeq Custom Amplicon v1.5

TruSeq Custom Amplicon v1.5 Data Sheet: Targeted Resequencing TruSeq Custom Amplicon v1.5 A new and improved amplicon sequencing solution for interrogating custom regions of interest. Highlights Figure 1: TruSeq Custom Amplicon Workflow

More information

Troubleshooting Sequencing Data

Troubleshooting Sequencing Data Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page

More information

SmartFlare RNA Detection Probes: Principles, protocols and troubleshooting

SmartFlare RNA Detection Probes: Principles, protocols and troubleshooting Technical Guide SmartFlare RNA Detection Probes: Principles, protocols and troubleshooting Principles of SmartFlare technology RNA detection traditionally requires transfection, laborious sample prep,

More information

Real-time quantitative RT -PCR (Taqman)

Real-time quantitative RT -PCR (Taqman) Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR

More information

Concepts and methods in sequencing and genome assembly

Concepts and methods in sequencing and genome assembly BCM-2004 Concepts and methods in sequencing and genome assembly B. Franz LANG, Département de Biochimie Bureau: H307-15 Courrier électronique: [email protected] Outline 1. Concepts in DNA and RNA

More information

Automated Library Preparation for Next-Generation Sequencing

Automated Library Preparation for Next-Generation Sequencing Buyer s Guide: Automated Library Preparation for Next-Generation Sequencing What to consider as you evaluate options for automating library preparation. Yes, success can be automated. Next-generation sequencing

More information

empcr Amplification Method Manual - Lib-A

empcr Amplification Method Manual - Lib-A GS Junior Titanium Series May 2010 (Rev. April 2011) For life science research only. Not for use in diagnostic procedures. 1. WORKFLOW The emulsion-based clonal amplification (empcr amplification) of a

More information

BacReady TM Multiplex PCR System

BacReady TM Multiplex PCR System BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental

More information

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination

More information

HBV Quantitative Real Time PCR Kit

HBV Quantitative Real Time PCR Kit Revision No.: ZJ0002 Issue Date: Aug 7 th, 2008 HBV Quantitative Real Time PCR Kit Cat. No.: HD-0002-01 For Use with LightCycler 1.0/LightCycler2.0/LightCycler480 (Roche) Real Time PCR Systems (Pls ignore

More information

Oligonucleotide Stability Study

Oligonucleotide Stability Study Oligonucleotide Stability Study IDT is performing a long term study of oligo stability. The study has been ongoing for 2 years and has tested oligo stability under various conditions. An overview of the

More information

DyNAmo cdna Synthesis Kit for qrt-pcr

DyNAmo cdna Synthesis Kit for qrt-pcr DyNAmo cdna Synthesis Kit for qrt-pcr Instruction manual F- 470S Sufficient for 20 cdna synthesis reactions (20 µl each) F- 470L Sufficient for 100 cdna synthesis reactions (20 µl each) Description...

More information

Applied Biosystems 3500/3500xL Genetic Analyzer

Applied Biosystems 3500/3500xL Genetic Analyzer QUICK REFERENCE Applied Biosystems 3500/3500xL Genetic Analyzer with 3500 Series Data Collection Software 3 Catalog Number 4405186, 4405187 Pub. No. 100026299 Rev. A Note: For safety and biohazard guidelines,

More information

Amplicon Template Preparation and Sequencing

Amplicon Template Preparation and Sequencing Please note: the shared protocols described herein may not have been validated by Pacific Biosciences and are provided as-is and without any warranty. Use of these protocols is offered to those customers

More information

TIANquick Mini Purification Kit

TIANquick Mini Purification Kit TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E

More information

PowerFecal DNA Isolation Kit

PowerFecal DNA Isolation Kit PowerFecal DNA Isolation Kit Catalog No. Quantity 12830-50 50 Preps Instruction Manual Inhibitor Removal Technology (IRT) is a registered trademark of MO BIO Laboratories, Inc. and is covered by the following

More information

AxyPrep TM Mag PCR Clean-up Protocol

AxyPrep TM Mag PCR Clean-up Protocol AxyPrep TM Mag PCR Clean-up Protocol Intro The AxyPrep Mag PCR Clean-up kit utilizes a unique paramagnetic bead technology for rapid, high-throughput purification of PCR amplicons. Using this kit, PCR

More information

All-in-One First-Strand cdna Synthesis Kit

All-in-One First-Strand cdna Synthesis Kit All-in-One First-Strand cdna Synthesis Kit For reliable first-strand cdna synthesis from all RNA sources Cat. No. AORT-0020 (20 synthesis reactions) Cat. No. AORT-0050 (50 synthesis reactions) User Manual

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

illustra MicroSpin G-25 Columns

illustra MicroSpin G-25 Columns GE Healthcare illustra MicroSpin G-25 Columns For the the purification of oligonucleotides and small DNA fragments Product booklet See back cover for quick reference protocol card Code: 27-5325-01 (50

More information

INSTRUCTION Probemaker

INSTRUCTION Probemaker INSTRUCTION Probemaker Instructions for Duolink In Situ Probemaker PLUS (Art. no. 92009-0020) and Duolink In Situ Probemaker MINUS (Art. no. 92010-0020) Table of content 1. Introduction 4 2. Applications

More information

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAAC GTGCAC GTGAAC Wouter Coppieters Head of the genomics core facility GIGA center, University of Liège Bioruptor NGS: Unbiased DNA

More information

Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3

Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3 Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.

Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers. Unzipping Genes MBPCR014 Beta-Thalassemia Detection Kit P r o d u c t I n f o r m a t i o n Description: Thalassemia is a group of genetic disorders characterized by quantitative defects in globin chain

More information

RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl

RT31-020 20 rxns. RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl Components RT31-020 20 rxns RT31-050 50 rxns RT31-100 100 rxns TRANSCRIPTME Enzyme Mix (1) 40 µl 2 x 50 µl 5 x 40 µl 2x RT Master Mix (2) 200 µl 2 x 250 µl 5 x 200 µl RNase H (E. coli) 20 µl 2 x 25 µl

More information

PCR Instruments and Consumables

PCR Instruments and Consumables Index Page GeneAmp PCR Instrument Systems 2 GeneAmp PCR System 9700 Components 3 Accessories and Software for GeneAmp PCR Instrument Systems 4 Disposables 5 PCR Enzymes 7 GeneAmp PCR Kits 12 RNA PCR Kits

More information

Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform

Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 2 Sample Prep Workflow, 3 Best Practices, 4 DNA Input Recommendations, 6

More information

LABORATORY ORDERING INFORMATION (valid June 2011)

LABORATORY ORDERING INFORMATION (valid June 2011) LABORATORY ORDERING INFORMATION (valid June 2011) GENERAL You can search past orders in the orders ( pinks ) database - search by supplier, item description, catalog number, even name of person who did

More information

Agilent High Sensitivity DNA Kit Guide

Agilent High Sensitivity DNA Kit Guide Agilent High Sensitivity DNA Kit Guide Agilent High Sensitivity DNA Agilent Technologies Notices Agilent Technologies, Inc. 2009, 2013 No part of this manual may be reproduced in any form or by any means

More information

qstar mirna qpcr Detection System

qstar mirna qpcr Detection System qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr

More information

FULLY AUTOMATED AND VALIDATED HIGH VOLUME DNA EXTRACTION USING CHEMAGEN MAGNETIC BEADS BASED KITS

FULLY AUTOMATED AND VALIDATED HIGH VOLUME DNA EXTRACTION USING CHEMAGEN MAGNETIC BEADS BASED KITS FULLY AUTOMATED AND VALIDATED HIGH VOLUME DNA EXTRACTION USING CHEMAGEN MAGNETIC BEADS BASED KITS Tom Janssens & Ivo Salden UZ Gasthuisberg, Center for Human Genetics, Leuven Perkin Elmer Webinar 27th

More information

LifeScope Genomic Analysis Software 2.5

LifeScope Genomic Analysis Software 2.5 USER GUIDE LifeScope Genomic Analysis Software 2.5 Graphical User Interface DATA ANALYSIS METHODS AND INTERPRETATION Publication Part Number 4471877 Rev. A Revision Date November 2011 For Research Use

More information