pgl4 Luciferase Reporter Vectors

Size: px
Start display at page:

Download "pgl4 Luciferase Reporter Vectors"

Transcription

1 Technical Manual pgl4 Luciferase Reporter s INSTRUCTIONS FOR USE OF PRODUCTS E51, E61, E71, E81, E1, E6701, E6711, E6721, E6731, E6741, E6751, E6761, E6771, E6881, E681, E601, E611, E621, E631, E641, E651, E661, E671, E681, E61, E7501, E7511, E7521, E8411, E81, E8431, E8441, E8451, E8461, E81 AND E8481. PRINTED IN USA..

2 pgl4 Luciferase Reporter s I. Description...1 II. Product Components and Storage Conditions...3 III. All technical literature is available on the Internet at: Please visit the web site to verify that you are using the most current version of this Technical Manual. Please contact Promega Technical Services with questions regarding the use of these products. [email protected] General Considerations...4 A. The pgl4 Backbone...4 B. The pgl4 Reporter Genes...6 C. Distinguishing Features of the pgl4 s... D. Common Features of the pgl4 s... IV. pgl4 Sequences, Restriction Enzyme Tables and Maps...16 A. Sequences, Restriction Enzyme Tables and GenBank Numbers...16 B. pgl4 Maps...17 luc2 Maps...18 hrluc Maps...25 V. References...30 VI. Related Products...30 I. Description The pgl4 Luciferase Reporter s (a,b,c,d) are the next generation of reporter gene vectors optimized for expression in mammalian cells. Numerous configurations of pgl4 s are available, including those with the synthetic firefly luc2 (Photinus pyralis) and Renilla hrluc (Renilla reniformis) genes, which have been codon optimized for more efficient expression in mammalian cells. Furthermore, both the reporter genes and the vector backbone, including the bla (β-lactamase or ) and mammalian selectable marker genes for hygromycin (Hygro or Hyg r ), neomycin (Neo or Neo r ) and puromycin (Puro or Puro r ), have been engineered to reduce the number of consensus transcription factor binding sites, reducing background and the risk of anomalous transcription. The pgl4 backbone, provided with a choice of luc2 or hrluc genes, is also supplied with two Rapid Response Luciferase Reporter genes for each luciferase gene. The proteins encoded by these Rapid Response Luciferase genes respond more quickly and with greater magnitude to changes in transcriptional activity than their more stable counterparts. Page 1

3 I. Description (continued) The pgl4 family includes: Basic vectors with no that contain a multiple cloning region for cloning a of choice s containing a minimal s containing response elements and a minimal Promoter-containing vectors that can be used as expression controls or as co-reporter vectors Poly(A) block (for background reduction) Selectable Marker None Hygro r Neo r Puro r pgl4 s Upstream Element Multiple cloning region Promoter/ response elements Luciferase Gene Firefly (luc2) Rapid Response ( P, CP) Renilla (hrluc) Rapid Response ( P, CP) 487MA Figure 1. Generic pgl4 map showing the variety of features. Advantages of the pgl4 s include: Improved sensitivity and biological relevance due to: Increased reporter gene expression: Codon optimization of synthetic genes for mammalian expression Reduced background and risk of expression artifacts: Removal of cryptic DNA regulatory elements and transcription factor binding sites Improved temporal response: Rapid Response technology available using destabilized luciferase genes Enhanced usability and convenience: Flexible detection options: Choice of either synthetic luc2 (Photinus pyralis) or hrluc (Renilla reniformis) reporter genes Easy transition from transient to stable cells: Choice of mammalian selectable markers Easy transfer from one vector to another: Common multiple cloning site and a unique transfer scheme Page 2

4 II. Product Components and Storage Conditions Product Size Cat.# pgl4.10[luc2] (a,b) 20µg E51 pgl4.11[luc2p] (a,b) 20µg E61 pgl4.12[luc2cp] (a,b) 20µg E71 pgl4.13[luc2/sv40] (a,b) 20µg E81 pgl4.14[luc2/hygro] (a,b) 20µg E1 pgl4.[luc2p/hygro] (a,b) 20µg E6701 pgl4.16[luc2cp/hygro] (a,b) 20µg E6711 pgl4.17[luc2/neo] (a,b) 20µg E6721 pgl4.18[luc2p/neo] (a,b) 20µg E6731 pgl4.[luc2cp/neo] (a,b) 20µg E6741 pgl4.20[luc2/puro] (a,b) 20µg E6751 pgl4.21[luc2p/puro] (a,b) 20µg E6761 pgl4.22[luc2cp/puro] (a,b) 20µg E6771 pgl4.23[luc2/minp] (a,b) 20µg E8411 pgl4.[luc2p/minp] (a,b) 20µg E81 pgl4.25[luc2cp/minp] (a,b) 20µg E8431 pgl4.[luc2/minp/hygro] (a,b) 20µg E8441 pgl4.27[luc2p/minp/hygro] (a,b) 20µg E8451 pgl4.[luc2cp/minp/hygro] (a,b) 20µg E8461 pgl4.2[luc2p/cre/hygro] (a,b) 20µg E81 pgl4.30[luc2p/nfat-re/hygro] (a,b,c) 20µg E8481 pgl4.70[hrluc] (a,d) 20µg E6881 pgl4.71[hrlucp] (a,d) 20µg E681 pgl4.72[hrluccp] (a,d) 20µg E601 pgl4.73[hrluc/sv40] (a,d) 20µg E611 pgl4.74[hrluc/tk] (a,d) 20µg E621 pgl4.75[hrluc/cmv] (a,d,e) 20µg E631 pgl4.76[hrluc/hygro] (a,d) 20µg E641 pgl4.77[hrlucp/hygro] (a,d) 20µg E651 pgl4.78[hrluccp/hygro] (a,d) 20µg E661 pgl4.7[hrluc/neo] (a,d) 20µg E671 pgl4.80[hrlucp/neo] (a,d) 20µg E681 pgl4.81[hrluccp/neo] (a,d) 20µg E61 pgl4.82[hrluc/puro] (a,d) 20µg E7501 pgl4.83[hrlucp/puro] (a,d) 20µg E7511 pgl4.84[hrluccp/puro] (a,d) 20µg E7521 Page 3

5 II. Product Components and Storage Conditions (continued) Available Separately: Product Size Cat.# pgl4.31[luc2p/gal4uas/hygro] (a,b) 20µg C351 The CheckMate /Flexi Mammalian Two-Hybrid System Technical Manual, #TM3, is shipped with the pgl4.31[luc2p/gal4uas/hygro] and contains protocol information for use of this vector. Storage Conditions: Store the pgl4 Luciferase Reporter s at 20 C. III. General Considerations III.A. The pgl4 Backbone To reduce the risk of anomalous expression and increase the reliability of reporter gene expression, the pgl3 region upstream of the reporter gene was re-engineered to create the pgl4 s. The pgl3 region from the start of the reporter gene (the Nco I restriction site) to the bacterial gin of replication sequence was also redesigned. The modifications to this region include: a greatly reduced number of consensus transcription factor binding sites (Figure 2); a redesign of the multiple cloning region; removal of the f1 gin of replication; deletion of an intronic sequence; and a reduction in the number of modules. (Promoter modules are composite regulatory elements consisting of at least two transcription factor binding sites separated by a spacer. Promoter modules can have synergistic or antagonistic functions (1).) Note: The synthetic in the pgl4 s expresses a protein sequence identical to that expressed by the gene in the pgl3 s. The only regions of the pgl4 backbone not optimized for reduced anomalous expression are the downstream of the reporter gene and the bacterial gin of replication. Modifications to the pgl4 s have resulted in an improved signalto-background ratio. Some of these improved ratios are presented in Table 1, where several pgl4 s are compared to their controls (the corresponding less vectors), and the fold increase in the signal-to-background ratio is compared for the pgl4 s and previous generations of reporter vectors (e.g., pgl3 and phrl s). Page 4

6 GBF1 Arnt CDP FAST-1/Smad Brn-2 pgl3 Backbone MEIS1 RP58 Neu1/3 Lmo2 AD-b Cut-like Nkx2.5 E2F TALE STAT5 ELF-2 CCAAT GBF3 Prom L Gut B-cell PAR Mamm.C GBF3 Elk-1 Msx-1 HNF 1 HLF E2F NFAT Hox1.3 LHX3 ST/TA SF1 Pax2/5/8 AC-t Myo E2F STAT5 CREB HMX3 NKX3.1 MIS HNF4 HNF1 SRF B-cell HNF 1 MOK-2 CDE HNF3 EBV Elk-1 FOXL1 KLF3 CCAAT B-cell CPBP Pax1 Cone-rod Pax-3 FLI PAR Ras C2HC1 Pax1 Tax/CREB CCAAT Mus RFX1 Musc. Pax1 Pbx1 B-cell Ikaros2 v-mar MIBP-1 MyT1 NUDR ATF CCAAT NUDR EKLF RFX1 E4BP4 CDF-1 HOX PAX AD-b OBF1 NF-kB CREB Gut MEIS1 CCAAT GBF1 IS NRF2 Elf-2E2F NF-kB HLF BACH1 Neu-rGBF1 IRF-3 HIF-1 v-myb Pit1 OBF1 Barb Ikaros3 HLF MEIS1 c-myb OBF1 STAT5 MEF2 WTS Neu-r MEIS1 HoxC-Rel ST/TA OBF1 FAST-1 POZ CREB v-myb GBF1MREMMC RFX1 POZ B-cell My11 Pro L S8 STs TTF1 E2F v-myb EG3 E2F Tax PAX-6 GBF1 Bright Myo Myo FoxA2 c-myb Cdf1 Brn-3 X-Box Sox-5 c-myb NF Y Ikaros2 Neu-r Gsh-1 E2F CCAAT NUDR PAR Gfi-1B GBF1 HLF NUDR HAND2 E2F Neu1/3 TATA HNF4 PAR NKX3.1 Lmo2 E4BP4 Tal-1a E2F TCF PAX6 HNF1 AC-t RFX1 IRF2 E4BP4 GBF1 Elk-1 Cart-1 NKX3.1 CCAAT Mamm.C TCF11 Nkx2.5 GBF3 Cdx-2 AB-D Tal-1a Brn-3 Brn-3 OBF-1 COMP1 RP58 PAR Pdx1 Cart-1 Cart-1 CDP Clox FOXC1 AC-t Pbx-1 Pbx1 IF1 PR CDP NUDR Pax1 MyT1 Arnt CDP OBF1 NKX3.1 Elk-1 AC-t Nco I Runt-2 Pax1 AD-b Baso PL Avian C CDF-1 Pax TALE Hox-1.3 E4BP4 AD-b NKX3.1 Dec1 HNF1 GBF1 AP1 MIT/TFE Runt-2 Avian C E4BP4 NKX3.1 Cart-1 CDF1 Mamm C Cart-1 NUDR TCF/LEF1 GBF1 Nkx2.5 Pdx-1 Cdx-2 Brn-3 FOXC1 Cart-1 OBF1 AD-b PAR GBF3 RP58 Tal-1a COMP1 CDP Avian C Pbx1 Clox Pbx-1 pgl4 Backbone Nco I Figure 2. Reduced number of consensus transcription factor binding sites for the pgl4 s. The number of consensus transcription factor binding sites identified in the pgl3 backbone has been greatly reduced in the pgl4 backbone. Note: The SV40, HSV-TK and CMV s contain several consensus transcription factor binding sites. Due to the complex nature of the s these sites were not altered. However, the number and type of consensus transcription factor binding sites vary depending on the. For maximum reduction of anomalous expression in your assay system, we recommend that you evaluate the s to determine the one that results in the lowest level of anomalous expression with your system. IRF1 TEF-1 61MA Page 5

7 III.A. The pgl4 Backbone (continued) Poly(A) Signal/Transcriptional Pause Site for Background Reduction All pgl4 s contain a synthetic /transcriptional pause site (2) located upstream of either the multiple cloning region (in less vectors) or the SV40, CMV or HSV-TK (in -containing vectors). The synthetic / is present to reduce the effects of spurious transcription on luciferase reporter gene expression. Table 1. Signal-to-Background Comparison for Several of the pgl4, pgl3 and phrl s. 1 Signal-to- Fold Increase Background for s Ratio 1 pgl4 s 2 pgl4.13[luc2/sv40] vs. pgl4.10[luc2] 3,200 ± pgl3-control vs. pgl3-basic 670± 57 pgl4.73[hrluc/sv40] vs. pgl4.70[hrluc] 630 ± phrl-sv40 vs. phrl-null ± 2 pgl4.74[hrluc/tk] vs. pgl4.70[hrluc] 7 ± 8 33 phrl-tk vs. phrl-null 2.3 ± 0. pgl4.75[hrluc/cmv] vs. pgl4.70[hrluc] 1,100 ± phrl-cmv vs. phrl-null 17 ± 2 1 To generate signal-to-background ratios the luciferase-containing vectors were transfected into CHO cells. At hours post-transfection the cells were lysed, luminescent signals were generated using the Dual-Luciferase Assay System and the relative light units were corrected for transfection efficiency, yielding normalized signals. Signal-to-background ratio = signal from -containing vector/signal from corresponding less vector. 2 Fold increase for pgl4 s = (signal-to-background ratio from pgl4 /signalto-background ratio from corresponding pgl3 or phrl ) 1. The experiment was repeated in CHO and other cell lines (HeLa, NIH/3T3 and HEK 23 cells) generating similar results. III.B. The pgl4 Reporter Genes To increase expression and reliability of the firefly luciferase reporter, a synthetic firefly luciferase gene, luc2, has been engineered. The gene was synthetically redesigned by changing the codons to those most frequently used in mammalian cells while simultaneously removing most of the consensus sequences for transcription factor binding sites (Figure 3). Additionally, the number of predicted modules present within the luc+ reporter gene (and thought to cause anomalous expression) has been reduced to a single module in the luc2 gene. To maintain the integrity of the firefly luciferase protein sequence from the luc+ gene to the luc2 gene, some of the consensus transcription factor binding sites and modules were not removed. In the transfection experiment shown in Figure 4, the synthetic firefly luc2 luciferase gene displayed an increase in expression compared to luc+. Page 6

8 luc+ PXR/CAR/RXR Pbx-1 CCAAT SRF Gfl-1B Cut-like RFX1 BRN-23 GBF3 OBF1 VIS1 En-1 HEN1 SRF Sox-5 NMP4 NKX3.1 AREB6 C-Myb SRF HNF1 AhR ATF4 Otx2 VIS1 VIS 1 Lmo2 NFY MyT1 VIS 1 ST/TA MEF Lmo2 Mt TCF/LEF-1 GFI1 Pit1 OBF 1 E2F GSh-1 MIBP-1/RFX1 POZ CDF-1 v-myb FAST-1/S MAD Pbx1/Meis1 MESI1 COMP1 E2F Pax-3 Tst-1/Oct-6 MEIS 1 E2F Ikaros 3 WHP CBF 3 E4BP4 ST/TA CDE/CHR TCF/LEF-1 MSX1/MSX-2 MyT1 P53 C-Ets-1 GBF3 AD-b HNF1 Oct1,2 GABP E2 E4BP4 NGN1/3 v-myb Brn3 FOXF2 PAR Pbx1 TEF-1 CCAAT OBF1 C2HC SRE OBF1 Cut-like FOXF2 MEIS1 ST/TA Elk-1 C2H2 SOX-5 GBF2 Pbx1 MOK-2 v-myb POZ Brn2 c-ets-1 MMC CCAATHIF1 Pax1 COMP1 VIS1 PBX/MEIS1 ST/TA ATF MEF2 E4BP4 Tst-1/Oct-6 SRF Brn23 COMP1 MOK-2 GATA Clox RF-7 c-myb TATA GBF1 GLI-k POZ HNF6 B-cell MEF TALE ZF Smad4 MIBP1 Pbx1 Cut-like TCF/LEF-1 Albumin D-box HEN1 Lmo2 RFX1 v-myb C-r CHOP CDE/CHR ST/TA HNF4 CREB ST/TA NKX3.1 WHP Pax-6 Tax/CREB FLI FAST-1/SMAD NF-KB Se-CtRNA PXR/RXR/CAR MZF-1 Thing1 AP 2 MAZ BPV CREB c-myb CREB NMP4 COMP1 GLI-K C-r Pbx1/Meis1 PAR PAX2/5/8 P53FLI E2F CREB HAND2 NMP4 E2F E4BP4 PAR Avian C MyT1 c-myb TALE MOK-2 Pbx-1 Pax-3 Cut-like NUR77/Nurr1/Nor-1 Ikaros-3 ST/TA Cut-like RAR CREB Elk-1 Elk-1 E2FCREB PAR GFI1 E2F E2F C-Abl c-myb v-myb CDF-1 ST/TA SRF v-myb NF-kB p53 p53 PAX luc2 Bel-1 VDR/RXR FKHRL1 LBP1c/LSF v-myb PAX c-myb CDF1 Baso p53 MA Figure 3. Reduced number of consensus transcription factor binding sites for the luc2 gene. The number of consensus transcription factor binding sites identified in the luc+ gene (top) have been greatly reduced in the luc2 gene (below), while conserving the protein sequence. To ensure that the synthetic construction affected only expression, both the luc+ and luc2 genes were cloned into the pgl3-control. The vectors were co-transfected with an internal control for assessing transfection efficiency, and after hours the luminescence (in relative light units) was measured and normalized to the control. When compared to luc+, the luc2 gene demonstrated a 4.1- to 11.8-fold increase in expression for the four mammalian cell lines tested. For more information on the hrluc gene, please refer to the Renilla Luciferase Reporter s Technical Manual, #TM237. See Table 2 for a list of the features in each pgl4. Page 7

9 10,000,000 Luminescence (Relative Light Units) 1,000, ,000 10, luc+ luc ,000 NIH/3T3 CHO HEK 23 HeLa Figure 4. The firefly luc2 gene displays higher expression than luc+. The luc2 gene was cloned into the pgl3-control (Cat.# E1741), replacing the luc+ gene. Thus both firefly luciferase genes were in the same pgl3-control backbone. The two vectors containing either of the firefly luciferase genes were co-transfected into NIH/3T3, CHO, HEK 23 and HeLa cells using the phrl-tk (Cat.# E61) for a transfection control. Twenty-four hours post-transfection the cells were lysed with Passive Lysis Buffer (Cat.# E41) and luminescence was measured using the Dual-Luciferase Assay System (Cat.# E10). Luminescence (relative light units) was normalized to the Renilla luciferase expression from the phrl-tk transfection control. The fold increase in expression values is listed above each pair of bars. A repeat of this experiment yielded similar results. Table 2. Features of the pgl4 s. Protein Reporter Multiple Degrada- Gene Promoter/ Mammalian Cloning Reporter tion Response Selectable Region Gene Sequence Element Marker pgl4.10[luc2] Yes luc2 1 No No No pgl4.11[luc2p] Yes hpest No No pgl4.12[luc2cp] Yes hcl1-hpest No No pgl4.13[luc2/sv40] No No SV40 No pgl4.14[luc2/hygro] Yes No No Hygro pgl4.[luc2p/hygro] Yes hpest No Hygro pgl4.16[luc2cp/hygro] Yes hcl1-hpest No Hygro pgl4.17[luc2/neo] Yes No No Neo pgl4.18[luc2p/neo] Yes hpest No Neo pgl4.[luc2cp/neo] Yes hcl1-hpest No Neo pgl4.20[luc2/puro] Yes No No Puro pgl4.21[luc2p/puro] Yes hpest No Puro pgl4.22[luc2cp/puro] Yes hcl1-hpest No Puro pgl4.23[luc2/minp] Yes No minp No pgl4.[luc2p/minp] Yes hpest No pgl4.25[luc2cp/minp] Yes hcl1-hpest No pgl4.[luc2/minp/hygro] Yes No Hygro pgl4.27[luc2p/minp/hygro] Yes hpest Hygro pgl4.[luc2cp/minp/hygro] Yes hcl1-hpest Hygro pgl4.2[luc2p/cre/hygro] No hpest CRE Hygro pgl4.30[luc2p/nfat-re/hygro] No hpest NFAT-RE Hygro pgl4.31[luc2p/gal4uas/hygro] No hpest GAL4UAS Hygro 1 luc2 is the synthetic firefly luciferase gene. (continued) 31MA Page 8

10 Table 2. Features of the pgl4 s (continued). Protein Reporter Multiple Degrada- Gene Promoter/ Mammalian Cloning Reporter tion Response Selectable Region Gene Sequence Element Marker pgl4.70[hrluc] Yes hrluc 2 No No No pgl4.71[hrlucp] Yes hpest No No pgl4.72[hrluccp] Yes hcl1-hpest No No pgl4.73[hrluc/sv40] No No SV40 No pgl4.74[hrluc/tk] No No HSV-TK No pgl4.75[hrluc/cmv] No No CMV No pgl4.76[hrluc/hygro] Yes No No Hygro pgl4.77[hrlucp/hygro] Yes hpest No Hygro pgl4.78[hrluccp/hygro] Yes hcl1-hpest No Hygro pgl4.7[hrluc/neo] Yes No No Neo pgl4.80[hrlucp/neo] Yes hpest No Neo pgl4.81[hrluccp/neo] Yes hcl1-hpest No Neo pgl4.82[hrluc/puro] Yes No No Puro pgl4.83[hrlucp/puro] Yes hpest No Puro pgl4.84[hrluccp/puro] Yes hcl1-hpest No Puro 2 hrluc is the synthetic Renilla gene. III.C. Distinguishing Features of the pgl4 s The following features are available for the pgl4 s. Reporter Genes: Firefly luciferase (luc2) or Renilla luciferase (hrluc) Regular or Rapid Response genes Upstream Elements: Promoterless basic vectors s with minimal s s containing response elements and minimal s s with constitutive s such as SV40, HSV-TK and CMV Selectable Markers: Hygro Neo Puro The Rapid Response pgl4 s Computational models predict that genetic reporters with reduced intracellular stability will yield faster response to changes in transcriptional rate and an increase in the relative magnitude of the response (3). Destabilized reporter proteins (i.e., those with faster protein degradation rates) are therefore expected to be more responsive and better suited to monitor rapid processes (such as activation and repression) than those with slower degradation rates. To generate reporter proteins that have increased protein degradation rates (i.e., destabilized reporters) one or both of two different protein degradation sequences have been incorporated into the synthetic firefly luc2 and Renilla hrluc luciferase genes. The first degradation sequence, PEST, is a forty-amino acid sequence isolated from the C-terminal region of mouse ornithine decarboxylase (4). The second Page

11 III.C. Distinguishing Features of the pgl4 s (continued) degradation sequence includes CL1 and PEST. CL1, ginally isolated from yeast, has also been shown to increase protein degradation (5). The codons within the PEST and CL1-PEST sequences have been optimized for expression in mammalian cells, and the number of consensus transcription factor binding sites has been reduced. To reflect the changes in these two protein degradation sequences they have been designated hpest and hcl1-hpest. The Rapid Response pgl4 Reporter gene design is shown in Figure 5. As the result of inclusion of the protein degradation sequences in the Rapid Response pgl4 s, the rate of reporter response to cellular stimuli has increased. In Figure 6 and Table 3 increased rates of reporter response in the CRE (camp response element) model system are demonstrated. For the firefly luciferasebased Rapid Response pgl4 Reporter s (pgl4.11[luc2p] and pgl4.12[luc2cp]), the rate of reporter response for the first two hours postinduction increased one- and twofold, respectively, over the luc2 control (pgl4.10[luc2]). Similar results for the same time frame were detected for the Renilla-based Rapid Response pgl4 Reporter s (pgl4.71[hrlucp] and pgl4.72[hrluccp]). The rate of response for the hrlucp- and hrluccp-destabilized Renilla reporters increased one- and threefold, respectively, when compared to the nondestabilized hrluc reporter. Gene Design luc2 luc2 luc2p luc2 hpest luc2cp luc2 hcl1 hpest hrluc hrluc hrlucp hrluc hpest hrluccp hrluc hcl1 hpest 4861MA Figure 5. Gene design of the Rapid Response pgl4 Reporter s. A consequence of inclusion of the degradation sequences is that the destabilized luciferase proteins do not accumulate in the cell to the same extent as the nondestabilized luciferase-containing controls. As a result, destabilized reporter proteins typically generate lower signal intensities (Figure 7). The luc2p and luc2cp proteins displayed 18.7% and 3.%, respectively, of the relative light units obtained using the firefly luciferase gene luc2. Similar reductions in relative light intensities were displayed by the Renilla luciferase-based Rapid Response pgl4 Reporter s. The Renilla reporter proteins hrlucp and hrluccp displayed 40% and 5.8%, respectively, of the relative light units of the hrluc control. Luminescence obtained using the Rapid Response pgl4 Reporter s can vary depending on the mammalian cell line and experimental conditions used, thus optimization is recommended. Page 10

12 Table 3. Increase in Reporter Response for the Rapid Response pgl4 Reporter s (results calculated from the data shown in Figure 6). Induction Fold Increase in at 2 Hours 1 Reporter Response Rate 2 pgl4.10[luc2] 6.6 pgl4.11[luc2p] pgl4.12[luc2cp] pgl4.70[hrluc] 2.7 pgl4.71[hrlucp] pgl4.72[hrluccp] Induction = signal from induced samples/signal from noninduced samples. 2 Reporter Response Rate = (induction of Rapid Response Reporter/induction of a regular reporter) 1. A pgl4.10[luc2] pgl4.11[luc2p] pgl4.12[luc2cp] Induction Time (hours) 5 6 B. 16 pgl4.70[hrluc] pgl4.71[hrlucp] pgl4.72[hrluccp] 12 Induction Time (hours) MA Figure 6. Increase in reporter response rate. To determine the increase in reporter response rate for the Rapid Response pgl4 Reporter s, a DNA segment containing multiple CREs (camp response element) and a minimal HSV-TK were cloned into each of the four Rapid Response pgl4 Reporter s (pgl4.11[luc2p], pgl4.12[luc2cp], pgl4.71[hrlucp] and pgl4.72[hrluccp]) and the two control vectors (pgl4.10[luc2] and pgl4.70[hrluc]). The CRE-containing vectors were then transiently transfected into HEK 23 cells. Twenty-four hours later 100µM of RO (RO-20-17) and 1µM of ISO (isoproterenol hydrochlde) were added to the transiently transfected cells to induce reporter gene expression. RO alone (100µM) was added to a subset of the wells to serve as a noninduced control. Cells were harvested, lysed and assayed with either the Luciferase Assay System (Cat.# E00; Panel A) or the Renilla Luciferase Assay System (Cat.# E10; Panel B). Induction was calculated by dividing the relative light units obtained from the induced wells by the relative light units obtained from noninduced wells. Two repeats of this experiment yielded similar results. Page 11

13 Luminescence (Relative Light Units) 100,000,000 10,000,000 1,000, ,000 10,000 pgl4.10[luc2] 18.7% pgl4.11[luc2p] 3.% pgl4.12[luc2cp] pgl4.70[hrluc] 40% pgl4.71[hrlucp] 5.8% pgl4.72[hrluccp] Figure 7. Relative expression of Rapid Response pgl4 luciferase genes. To determine the relative expression of the Rapid Response pgl4 luciferase genes, a DNA segment containing multiple CREs (camp response element) and a minimal HSV-TK was cloned into each of the four Rapid Response pgl4 Reporter s (pgl4.11[luc2p], pgl4.12[luc2cp], pgl4.71[hrlucp], and pgl4.72[hrluccp]) and the two control vectors (pgl4.10[luc2] and pgl4.70[hrluc]), which do not contain degradation sequences. The resulting vectors were cotransfected with a second reporter (transfection control) into HEK 23 cells. The transfection controls for the firefly luc2-containing vectors were the phrl-tk and, for the Renilla hrluc vectors, the pgl3-control. Twenty-four hours later the cells were lysed with Passive Lysis Buffer and luminescence (relative light units) was measured using the Dual- Luciferase Assay System. (The firefly luc2 data is shown by three bars on the left, while the hrluc data is contained in the three bars on the right.) Luminescence (relative light units) was normalized to the transfection control. The effects of the protein degradation sequences on the accumulation of luciferase enzyme are shown as percent expression of the control. The Promoterless pgl4 s The less pgl4 s contain no enhancer or elements. These vectors, which contain a multiple cloning region immediately upstream of the luciferase reporter gene, can be used to clone in a desired regulatory element(s) to drive expression of the reporter gene. The Minimal Promoter pgl4 s The minimal (minp) vectors contain a TATA-box element immediately upstream of the luciferase reporter gene and immediately downstream of the multiple cloning region. These vectors can be used to clone in a desired less-response element to drive expression of the reporter gene. The minimal TATA has low basal activity and allows for sensitive response element activity measurements. 33MA Page 12

14 A. Luminescence (Relative Light Units) Fold Noninduced Forskolin B. Luminescence (Relative Light Units) Fold Noninduced Ionomycin + PMA 45MA Figure 8. High levels of reporter induction for pgl4.2[luc2p/cre/hygro] and pgl4.30[luc2p/nfat-re/hygro] in transient transfection of HEK 23 cells. pgl4.2 (Panel A) and pgl4.30 (Panel B) Reporter s were transiently transfected into HEK 23 cells. After twenty-four hours, reporter gene expression was induced by addition of 100µM forskolin to the pgl4.2-transfected cells for 5 hours and by addition of 1µM ionomycin plus 10ng/ml PMA to the pgl4.30-transfected cells for 17 hours. Noninduced controls were treated with an equivalent amount of DMSO vehicle for both pgl4.2- and pgl4.30-transfected cells. Luciferase activity was measured using the Bright-Glo Luciferase Assay System (Cat.# E10). The numbers shown above the graph bars represent fold induction for the respective vectors, calculated by dividing the relative light units obtained for the induced wells by the relative light units obtained from noninduced wells (n = ; standard error bars are shown). Results will vary depending on the cell line and the transfection protocol used. The CRE and NFAT-RE Reporter s The pgl4.2[luc2p/cre/hygro] and pgl4.30[luc2p/nfat-re/hygro] s are designed for use in both transient transfection assays and in stable cell line generation to monitor the camp and NFAT signaling pathways, respectively (Figure 8 shows a transient transfection). These vectors feature the Rapid Response Luciferase luc2p reporter gene and contain a hygromycin selection cassette to facilitate stable cell line expression. pgl4.2[luc2p/cre/hygro] contains three tandem CRE sequences upstream of the minimal sequence to drive luc2p expression. pgl4.30[luc2p/nfat-re/hygro] contains three tandem NFAT-RE sequences upstream of the minimal sequence to drive expression of the luc2p reporter. Page 13

15 III.C. Distinguishing Features of the pgl4 s (continued) The GAL4UAS Reporter Another response element vector, the pgl4.31[luc2p/gal4uas/hygro] is part of the CheckMate /Flexi Mammalian Two-Hybrid System. This reporter vector contains five consensus binding sequences, or Upstream Activating Sequences (UAS), for the GAL4 DNA-binding domain (GAL4UAS) upstream of a minimal adenoviral and is designed for transcriptional activation of the firefly luciferase by association of the GAL4 DNA-binding and VP16 activation domains bound upstream of the luciferase gene. The Internal Control pgl4 s The pgl4.13[luc2/sv40] and pgl4.73[hrluc/sv40] s are intended for use as internal control reporters and may be used with most experimental reporter vectors to co-transfect mammalian cells. These vectors contain the region, which provides strong, constitutive expression of luciferase in a variety of cell types, as well as the SV40 gin of replication, which results in transient, episomal replication in cells expressing the SV40 large T antigen such as COS-1 or COS-7 cells (6).! These -containing vectors may not be appropriate for use in examining the function of a response element of interest. Minimal -containing vectors are better suited for examining a response element of interest. The pgl4.74[hrluc/tk] is intended for use as an internal control reporter and may be used with most experimental reporter vectors to co-transfect mammalian cells. The pgl4.74[hrluc/tk] contains the herpes simplex virus thymidine kinase (HSV-TK) upstream of hrluc to provide low to moderate levels of Renilla luciferase expression in co-transfected mammalian cells of both embryonal and mature mammalian tissues (6,7). The pgl4.75[hrluc/cmv] is intended for use as an internal control reporter and may be used with most experimental reporter vectors to co-transfect mammalian cells. The pgl4.75[hrluc/cmv] contains the CMV immediateearly region, which provides strong, constitutive expression of Renilla luciferase in a variety of cell types. The promiscuous nature of the CMV immediate-early has been demonstrated in transgenic mice, where its transcriptional activity was observed in of the murine tissues examined (8). Selectable Markers Hygromycin B is an aminoglycosidic antibiotic that inhibits protein synthesis by disrupting translocation and promoting mistranslation at the 80S ribosome. Hygromycin B phosphotransferase (Hygro or Hyg r ) inactivates hygromycin B by phosphorylation. For the selection of stable cell lines, an expression cassette for the gene encoding hygromycin B phosphotransferase is available in the following pgl4 s: pgl4.14[luc2/hygro], pgl4.[luc2p/hygro], pgl4.16[luc2cp/hygro], pgl4.76[hrluc/hygro], pgl4.77[hrlucp/hygro], and pgl4.78 [hrluccp/hygro]. G418 is an aminoglycosidic antibiotic that inhibits protein synthesis. Neomycin or aminoglycoside 3 phosphotransferase (Neo or Neo r ) confers resistance to G418. For the selection of stable cell lines, an expression cassette for the gene encoding Page 14

16 neomycin phosphotransferase is available in the following pgl4 s: pgl4.17[luc2/neo], pgl4.18[luc2p/neo], pgl4.[luc2cp/neo], pgl4.7[hrluc/neo], pgl4.80[hrlucp/neo] and pgl4.81[hrluccp/neo]. Puromycin dihydrochlde is a nucleoside antibiotic that inhibits protein synthesis. Puromycin-N-acetyltransferase (Puro or Puro r ) confers resistance to puromycin. For the selection of stable cell lines, an expression cassette for the gene encoding puromycin-n-acetyltransferase is available in the following pgl4 s: pgl4.20[luc2/puro], pgl4.21[luc2p/puro], pgl4.22[luc2cp/puro], pgl4.82[hrluc/puro], pgl4.83[hrlucp/puro] and pgl4.84[hrluccp/puro]. The genes for hygromycin, neomycin and puromycin resistance have also been designed for reduced anomalous expression and codon optimized by the same process used on the firefly and Renilla luciferase reporter genes (earning all nine genes the designation synthetic ). The expression cassette contains the to express the Hygro, Neo or Puro resistance gene and a synthetic at the 3 end for transcriptional termination (separate from the synthetic /translational pause site located upstream of the reporter gene). III.D. Common Features of the pgl4 s SV40 Late Poly(A) Signal In addition to the features previously listed, each of the pgl4 s contains a downstream of the reporter gene. Polyadenylation signals cause the termination of transcription by RNA polymerase II and signal the addition of approximately adenosine residues to the 3 -end of the RNA transcript (). Polyadenylation has been shown to enhance RNA stability and translation efficiency (10,11). The is extremely efficient and has been shown to increase the steady-state level of RNA approximately fivefold more than the SV40 early (12,13). The has been positioned 3 to the reporter gene in the pgl4 s to increase the level of luciferase expression. Redesigned Multiple Cloning Region The multiple cloning region of the pgl4 s (Figure ) has been synthetically constructed and is based on the multiple cloning region of the pgl3 s. However, differences between the two multiple cloning regions exist. The pgl4 multiple cloning region includes the following restriction sites: Bgl I,,,,,,,,,, and. The Bgl I, and restriction sites have been added to the pgl4 multiple cloning region and are not found in the pgl3 multiple cloning region. The Mlu I and Sma I restriction sites found in the pgl3 multiple cloning region have not been included in the pgl4 multiple cloning region. The purpose of two restriction sites is to be able to move DNA of interest (i.e., response elements, enhancers, s, etc.) among the pgl4 s. Additionally, due to the unique DNA recognition properties of Bgl I and, the two restriction sites in the pgl4 s offer directionality. Thus transfer between pgl4 s by using either the Bgl I or restriction enzymes retains the desired directionality of your DNA fragment of interest. Note: Additional Bgl I and restriction sites are present in the hrluc gene. Therefore, these two enzymes should not be used for cloning into Renilla-based pgl4 s. Page

17 RVprimer3 5...ACAAAACAAACTAGCAAAATAGGCTGTCCCCAGTGCAAGTGCAGGTGCCAGAACATTTCTCT / SfiI BglI Acc65I KpnI EcolCRI SacI NheI XhoI EcoRV BglII GGCCTAACTGGCCGGTACCTGAGCTCGCTAGCCTCGAGGATATCAAGATCT SfiI BglI HindIII GGCCTCGGCGGCCAAGCTTGGCAATCCGGTACTGTTGGTAAAGCCACCATGG...3 AGACACTAGAGGGTATATAATGGAAGCTCGACTTCCAGCTT Luciferase start minp Figure. The multiple cloning region of the pgl4 s. This map represents the less pgl4 s but also demonstrates the position and sequence of the minimal, minp, found in the pgl4.23 pgl4. s. The minp sequence is shaded in gray. Note: The BglI and EcoRV sites are also present in the hrluc gene and should not be used for cloning into the hrluc- (Renilla luciferase-) containing pgl4 s. 35MB IV. pgl4 Sequences, Restriction Enzyme Tables and Maps IV.A. Sequences, Restriction Enzyme Tables and GenBank Numbers Sequence information and restriction enzyme tables for the pgl4 s are available online at: The GenBank /EMBL accession numbers are listed below in Table 4. Note: Due to the use of updated software for generating vector maps and restriction enzyme tables, the manner in which we report restriction enzyme cut sites has changed. The location is now reported at the 5 -end of the cut DNA (the base to the right of the cut site). The maps and restriction enzyme tables associated with the pgl4 s have been updated accordingly. Table 4. GenBank /EMBL Accession Numbers for the pgl4 s. pgl4.10[luc2] pgl4.11[luc2p] pgl4.12[luc2cp] pgl4.13[luc2/sv40] pgl4.14[luc2/hygro] pgl4.[luc2p/hygro] pgl4.16[luc2cp/hygro] pgl4.17[luc2/neo] pgl4.18[luc2p/neo] GenBank /EMBL Accession Number AY AY AY7382 AY AY864 AY86 AY86430 DQ DQ Page 16

18 Table 4. GenBank /EMBL Accession Numbers (continued) pgl4.[luc2cp/neo] pgl4.20[luc2/puro] pgl4.21[luc2p/puro] pgl4.22[luc2cp/puro] pgl4.23[luc2/minp] pgl4.[luc2p/minp] pgl4.25[luc2cp/minp] pgl4.[luc2/minp/hygro] pgl4.27[luc2p/minp/hygro] pgl4.[luc2cp/minp/hygro] pgl4.2[luc2p/cre/hygro] pgl4.30[luc2p/nfat-re/hygro] pgl4.31[luc2p/gal4uas/hygro] pgl4.70[hrluc] pgl4.71[hrlucp] pgl4.72[hrluccp] pgl4.73[hrluc/sv40] pgl4.74[hrluc/tk] pgl4.75[hrluc/cmv] pgl4.76[hrluc/hygro] pgl4.77[hrlucp/hygro] pgl4.78[hrluccp/hygro] pgl4.7[hrluc/neo] pgl4.80[hrlucp/neo] pgl4.81[hrluccp/neo] pgl4.82[hrluc/puro] pgl4.83[hrlucp/puro] pgl4.84[hrluccp/puro] GenBank /EMBL Accession Number DQ18883 DQ DQ DQ1888 DQ04455 DQ04456 DQ04457 DQ04458 DQ0445 DQ044 DQ04461 DQ04462 DQ AY7382 AY AY7382 AY73822 AY AY AY86431 AY86432 AY86433 DQ DQ DQ DQ DQ1888 DQ IV.B. pgl4 Maps The following section contains circular vector maps and sequence reference points for the pgl4 s. For each map a selected set of restriction enzyme sites is also shown, including those in the multiple cloning regions, EcoRI, which denotes the Rapid Response Reporter and BamHI and SalI, which denote the selectable marker region. Information for pgl4.31[luc2p/gal4uas/hygro] can be found in the CheckMate /Flexi Mammalian Two-Hybrid System Technical Manual, #TM3 and online at: Note: The restriction enzyme sites shown on these vector maps were derived from sequence analysis software and have not been verified by restriction enzyme digestion with each enzyme listed. The location given specifies the 5 end of the cut DNA (the base to the right of the cut site). Page 17

19 pgl4 luc2 Maps 20 Sal I 2020 BamH I pgl4.10[luc2] (bp) pause site (for background reduction) 18 luc2 reporter gene Reporter primer 4 binding region ColEI-derived plasmid replication gin 2333 β-lactamase ( ) coding region /transcriptional pause site 408 Reporter primer 3 binding region luc2 Figure 10. pgl4.10[luc2] circle map and sequence reference points. 21MA Sal I 2148 BamH I pgl4.11[luc2p] (4370bp) pause site (for background reduction) luc2p reporter gene Reporter primer 4 binding region ColEI-derived plasmid replication gin 61 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region luc2p 22MA EcoR I 1750 Figure 11. pgl4.11[luc2p] circle map and sequence reference points Sal I 2 BamH I pgl4.12[luc2cp] (41bp) pause site (for background reduction) EcoRV luc2cp reporter gene Reporter primer 4 binding region ColEI-derived plasmid replication gin 2512 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region luc2cp 23MA EcoR I 1750 Figure 12. pgl4.12[luc2cp] circle map and sequence reference points. Page 18

20 25 Sal I BamH I pgl4.13[luc2/sv40] (4641bp) luc2 pause site (for background reduction) luc2 reporter gene Reporter primer 4 binding region 25 4 ColEI-derived plasmid replication gin 2732 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region MA luc2 Maps Figure 13. pgl4.13[luc2/sv40] circle map and sequence reference points. Hyg r 2020 BamH I Sal I 3625 pgl4.14[luc2/ Hygro] (5841bp) luc2 pause site (for background reduction) 4862MA luc2 reporter gene hygromycin (Hyg r ) coding region Reporter primer 4 binding region ColEI-derived plasmid replication gin 332 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region Figure 14. pgl4.14[luc2/hygro] circle map and sequence reference points. Hyg r 2148 BamH I Sal I 3753 EcoR I 1750 pgl4.[luc2p/ Hygro] (56bp) luc2p pause site (for background reduction) 4863MA luc2p reporter gene hygromycin (Hyg r ) coding region Reporter primer 4 binding region ColEI-derived plasmid replication gin 40 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region Figure. pgl4.[luc2p/hygro] circle map and sequence reference points. Page

21 Hyg r 2 BamH I Sal I 3804 Figure 16. pgl4.16[luc2cp/hygro] circle map and sequence reference points. Neo r 2020 BamH I Sal I 3383 luc2cp reporter gene hygromycin (Hyg r ) coding region Reporter primer 4 binding region ColEI-derived plasmid replication gin 4111 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region luc2 reporter gene neomycin phosphotransferase (Neo r ) coding region Reporter primer 4 (RVprimer4) binding region ColEI-derived plasmid replication gin 360 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region Figure 17. pgl4.17[luc2/neo] circle map and sequence reference points. Neo r 2148 BamH I Sal I 3511 EcoR I 1750 pgl4.16[luc2cp/ Hygro] (20bp) EcoR I 1750 pgl4.17[luc2/ Neo] (55bp) pgl4.18[luc2p/ Neo] (5727bp) luc2cp luc2 luc2p pause site (for background reduction) pause site (for background reduction) pause site (for background reduction) Figure 18. pgl4.18[luc2p/neo] circle map and sequence reference points. 4864MA 5131MA 5132MA luc2p reporter gene neomycin phosphotransferase (Neo r ) coding region Reporter primer 4 binding region ColEI-derived plasmid replication gin 3818 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region Page 20

22 Neo r 2 BamH I Figure. pgl4.[luc2cp/neo] circle map and sequence reference points. Puro r 2020 BamH I luc2cp reporter gene neomycin phosphotransferase (Neo r ) coding region Reporter primer 4 binding region ColEI-derived plasmid replication gin 386 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region luc2 reporter gene puromycin-n-acetyltransferase (Puro r ) coding region Reporter primer 4 binding region ColEI-derived plasmid replication gin 5 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region Figure 20. pgl4.20[luc2/puro] circle map and sequence reference points. Puro r 2148 BamH I Sal I 3562 Sal I 3188 Sal I 3316 EcoR I 1750 pgl4.[luc2cp/ Neo] (5778bp) EcoR I 1750 pgl4.20[luc2/ Puro] (5404bp) pgl4.21[luc2p/ Puro] (5532bp) luc2cp luc2 luc2p pause site (for background reduction) pause site (for background reduction) pause site (for background reduction) Figure 21. pgl4.21[luc2p/puro] circle map and sequence reference points. 5133MA 51MA 5135 MA luc2p reporter gene puromycin-n-acetyltransferase (Puro r ) coding region Reporter primer 4 binding region ColEI-derived plasmid replication gin 3623 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region Page 21

23 Puro r 2 BamH I Sal I 3367 pgl4.22[luc2cp/ Puro] (5583bp) EcoR I 1750 luc2cp pause site (for background reduction) 5136MA luc2cp reporter gene puromycin-n-acetyltransferase (Puro r ) coding region Reporter primer 4 binding region ColEI-derived plasmid replication gin 3674 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region Figure 22. pgl4.22[luc2cp/puro] circle map and sequence reference points Sal I 2061 BamH I pgl4.23[luc2/minp] (43bp) / Bmt I 32 Minimal Minimal luc2 reporter gene Reporter primer 4 binding region ColE1-derived plasmid replication gin 2374 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region luc2 548MA Figure 23. pgl4.23[luc2/minp] circle map and sequence reference points. 25 Sal I 218 BamH I EcoR I 171 pgl4.[luc2p/minp] (4411bp) luc2p / Bmt I 32 Minimal 54MA Minimal luc2p reporter gene Reporter primer 4 binding region 25 ColE1-derived plasmid replication gin 2502 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region Figure. pgl4.[luc2p/minp] circle map and sequence reference points. Page 22

24 Sal I BamH I EcoR I 171 pgl4.25[luc2cp/minp] (4462bp) luc2cp / Bmt I 32 Minimal 550MA Minimal luc2cp reporter gene Reporter primer 4 binding region ColE1-derived plasmid replication gin 2553 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region Figure 25. pgl4.25[luc2cp/minp] circle map and sequence reference points. Sal I 36 Hyg r BamH I 2061 pgl4.[luc2/minp/hygro] (5882bp) luc2 / Bmt I 32 Minimal 551MA Minimal luc2 reporter gene hygromycin (Hyg r ) coding region Reporter primer 4 binding region ColE1-derived plasmid replication gin 373 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region Figure. pgl4.[luc2/minp/hygro] circle map and sequence reference points. BamH I 218 Sal I 374 Hyg r EcoR I 171 luc2p pgl4.27[luc2p/minp/hygro] (10bp) / Bmt I Minimal Figure 27. pgl4.27[luc2p/minp/hygro] circle map and sequence reference points MA Minimal luc2p reporter gene hygromycin (Hyg r ) coding region Reporter primer 4 binding region ColE1-derived plasmid replication gin 4101 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region Page 23

25 Sal I 3845 Hyg r pgl4.[luc2cp/minp/hygro] (61bp) BamH I 20 luc2cp Minimal luc2cp reporter gene hygromycin (Hyg r ) coding region Reporter primer 4 binding region ColE1-derived plasmid replication gin β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region 10 2 Figure. pgl4.[luc2cp/minp/hygro] circle map and sequence reference points. / Sal I 3868 EcoR I 171 pgl4.2[luc2p/cre/hygro] (84bp) Hyg r / Bmt I Minimal Figure 2. pgl4.2[luc2p/cre/hygro] circle map and sequence reference points. / Sal I 3881 Hyg r CRE NFAT-RE Minimal luc2p BamH I 23 pgl4.30[luc2p/nfat-re/hygro] (7bp) Minimal luc2p BamH I 2276 camp response element (CRE) 33 1 Minimal luc2p reporter gene hygromycin (Hyg r ) coding region Reporter primer 4 binding region ColE1-derived plasmid replication gin 4175 β-lactamase ( ) coding region 4 58 /transcriptional pause site Reporter primer 3 binding region NFAT response element Minimal luc2p reporter gene hygromycin (Hyg r ) coding region Reporter primer 4 binding region ColE1-derived plasmid replication gin 4188 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region Figure 30. pgl4.30[luc2p/nfat-re/hygro] circle map and sequence reference points. 32 EcoR I MA 554MA 555MA Page

26 pgl4 hrluc Maps pgl4.70[hrluc] (3522bp) hrluc / hrluc reporter gene Reporter primer 4 binding region ColEI-derived plasmid replication gin 1613 β-lactamase ( ) coding region 04 /transcriptional pause site Reporter primer 3 binding region Sal I BamH I Figure 31. pgl4.70[hrluc] circle map and sequence reference points. 25MA hrluc Maps 1437 Sal I 1431 BamH I pgl4.71[hrlucp] (3653bp) / hrlucp reporter gene Reporter primer 4 binding region ColEI-derived plasmid replication gin 1744 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region hrlucp MA EcoR I Sal I 1482 BamH I Figure 32. pgl4.71[hrlucp] circle map and sequence reference points. pgl4.72[hrluccp] (3704bp) / hrluccp EcoR I 1033 Figure 33. pgl4.72[hrluccp] circle map and sequence reference points. 27MA hrluccp reporter gene Reporter primer 4 binding region ColEI-derived plasmid replication gin 175 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region Page 25

27 1705 Sal I 16 BamH I pgl4.73[hrluc/sv40] (321bp) hrluc pause site (for background reduction) hrluc reporter gene Reporter primer 4 binding region ColEI-derived plasmid replication gin 2012 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region Figure. pgl4.73[hrluc/sv40] circle map and sequence reference points Sal I 20 BamH I pgl4.74[hrluc/tk] (37bp) hrluc pause site (for background reduction) HSV-TK HSV-TK hrluc reporter gene Reporter primer 4 binding region ColEI-derived plasmid replication gin 2330 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region Figure 35. pgl4.74[hrluc/tk] circle map and sequence reference points Sal I 205 BamH I pgl4.75[hrluc/cmv] (41bp) hrluc pause site (for background reduction) CMV immediateearly CMV immediate early hrluc reporter gene Reporter primer 4 binding region ColEI-derived plasmid replication gin 2372 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region MA 2MA MA Figure 36. pgl4.75[hrluc/cmv] circle map and sequence reference points. Page

28 Sal I 205 Sal I 3036 Figure 37. pgl4.76[hrluc/hygro] circle map and sequence reference points. Hyg r Hyg r pgl4.77[hrlucp/hygro] (5252bp) 1431 BamH I pgl4.76[hrluc/ Hygro] (5121bp) 1300 BamH I hrluc hrlucp pause site (for background reduction) EcoR I 1033 / Figure 38. pgl4.77[hrlucp/hygro] circle map and sequence reference points. 4868MA 4865MA hrluc reporter gene hygromycin (Hyg r ) coding region Reporter primer 4 binding region ColEI-derived plasmid replication gin 3212 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region hrlucp reporter gene hygromycin (Hyg r ) coding region Reporter primer 4 binding region ColEI-derived plasmid replication gin 33 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region Sal I 3087 Hyg r 1482 BamH I pgl4.78[hrluccp/hygro] (5303bp) hrluccp / EcoR I MA hrluccp reporter gene hygromycin (Hyg r ) coding region Reporter primer 4 binding region ColEI-derived plasmid replication gin 334 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region Figure 3. pgl4.78[hrluccp/hygro] circle map and sequence reference points. Page 27

29 Sal I 23 Neo r pgl4.7[hrluc/ Neo] (487bp) 1300 BamH I hrluc pause site (for background reduction) Figure 40. pgl4.7[hrluc/neo] circle map and sequence reference points. 5137MA hrluc reporter gene neomycin phosphotransferase (Neo r ) coding region Reporter primer 4 binding region ColEI-derived plasmid replication gin 270 β-lactamase ( ) coding region /transcriptional pause site 487 Reporter primer 3 binding region Sal I 274 Neo r pgl4.80[hrlucp/neo] (5010bp) 1431 BamH I hrlucp / EcoR I MA hrlucp reporter gene neomycin phosphotransferase (Neo r ) coding region Reporter primer 4 binding region ColEI-derived plasmid replication gin 3101 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region Figure 41. pgl4.80[hrlucp/neo] circle map and sequence reference points. Sal I 45 Neo r 1482 BamH I pgl4.81[hrluccp/neo] (5061bp) hrluccp / EcoR I 1033 Figure. pgl4.81[hrluccp/neo] circle map and sequence reference points. 513MA hrluccp reporter gene neomycin phosphotransferase (Neo r ) coding region Reporter primer 4 binding region ColEI-derived plasmid replication gin 32 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region Page

30 Sal I 68 Sal I 25 Figure 43. pgl4.82[hrluc/puro] circle map and sequence reference points. Figure 44. pgl4.83[hrlucp/puro] circle map and sequence reference points. Sal I 50 Puro r Puro r Puro r 1482 BamH I pgl4.82[hrluc/ Puro] (4684bp) 1300 BamH I pgl4.84[hrluccp/puro] (48bp) pgl4.83[hrlucp/puro] (48bp) 1431 BamH I hrluc hrlucp hrluccp / EcoR I 1033 pause site (for background reduction) / EcoR I 1033 Figure 45. pgl4.84[hrluccp/puro] circle map and sequence reference points. 51MA 5140MA 5141MA hrluc reporter gene puromycin-n-acetyltransferase (Puro r ) coding region Reporter primer 4 binding region ColEI-derived plasmid replication gin 2775 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region hrlucp reporter gene puromycin-n-acetyltransferase (Puro r ) coding region Reporter primer 4 binding region 4 ColEI-derived plasmid replication gin 206 β-lactamase ( ) coding region /transcriptional pause site 48 Reporter primer 3 binding region hrluccp reporter gene puromycin-n-acetyltransferase (Puro r ) coding region Reporter primer 4 binding region ColEI-derived plasmid replication gin 257 β-lactamase ( ) coding region /transcriptional pause site Reporter primer 3 binding region Page 2

31 V. References 1. Klingenhoff, A. et al. () Functional modules can be detected by formal models independent of overall nucleotide sequence similarity. Bioinform., pgl3 Luciferase Reporter s Technical Manual, #TM033, Promega Corporation. 3. Schimke R.T. (73) Control of enzyme levels in mammalian tissues. Adv. Enzymol. Mol. Biol. 37, Li, X. et al. (8) Generation of destabilized green fluorescent protein as a transcription reporter. J. Biol. Chem. 273, Gilon, T., Chomsky, O. and Kulka, R.G. (8) Degradation signals for ubiquitin system proteolysis in Saccharomyces cerevisiae. EMBO J. 17, Gluzman, Y. (81) SV40-transformed simian cells support the replication of early SV40 mutants. Cell 23, Wagner, E.F. et al. (85) Transfer of genes into embryonal carcinoma cells by retrovirus infection: Efficient expression from an internal. EMBO J. 4, Stewart, C.L. et al. (87) Expression of retroviral vectors in transgenic mice obtained by embryo infection. EMBO J. 6, Schmidt, E.V. et al. (0) The cytomegalovirus enhancer: A pan-active control element in transgenic mice. Mol. Cell. Biol. 10, Proudfoot, N.J. (1) Poly(A) signals. Cell 64, Bernstein, P. and Ross, J. (8) Poly(A), binding protein and the regulation of mrna stability. Trends Biochem. Sci. 14, Jackson, R.J. and Standart, N. (0) Do the tail and 3 untranslated region control mrna translation? Cell 62,. 13. Carswell, S. and Alwine, J.C. (8) Efficiency of utilization of the simian virus 40 late polyadenylation site: Effects of upstream sequences. Mol. Cell. Biol., VI. Related Products Renilla Luciferase Assay Systems Product Size Cat.# EnduRen Live Cell Substrate 0.mg E mg E6482 mg E6485 ViviRen Live Cell Substrate 0.37mg E mg E6 37mg E645 Renilla Luciferase Assay System 100 assays E10 1,000 assays E20 Luciferase Reporter Cell Lines Product Size Cat.# GloResponse CRE-luc2P HEK23 Cell Line each E8500 GloResponse NFAT-RE-luc2P HEK23 Cell Line each E8510 Page 30

32 Firefly Luciferase Assay Systems Product Size Cat.# ONE-Glo Luciferase Assay System* 10ml E ml E6120 1L E6130 Bright-Glo Luciferase Assay System* 10ml E10 100ml E ml E50 Steady-Glo Luciferase Assay System 10ml E ml E ml E2550 Luciferase Assay System 100 assays E00 Luciferase 1000 Assay System 1,000 assays E4550 Luciferase Assay System with Reporter Lysis Buffer 100 assays E4030 *For Laboratory Use. Firefly and Renilla (Dual-Reporter) Luciferase Assay Systems Product Size Cat.# Dual-Glo Luciferase Assay System 10ml E ml E ml E280 Dual-Luciferase Reporter Assay System 100 assays E10 Dual-Luciferase Reporter 1,000 Assay System 1,000 assays E80 Luminometers Product Size Cat.# GloMax 20/20 Luminometer each E5311 GloMax 20/20 Luminometer w/single Auto-Injector each E5321 GloMax 20/20 Luminometer w/dual Auto-Injector each E5331 GloMax 6 Microplate Luminometer each E6501 GloMax 6 Microplate Luminometer w/single Injector each E6511 GloMax 6 Microplate Luminometer w/dual Injectors each E6521 Lysis Buffer Product Size Cat.# Passive Lysis 5X Buffer 30ml E41 Antibiotic Product Size Cat.# Antibiotic G-418 Sulfate 100mg V781 Page 31

33 (a) For research use only. This product and/or its use is subject to one or more of the following Promega patents: U.S. Pat. Appln. Ser. Nos. 0/645,706, 10/43,508, 10/4,1, PCT Pat. Appln. Ser. No. PCT/US03/3, PCT/US2005/033218, U.S. Pat. Nos. 5,670,356, 6,387,675 and 6,552,17, Australian Pat. No. 684 and various corresponding patent applications and issued patents. The terms of the limited license conveyed with the purchase of this product are as follows: Researchers may use this product in their research and they may transfer derivatives to others for research use provided that at the time of transfer a copy of this label license is given to the recipients and the recipients agree to be bound by the terms and conditions of this label license. In addition, researchers must do one of the following: (1) use luminescent assay reagents purchased from Promega Corporation for all determinations of luminescence activity resulting from the research use of this product and its derivatives; or (2) contact Promega to obtain a license for the use of the product and its derivatives in conjunction with luminescent assay reagents not purchased from Promega. No reach-through payments shall be owed to Promega relating to an organization s commercialization of products that are the discoveries resulting from the research use of this product or its derivatives, provided that such products of the organization do not fall within the scope of the valid claims of any issued patents assigned or licensed to Promega, or that such commercialization would not be a violation of the terms of this label license. No other use of this product or its derivatives is authzed without the express written consent of Promega including, without limitation, Commercial Use. Commercial Use means any and all uses of this product and derivatives by a party for monetary or other consideration and may include but is not limited to use in: (1) product manufacture; and (2) to provide a service, information or data; and/or resale of the product or its derivatives, whether or not such product or derivatives are resold for use in research. With respect to such Commercial Use, or any diagnostic, therapeutic or prophylactic uses, please contact Promega for supply and licensing information. If the purchaser is not willing to accept the conditions of this limited use statement, Promega is willing to accept the return of the unopened product and provide the purchaser with a full refund. However, in the event the product is opened, then the purchaser agrees to be bound by the conditions of this limited use statement. (b)cat.# C351, E51, E61, E71, E81, E1, E6701, E6711, E6721, E6731, E6741, E6751, E6761, E6771, E8411, E81, E8431, E8441, E8451, E8461, E81, E8481: The method of recombinant expression of Coleoptera luciferase is covered by U.S. Pat. Nos. 5,583,0, 5,674,713 and 5,700,673. A license (from Promega for research reagent products and from The Regents of the University of California for all other fields) is needed for any commercial sale of nucleic acid contained within or derived from this product. (c)cat.# E8481: The NFAT response element and its use are licensed under one or more of the following patents: U.S. Pat. Nos. 5,837,840, 6,7,25, 5,8,810, 6,06,5, 6,388,052, 6,0,0, 6,171,781, 6,352,830, 6,312,8 and 6,875,571. (d) Cat.# E6881, E681, E601, E611, E621, E631, E641, E651, E661, E671, E681, E61, E7501, E7511, E7521: Licensed from University of Georgia Research Foundation, Inc., under U.S. Pat. Nos. 5,22,658, 5,418,5, Canadian Pat. No. 2,105,84 and related patents. (e) Cat.# E631: The CMV and its use are covered under U.S. Pat. Nos. 5,168,062 and 5,385,83 owned by the University of Iowa Research Foundation, Iowa City, Iowa, and licensed FOR RESEARCH USE ONLY. Research Use includes contract research for which monetary or other consideration may be received. Other commercial users must obtain a license to these patents directly from the University of Iowa Research Foundation Promega Corporation. All Rights Reserved. Dual-Luciferase, Flexi, GloMax and Steady-Glo are registered trademarks of Promega Corporation. Bright-Glo, CheckMate, Dual-Glo, EnduRen, GloResponse, ONE-Glo, Rapid Response and ViviRen are trademarks of Promega Corporation. GenBank is a registered trademark of the U.S. Department of Health and Human Services. Products may be covered by pending or issued patents or may have certain limitations. Please visit our Web site for more information. All prices and specifications are subject to change without prior notice. Product claims are subject to change. Please contact Promega Technical Services or access the Promega catalog online for the most up-to-date information on Promega products. Page 32

FuGENE HD Transfection Reagent

FuGENE HD Transfection Reagent TECHNICAL MANUAL FuGENE HD Transfection Reagent Instructions for Use of Products E2311 and E2312 Revised 2/13 TM328 FuGENE HD Transfection Reagent All technical literature is available at: www.promega.com/protocols/

More information

Luciferase Assay System

Luciferase Assay System TECHNICAL BULLETIN Luciferase Assay System Instructions for Use of Products E1483, E1500, E1501, E1531, E4030, E4530 and E4550. Revised 8/15 TB281 Luciferase Assay System All technical literature is available

More information

Dual-Luciferase Reporter Assay System INSTRUCTIONS FOR USE OF PRODUCTS E1910 AND E1960.

Dual-Luciferase Reporter Assay System INSTRUCTIONS FOR USE OF PRODUCTS E1910 AND E1960. Technical Manual Dual-Luciferase Reporter Assay System INSTRUCTIONS FOR USE OF PRODUCTS E1910 AND E1960. PRINTED IN USA. Revised 8/06 AF9TM040 0806TM040 Dual-Luciferase Reporter Assay System All technical

More information

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells. Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,

More information

OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation

OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation -Optimal strategies to a successful mirna research project Optimal strategies to a successful mirna research

More information

Innate Immunity. Insects rely solely on an innate immune system for defense against infection

Innate Immunity. Insects rely solely on an innate immune system for defense against infection Innate Immunity Insects rely solely on an innate immune system for defense against infection The importance of mammalian innate immunity has only recently become appreciated The innate immune response

More information

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise: HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone

More information

STOP. Before using this product, please read the Limited Use License statement below:

STOP. Before using this product, please read the Limited Use License statement below: STOP Before using this product, please read the Limited Use License statement below: Important Limited Use License information for pdrive5lucia-rgfap The purchase of the pdrive5lucia-rgfap vector conveys

More information

LightSwitch Luciferase Assay System

LightSwitch Luciferase Assay System Constructs, Assays & Services Assay System Promoter GoClones Synthetic Response Elements Pathway Cell Lines 3 UTR GoClones mirna Mimics & Inhibitors Synthetic mirna Targets Transfection Reagents Assay

More information

Product: Expression Arrest TM egfp control shrna vector

Product: Expression Arrest TM egfp control shrna vector Product: Expression Arrest TM egfp control vector Catalog #: RHS1702 Product Description The laboratory of Dr. Greg Hannon at Cold Spring Harbor Laboratory (CSHL) has created an RNAi Clone Library comprised

More information

pmod2-puro A plasmid containing a synthetic Puromycin resistance gene Catalog # pmod2-puro For research use only Version # 11H29-MM

pmod2-puro A plasmid containing a synthetic Puromycin resistance gene Catalog # pmod2-puro For research use only Version # 11H29-MM pmod2-puro A plasmid containing a synthetic Puromycin resistance gene Catalog # pmod2-puro For research use only Version # 11H29-MM PrOduct information content: - 20 mg of lyophilized pmod2-puro plasmid

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

Integrated Protein Services

Integrated Protein Services Integrated Protein Services Custom protein expression & purification Version DC04-0012 Expression strategy The first step in the recombinant protein generation process is to design an appropriate expression

More information

Effects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual

Effects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual Effects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual I. Purpose...1 II. Introduction...1 III. Inhibition of Bacterial Growth Protocol...2 IV. Inhibition of in vitro

More information

Understanding the immune response to bacterial infections

Understanding the immune response to bacterial infections Understanding the immune response to bacterial infections A Ph.D. (SCIENCE) DISSERTATION SUBMITTED TO JADAVPUR UNIVERSITY SUSHIL KUMAR PATHAK DEPARTMENT OF CHEMISTRY BOSE INSTITUTE 2008 CONTENTS Page SUMMARY

More information

How To Understand How Gene Expression Is Regulated

How To Understand How Gene Expression Is Regulated What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation

More information

Integrated Protein Services

Integrated Protein Services Integrated Protein Services Custom protein expression & purification Last date of revision June 2015 Version DC04-0013 www.iba-lifesciences.com Expression strategy The first step in the recombinant protein

More information

mirnaselect pep-mir Cloning and Expression Vector

mirnaselect pep-mir Cloning and Expression Vector Product Data Sheet mirnaselect pep-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-C STORAGE: -80ºC QUANTITY: 2 vectors; each contains 100 µl of bacterial glycerol stock Components 1. mirnaselect

More information

Validation & Assay Performance Summary

Validation & Assay Performance Summary Validation & Assay Performance Summary GeneBLAzer RAR alpha DA Assay Kit GeneBLAzer RAR alpha-uas-bla GripTite Cells Cat. no. K1387, K1685 Target Description The retinoic acid receptor alpha (RAR alpha)

More information

Before opening this package, please read the Limited Use License statement below:

Before opening this package, please read the Limited Use License statement below: STOP Before opening this package, please read the Limited Use License statement below: Important Limited Use License information for pcpgfree-ova The purchase of the pcpgfree-ova vector conveys to the

More information

Design of conditional gene targeting vectors - a recombineering approach

Design of conditional gene targeting vectors - a recombineering approach Recombineering protocol #4 Design of conditional gene targeting vectors - a recombineering approach Søren Warming, Ph.D. The purpose of this protocol is to help you in the gene targeting vector design

More information

European Medicines Agency

European Medicines Agency European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein

More information

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams. Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.

More information

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: [email protected].

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu. Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: [email protected] What is Gene Expression & Gene Regulation? 1. Gene Expression

More information

Gene Regulation -- The Lac Operon

Gene Regulation -- The Lac Operon Gene Regulation -- The Lac Operon Specific proteins are present in different tissues and some appear only at certain times during development. All cells of a higher organism have the full set of genes:

More information

MGC premier Expression-Ready cdna clones TCH1103, TCM1104, TCR1105, TCB1106, TCH1203, TCM1204, TCR1205, TCB1206, TCH1303, TCM1304, TCR1305

MGC premier Expression-Ready cdna clones TCH1103, TCM1104, TCR1105, TCB1106, TCH1203, TCM1204, TCR1205, TCB1206, TCH1303, TCM1304, TCR1305 MGC premier Expression-Ready cdna clones TCH1103, TCM1104, TCR1105, TCB1106, TCH1203, TCM1204, TCR1205, TCB1206, TCH1303, TCM1304, TCR1305 The MGC premier Expression-Ready collection has the high quality,

More information

Mir-X mirna First-Strand Synthesis Kit User Manual

Mir-X mirna First-Strand Synthesis Kit User Manual User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.

More information

Chapter 5: Organization and Expression of Immunoglobulin Genes

Chapter 5: Organization and Expression of Immunoglobulin Genes Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed

More information

TransIT -2020 Transfection Reagent

TransIT -2020 Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/5400 INTRODUCTION TransIT -2020 Transfection Reagent is a high-performance, animal-origin free, broad spectrum reagent

More information

GENE REGULATION. Teacher Packet

GENE REGULATION. Teacher Packet AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

3 Chapter Three: Material and methods (clone creation, upstream and downstream process)

3 Chapter Three: Material and methods (clone creation, upstream and downstream process) 3 Chapter Three: Material and methods (clone creation, upstream and downstream process) 3.1 Model proteins and CHO cell cultures Two recombinant produced, CHO-cell-derived model-glycoproteins, a less glycosylated

More information

AP BIOLOGY 2009 SCORING GUIDELINES

AP BIOLOGY 2009 SCORING GUIDELINES AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following

More information

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh

More information

Recombinant DNA Unit Exam

Recombinant DNA Unit Exam Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line

2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line i 1 INTRODUCTION 1.1 Human Hepatitis B virus (HBV) 1 1.1.1 Pathogenesis of Hepatitis B 1 1.1.2 Genome organization of HBV 3 1.1.3 Structure of HBV virion 5 1.1.4 HBV life cycle 5 1.1.5 Experimental models

More information

Luciferase Assay System

Luciferase Assay System Luciferase Assay System A comprehensive platform for promoter and 3 UTR reporter assays SYSTEM OVERVIEW The LightSwitch Luciferase Assay System includes: s LightSwitch GoClone Collections Genome-wide collections

More information

BaculoDirect Baculovirus Expression System Free your hands with the BaculoDirect Baculovirus Expression System

BaculoDirect Baculovirus Expression System Free your hands with the BaculoDirect Baculovirus Expression System BaculoDirect Baculovirus Expression System Free your hands with the BaculoDirect Baculovirus Expression System The BaculoDirect Baculovirus Expression System gives you: Unique speed and simplicity High-throughput

More information

Protein Expression and Analysis. Vijay Yajnik, MD, PhD GI Unit MGH

Protein Expression and Analysis. Vijay Yajnik, MD, PhD GI Unit MGH Protein Expression and Analysis Vijay Yajnik, MD, PhD GI Unit MGH Identify your needs Antigen production Biochemical studies Cell Biology Protein interaction studies including proteomics Structural studies

More information

Translation Study Guide

Translation Study Guide Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to

More information

Lecture 6. Regulation of Protein Synthesis at the Translational Level

Lecture 6. Regulation of Protein Synthesis at the Translational Level Regulation of Protein Synthesis (6.1) Lecture 6 Regulation of Protein Synthesis at the Translational Level Comparison of EF-Tu-GDP and EF-Tu-GTP conformations EF-Tu-GDP EF-Tu-GTP Next: Comparison of GDP

More information

First Strand cdna Synthesis

First Strand cdna Synthesis 380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences

More information

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C) TECHNICAL DATA SHEET BIOLUMINESCENCE RESONANCE ENERGY TRANSFER RENILLA LUCIFERASE FUSION PROTEIN EXPRESSION VECTOR Product: prluc-c Vectors Catalog number: Description: Amount: The prluc-c vectors contain

More information

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the

More information

Sample Questions for Exam 3

Sample Questions for Exam 3 Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

Assembly of Restriction Enzyme Digestions

Assembly of Restriction Enzyme Digestions TECHNICAL MANUAL Assembly of Restriction Enzyme Digestions 12/11 TM367 Assembly of Restriction Enzyme Digestions All technical literature is available at: www.promega.com/protocols/ Visit the web site

More information

BCH401G Lecture 39 Andres

BCH401G Lecture 39 Andres BCH401G Lecture 39 Andres Lecture Summary: Ribosome: Understand its role in translation and differences between translation in prokaryotes and eukaryotes. Translation: Understand the chemistry of this

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

Answer Key Problem Set 5

Answer Key Problem Set 5 7.03 Fall 2003 1 of 6 1. a) Genetic properties of gln2- and gln 3-: Answer Key Problem Set 5 Both are uninducible, as they give decreased glutamine synthetase (GS) activity. Both are recessive, as mating

More information

Protein Expression. A Practical Approach J. HIGGIN S

Protein Expression. A Practical Approach J. HIGGIN S Protein Expression A Practical Approach S. J. HIGGIN S B. D. HAMES List of contributors Abbreviations xv Xvi i 1. Protein expression in mammalian cell s Marlies Otter-Nilsson and Tommy Nilsso n 1. Introduction

More information

Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu

Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu Expression and Purification of Recombinant Protein in bacteria and Yeast Presented By: Puspa pandey, Mohit sachdeva & Ming yu DNA Vectors Molecular carriers which carry fragments of DNA into host cell.

More information

RT-PCR: Two-Step Protocol

RT-PCR: Two-Step Protocol RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed

More information

Viral Infection: Receptors

Viral Infection: Receptors Viral Infection: Receptors Receptors: Identification of receptors has come from expressing the gene for the receptor in a cell to which a virus does not normally bind -OR- By blocking virus attachment

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Novel method to load a mammalian artificial chromosome. (MAC) with multiple genes

Novel method to load a mammalian artificial chromosome. (MAC) with multiple genes Novel method to load a mammalian artificial chromosome (MAC) with multiple genes Ph. D. thesis summary Anna Tóth Supervisor: Róbert Katona, Ph. D. Principal Investigator Institute of Genetics Biological

More information

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

pcmv6-neo Vector Application Guide Contents

pcmv6-neo Vector Application Guide Contents pcmv6-neo Vector Application Guide Contents Package Contents and Storage Conditions... 2 Product Description... 2 Introduction... 2 Production and Quality Assurance... 2 Methods... 3 Other required reagents...

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

Becker Muscular Dystrophy

Becker Muscular Dystrophy Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency

More information

Reverse Transcription System

Reverse Transcription System TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

Chapter 18 Regulation of Gene Expression

Chapter 18 Regulation of Gene Expression Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection

More information

1 Mutation and Genetic Change

1 Mutation and Genetic Change CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds

More information

Complex multicellular organisms are produced by cells that switch genes on and off during development.

Complex multicellular organisms are produced by cells that switch genes on and off during development. Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS

STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS THESIS SUBMITTED FOR THE DEGREB OF DOCTOR OF PHILOSOPHY (SCIENCE) OF THE UNIVERSITY OF CALCUTTA 1996 NRISINHA DE, M.Sc DEPARTMENT OF BIOCHEMISTRY

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Bio 102 Practice Problems Recombinant DNA and Biotechnology

Bio 102 Practice Problems Recombinant DNA and Biotechnology Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site

More information

13.4 Gene Regulation and Expression

13.4 Gene Regulation and Expression 13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.

More information

Replication Study Guide

Replication Study Guide Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have

More information

Control of Gene Expression

Control of Gene Expression Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring

More information

Gene Models & Bed format: What they represent.

Gene Models & Bed format: What they represent. GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,

More information

GenBank, Entrez, & FASTA

GenBank, Entrez, & FASTA GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,

More information

Hydroxynitrile lyase (Hnl)

Hydroxynitrile lyase (Hnl) Hydroxynitrile lyase (Hnl) R 1 HCN R 1 OH R 2 C O R 2 C * CN S-selective: Hevea brasiliensis R-selective: Prunus spp. (S)-Hnl of Hevea brasiliensis and (R)-Hnl of Prunus amygdalus Hb_Hnl Type II Hnl intracellular

More information

MEF Starter Nucleofector Kit

MEF Starter Nucleofector Kit page 1 of 7 MEF Starter Nucleofector Kit for Mouse Embryonic Fibroblasts (MEF) MEF display significant phenotypic variations which depend on the strain, the genetic background of the mice they are isolated

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

Cloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems

Cloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems Promega Notes Number 71, 1999, p. 10 Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems By Kimberly Knoche, Ph.D., and Dan Kephart, Ph.D. Promega Corporation Corresponding

More information

GENETIC TRANSFORMATION OF BACTERIA WITH THE GENE FOR GREEN FLUORESCENT PROTEIN (GFP)

GENETIC TRANSFORMATION OF BACTERIA WITH THE GENE FOR GREEN FLUORESCENT PROTEIN (GFP) GENETIC TRANSFORMATION OF BACTERIA WITH THE GENE FOR GREEN FLUORESCENT PROTEIN (GFP) LAB BAC3 Adapted from "Biotechnology Explorer pglo Bacterial Transformation Kit Instruction Manual". (Catalog No. 166-0003-EDU)

More information

Genetics Test Biology I

Genetics Test Biology I Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.

More information

Genetics Lecture Notes 7.03 2005. Lectures 1 2

Genetics Lecture Notes 7.03 2005. Lectures 1 2 Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several

More information

GeneCopoeia Genome Editing Tools for Safe Harbor Integration in. Mice and Humans. Ed Davis, Liuqing Qian, Ruiqing li, Junsheng Zhou, and Jinkuo Zhang

GeneCopoeia Genome Editing Tools for Safe Harbor Integration in. Mice and Humans. Ed Davis, Liuqing Qian, Ruiqing li, Junsheng Zhou, and Jinkuo Zhang G e n e C o p o eia TM Expressway to Discovery APPLICATION NOTE Introduction GeneCopoeia Genome Editing Tools for Safe Harbor Integration in Mice and Humans Ed Davis, Liuqing Qian, Ruiqing li, Junsheng

More information

Bacterial and Phage Genetic Switches

Bacterial and Phage Genetic Switches Bacterial and Phage Genetic Switches Prof. C. J. Dorman Department of Microbiology, Moyne Institute of Preventive Medicine, Trinity College, Dublin. Lecture 1 The genetic switch controlling the lytic-lysogen

More information

Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr

Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,

More information

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!! DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

ptune Inducible Vector

ptune Inducible Vector ptune Inducible Vector Application Guide Table of Contents Package contents and Storage Conditions:...2 Related products:...2 Introduction...2 Figure 1. Schematic Diagrams of ptune Inducible vector...3

More information

A role of microrna in the regulation of telomerase? Yuan Ming Yeh, Pei Rong Huang, and Tzu Chien V. Wang

A role of microrna in the regulation of telomerase? Yuan Ming Yeh, Pei Rong Huang, and Tzu Chien V. Wang A role of microrna in the regulation of telomerase? Yuan Ming Yeh, Pei Rong Huang, and Tzu Chien V. Wang Department of Molecular and Cellular Biology, Chang Gung University, Kwei San, Tao Yuan 333, Taiwan

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.

QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency. QUANTITATIVE RT-PCR Application: Quantitative RT-PCR is used to quantify mrna in both relative and absolute terms. It can be applied for the quantification of mrna expressed from endogenous genes, and

More information

MOL.911 HNL Expression

MOL.911 HNL Expression 1 W I S S E N T E C H N I K L E I D E N S C H A F T MOL.911 HNL Expression www.tugraz.at 2 Hydroxynitrile lyase (Hnl) R 1 HCN R 1 OH R 2 C O R 2 C * CN S selective: Hevea brasiliensis R selective: Prunus

More information

NIH Mammalian Gene Collection (MGC)

NIH Mammalian Gene Collection (MGC) USER GUIDE NIH Mammalian Gene Collection (MGC) Catalog number FL1002 Revision date 28 November 2011 Publication Part number 25-0610 MAN0000351 For Research Use Only. Not for diagnostic procedures. ii Table

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

Accelerating drug development to FTIH: Potential of new expression technologies

Accelerating drug development to FTIH: Potential of new expression technologies Accelerating drug development to FTIH: Potential of new expression technologies Lekan Daramola Associate Director Biopharmaceutical Development, Cell Culture & Fermentation Sciences CMC Strategy Forum

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information