Exon Primer name Sequence Amplicon size

Save this PDF as:

Size: px
Start display at page:

Download "Exon Primer name Sequence Amplicon size"


1 Supplementary Material PCR amplification of the BRCA2 gene The components of the PCR reaction were: 20mM Tris-HCl(pH8.4), 50mM KCl, 1.5mM MgCl 2, 0.1mM in each of datp, dctp, dgtp, TTP, 0.1µM of each primer, 5ng/µl DNA, 0.05units/µl Taq polymerase (Taq Platinum, GIBCO BRL, Gaithersburg, MD). The primer sequences are as follows: Exon Primer name Sequence Amplicon size 2 2-F GTT CCA GGA GAT GGG ACT GAA 348 bp 2-R ACA CAT AAG GAA CAG TTT ATG GTT 3 3-F CCA TAG TCA AGA TCT TTA GCA 466 bp 3-R ACT GAT TTG CCC AGC ATG ACA 4 4-F TTA CAA CTC CCT ATA CAT TCT CA 454 bp 4-R AAC CAG CCA ATT CAA CAT CAC A 5/6 5/6-F ATA TCT AAA AGT AGT ATT CCA ACA A 421 bp 5/6-R AAT TGC CTG TAT GAG GCA GAA T 7 7-F GTT ATA CCT TTG CCC TGA GAT T 398 bp 7-R GTC AGT TAC TAA CAC ACT TAT CA 8 8-F GTT TAT TCA CTG TGT TGA TTG AC 372 bp 8-R CAT ATA GGA CCA GGT TTA GAG A 9 9-F CAT CAC ACT ACT CAG GAT GAC A 495 bp 9-R GCA TGG TGG TGC ATG CTT GTA 10a 10a-F CCA AGT ACT CAG AAT AAC CCT T 497 bp 10a-R TTT GTC ACT TCC ACT CTC AAA G 10b 10b-F TCC ATG AAG CAA ACG CTG ATG A 470 bp 10b-R CCA GAT ATT GCC TGC TTT ACT G 10c 10c-F GAC CTA TTA GAC ACA GAG AAC A 454 bp 10c-R CTG CAT TCT TCA AAG CTA CAG A 10d 10d-F TCA GGT CAT ATG ACT GAT CCA A 416 bp 10d-R AAC ACA GAA GGA ATC GTC ATC T 10e 10e-F CCG AAA GAC CAA AAA TCA GAA CT 400 bp 10e-R AGC AAA CCA ACA TGG CAT ACG T 11a 11a-F CCA AAC ACT ACC TTT TTA ACT TAG T 380 bp 11a-R GAC CTC TTC TTT TAT ATC TGA AAC T 11b 11b-F CTG AAG AAC CAA CTT TGT CCT TA 350 bp 11b-R AGT GCT GGC ATT TTC ATG ATC AT 11c 11c-F TAT TAC CCC AGA AGC TGA TTC T 299 bp 11c-R TAC CTT TGA GCT TGT CTG ACA T 11d 11d-F ATG TCA CCC AGT ACA ACA TTC A 484 bp 11d-R CCT TTC ATT AGC AAC TTG GAA GA 11e 11e-F GAG AGT AGC ATC ACC TTC AAG A 464 bp


3 17 17-F CAC CAT GCT CAG CAA TGA AGT 498 bp 17-R GAT GGC AAC TGT CAC TGA CAA 18a 18a-F TCC ACT ATT TGG GGA TTG CTA A 432 bp 18a-R TAC CAC CCA TCT GTA AGT TCA A 18b 18b-F TAG AAG CAG AAG ATC GGC TAT A 389 bp 18b-R GAA TTT AAC TGA ATC AAT GAC TGA 18c 18c-F TCC TCC CCT CTT AGC TGT CTT 312 bp 18c-R GAC CTC CCA AAA ACT GCA CAA A F GGC AGT TCT AGA AGA ATG AAA AC 480 bp 19-R ACC CCT TCT CTA CCA AAA ATA CA F CTC AGG TGA TCC ACT AAT CTC 453 bp 20-R CCC TTG TTG CTA TTC TTT GTC T F TGA CAG AGT GAG ACC CTG TCT 411 bp 21-R CCT TTT GGA GAA ATG CAG CAT T F CAC ACC CTT AAG ATG AGC TCT 443 bp 22-R TAG TGG ATT TTG CTT CTC TGA TA F ATC CAC TAC TAA TGC CCA CAA A 416 bp 23-R TCC CGT GGC TGG TAA ATC TGA F ACA TAC AGT TAG CAG CGA CAA A 398 bp 24-R CAG ATC ACT AGT TAG CTA GCA A 25a 25a-F AGC TTT CGC CAA ATT CAG CTA T 361 bp 25a-R CTC TTG AAA GTG GCC CTC TTT 25b 25b-F GGA TAG ACC TTA ATG AGG ACA T 336 bp 25b-R TCC TGA GGT TCA TGG GCA ATT F GCA TGT TTG ACA ATT GGT ATC AC 427 bp 26-R GGA GCC ACA TAA CAA CCA CAT T 27a 27a-F GGG GAG GGA GAC TGT GTG TA 400 bp 27a-R TTT CGT ATT TGG TGC CAC AAC T 27b 27b-F AAG TCT TGT AAA GGG GAG AAA GA 379 bp 27b-R CTG GTG GGA GCA GTC CTA GT 27c 27c-F ATT CTC CTC AGA TGA CTC CAT T 352 bp 27c-R ACT GGA AAG GTT AAG CGT CAA T 27d 27d-F CTC AGA CTG AAA CGA CGT TGT A 318 bp 27d-R GCA ACT GAA GCA AAA GTA TAC CA One primer (designated -F ) in each pair was synthesized with an 18base M13 21 forward sequence (TGTAAAACGACGGCCAGT) at its 5 end, and the other primer (designated -R ) was synthesized with an 18 base M13 28 reverse sequence (CAGGAAACAGCTATGACC) at its 5 end. For the longer exons, two or more overlapping amplicons were designed. The thermocycling conditions were: 94 C, 4min, followed by 11 cycles, each with a denaturing step at 94 C for 20 seconds and an extension step at 72 C for 20 seconds, and with a 20 second annealing step that decreased 1 C/ cycle, beginning at 60 C in the first cycle and decreasing to 50 C in the eleventh cycle; the eleventh cycle

4 was then repeated 25 times; a 6 minute incubation at 72 C followed by a 4 C soak completed the program. DNA sequencing An aliquot of each PCR reaction was diluted 1:10 with water. The diluted PCR product was sequenced on both strands using an M13 Forward and an M13 Reverse Big Dye Primer kit (Applied Biosystems, Foster City, CA) according to the manufacturer s recommendations. The sequencing products were separated on a fluorescent sequencer (model 377 from Applied Biosystems, Foster City, CA). Base calls were made by the instrument software, and reviewed by visual inspection. Each sequence was compared to the corresponding normal sequence using Sequencher 3.0 software (LifeCodes, Stamford, CT). Denaturing Gradient Gel Electrophoresis (DGGE) analysis of exon 15 and 27 of the BRCA2 gene Genomic DNA samples were from healthy blood donors derived from the Netherlands Center of Blood Transfusion Service (CLB, Amsterdam, The Netherlands). DNA fragments that harbor the mutations in the EUFA423 patient, exon 15 and exon 27, were amplified from the patient and 60 unrelated controls. Primer sets, IC-B2-15.1F with IC- B2-15.1R, and IC-B2-27.1F with IC-B2-27.1R, were obtained from Ingeny (Ingeny International, The Netherlands) ( Samples were run in parallel using DGGE (1). Gels were stained with ethidium bromide and visualized with UV light. Reverse Transcription-PCR For RT-PCR analysis of the HSC62 cells, RNA was purified from fibroblasts and lymphoblasts using the Qiagen RNeasy Protect mini kit. First-strand cdna was synthesized from 2 µg RNA using Superscript II reverse transcriptase (Invitrogen, Carlsbad, CA). Primers used to amplify a region of BRCA2 from exon 18 through exon 22 were BRCA2ex18FP (CCTCCCCTCTTAGCTGTCTTAAA) and BRCA2ex22RP (CCCTTGATAAACCTTGTTCCTTT). Primers used to amplify a region of the FANCD2 gene were DF3862 (CATCCTGTTCTGCATGTATG) and DSR4360 (TGATGACTCTGATTAGACCC).

5 Segregation analysis of EUFA423 kindred For segregation analysis of EUFA423 pedigree, DNA from lymphoblastoid cell lines of the father (EUFA424L), mother (EUFA425L) and three siblings (EUFA664L, EUFA665L and EUFA666L) of EUFA423 were used to PCR amplify exon 15 and region 27a in exon 27 of the BRCA2 gene. The DNA sequence of both strands of each PCR product was determined. Microcell mediated chromosome transfer of human chromosome 13 into EUFA423 fibroblasts. Microcell fusions were performed as described (2). Briefly, donor A9+13 Hytk cells (mouse A9 cells containing hygromycin-marked human chromosome 13 (3) were split into 150 mm 2 tissue culture plates. After h, micronuclei were induced by treating the A9+13 Hytk cells for 48 h with 0.05 mg/ml colcemid. Micronucleated cells were then trypsinized and allowed to sit for 8-16 h onto tissue culture plates cut into the shape of a bullet. Bullets were then placed into 50 ml centrifuge tubes containing enucleation media (serum-free alpha-mem and 10 mg/ml of cytochalasin B) and centrifuged at 14,000 rpm for 30 min at 37 C. The resulting microcell pellets were resuspended in serum-free alpha-mem and filtered through an 8 m and then a 5 m Whatman Nuclepore membrane. The filtered microcells were then mixed with 100 mg/ml of phytohemagglutinin P and added to a monolayer of immortalized EUFA423 fibroblasts. After 15 min fibroblasts and A9+13 Hytk microcells were fused with 50% polyethylene glycol for 1 min, washed with serum-free alpha-mem and allowed to grow overnight in alpha-mem with 15% fetal bovine serum. The next day, cells were split 1:5 onto 150 mm 2 tissue culture plates, and the following day, cells were selected in alpha-mem medium, supplemented with 15% fetal bovine serum, 200 µg/ml hygromycin and hypoxanthine, aminopterin, thymidine (HAT). Clones were subsequently picked, expanded and analyzed. Chromosome Breakage Analysis Chromosome Breakage Analysis was performed as previously described (4).

6 fig. S1. FA-D1 cells and BRCA2(-/-) tumor cells exhibit a similar pattern of chromosome breakage. Metaphase chromosome spreads from FA-D1 fibroblasts or CAPAN1 cells exposed to MMC (20 ng/ml) for 48 hours. Radial forms are indicated (arrows). fig. S2. The FA-D1 reference line, HSC62, contains a homozygous mutation in the splice acceptor site of intron 19 (IVS19-1 G to A). Schematic representation of an alternate splicing mechanism at the junction of intron 19 and exon 20 of HSC62, resulting in the loss of the first 12 bases of exon 20, corresponding to an in-frame deletion of four amino acids from BRCA2 (a.a to 2833). fig. S3. Possible functions of the BRCA2 protein in the FA/BRCA pathway. (A) Schematic representation of the FA/BRCA pathway. DNA damage-inducible or S phase specific monoubiquitination of FANCD2 requires the FA protein complex (A/C/G/E/F complex). Monoubiquitination targets D2 to DNA repair foci containing BRCA1, BRCA2, and RAD51. The BRCA2 protein may function upstream in this pathway, by promoting D2 monoubiquitination, and/or downstream in the pathway by promoting homologous recombination repair. (B) Whole cell lysates were prepared from the indicated EBV lymphoblast lines (lanes 2-11) or BRCA2(-/-) CAPAN-1 cells (lane 12), and cellular proteins were immunoblotted with a monoclonal antibody specific for FANCD2 (F17 monoclonal). These cell lines and their growth requirements have previously been described (5). Supplementary References 1. R. M. Myers et al., in Methods Enzymology, R. Wu, Ed. (Academic Press, San Diego, 1987), vol. 155, pp M. Whitney et al., Nature Genet. 11, 341 (1995). 3. A. P. Cuthbert et al., Cytogenet. Cell Genet. 71, 68 (1995). 4. C. Timmers, Mol. Cell 7, 241 (2001). 5. I. Garcia-Higuera et al., Mol. Cell 7, 249 (2001).




10 table S1. FA patients with Biallelic Mutations in BRCA2 Clinical history Cell line FA Subtype Assignment Age (sex) Abnormal Pigmentation Abnormal Thumb Bone Marrow Failure Chromosome Breakage Cancer Mutant Allele #1 (exon) BIC entry Mutant Allele #2 (exon) BIC entry HSC62 D1 30 yr old (M) IVS19-1 G to A (20) - IVS19-1 G to A (20) - EUFA423 D1 3 yr old (F) Brain tumor 7691 insat (15) insa (27) 4 HSC230 B 2 yr old (M) del AAAC (11) many A to T (27) many EUFA579 U/A* 2 yr old (F) AML 7235 G to A (13) TC to AG (11) 1 AP37P U/A* 2 yr old (M) AML 8415 G to T (18) C to A (20) 1 * U/A, unassigned FA subtype Family History of Cansanguinity Polymorphic STOP variant (ter3326) BIC, Breast Cancer Information Core (

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core DNA Sequencing Services Pre-Mixed o Provide template and primer, mixed into the same tube* Pre-Defined o Provide template and primer in separate tubes* Custom o Full-service for samples with unknown concentration

More information

HP22.1 Roth Random Primer Kit A für die RAPD-PCR

HP22.1 Roth Random Primer Kit A für die RAPD-PCR HP22.1 Roth Random Kit A für die RAPD-PCR Kit besteht aus 20 Einzelprimern, jeweils aufgeteilt auf 2 Reaktionsgefäße zu je 1,0 OD Achtung: Angaben beziehen sich jeweils auf ein Reaktionsgefäß! Sequenz

More information

(http://genomes.urv.es/caical) TUTORIAL. (July 2006)

(http://genomes.urv.es/caical) TUTORIAL. (July 2006) (http://genomes.urv.es/caical) TUTORIAL (July 2006) CAIcal manual 2 Table of contents Introduction... 3 Required inputs... 5 SECTION A Calculation of parameters... 8 SECTION B CAI calculation for FASTA

More information

TA PCR Cloning Kit. Product Name:

TA PCR Cloning Kit. Product Name: Product Name: Kit Component DynaExpress TA PCR Cloning Kit (ptac-2) Cat. # Product Size DS126 DynaExpress TA PCR Cloning Kit (ptac-2) 20 reactions Box 1 (-20 ) ptac-2 Vector, linearized 20 µl (50 ng/µl)

More information

To measure the expression and regulation of the srfa and myc operons, lacz-reporter gene

To measure the expression and regulation of the srfa and myc operons, lacz-reporter gene SUPPLEMENTAL MATERIAL 1 1 1 1 1 0 1 Construction of reporter gene fusions To measure the expression and regulation of the srfa and myc operons, lacz-reporter gene fusions were made. For this the plasmid

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

DNA and Protein Synthesis Grade 10

DNA and Protein Synthesis Grade 10 Ohio Standards Connection: Life Sciences Benchmark C Explain the genetic mechanisms and molecular basis of inheritance. Indicator 5 Illustrate the relationship of the structure and function of DNA to protein

More information

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21,

Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, Grundlagen der Bioinformatik, SS 08, D. Huson, April 21, 2008 7 2 Introduction to Molecular Biology We will start with a very short repetition of the basics of molecular biology, including a summary of

More information

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors.

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. Legends of supplemental figures and tables Figure 1: Overview of study design and results. (A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors. After raw data gene expression

More information

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C) TECHNICAL DATA SHEET BIOLUMINESCENCE RESONANCE ENERGY TRANSFER RENILLA LUCIFERASE FUSION PROTEIN EXPRESSION VECTOR Product: prluc-c Vectors Catalog number: Description: Amount: The prluc-c vectors contain

More information

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation BDGP Resources Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation For recovery of sequences flanking PZ, PlacW and PEP elements E. Jay Rehm Berkeley Drosophila Genome Project I.

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:

More information

DNA Sample preparation and Submission Guidelines

DNA Sample preparation and Submission Guidelines DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send

More information

Mutations and Genetic Variability. 1. What is occurring in the diagram below?

Mutations and Genetic Variability. 1. What is occurring in the diagram below? Mutations and Genetic Variability 1. What is occurring in the diagram below? A. Sister chromatids are separating. B. Alleles are independently assorting. C. Genes are replicating. D. Segments of DNA are

More information

Supplementary Online Material for Morris et al. sirna-induced transcriptional gene

Supplementary Online Material for Morris et al. sirna-induced transcriptional gene Supplementary Online Material for Morris et al. sirna-induced transcriptional gene silencing in human cells. Materials and Methods Lentiviral vector and sirnas. FIV vector pve-gfpwp was prepared as described

More information

Table S1. Related to Figure 4

Table S1. Related to Figure 4 Table S1. Related to Figure 4 Final Diagnosis Age PMD Control Control 61 15 Control 67 6 Control 68 10 Control 49 15 AR-PD PD 62 15 PD 65 4 PD 52 18 PD 68 10 AR-PD cingulate cortex used for immunoblot

More information

Molecular analyses of EGFR: mutation and amplification detection

Molecular analyses of EGFR: mutation and amplification detection Molecular analyses of EGFR: mutation and amplification detection Petra Nederlof, Moleculaire Pathologie NKI Amsterdam Henrique Ruijter, Ivon Tielen, Lucie Boerrigter, Aafke Ariaens Outline presentation

More information

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet 1 UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet Exam in: MBV4010 Arbeidsmetoder i molekylærbiologi og biokjemi I MBV4010 Methods in molecular biology and biochemistry I Day of exam:.

More information


SERVICES CATALOGUE WITH SUBMISSION GUIDELINES SERVICES CATALOGUE WITH SUBMISSION GUIDELINES 3921 Montgomery Road Cincinnati, Ohio 45212 513-841-2428 www.agctsequencing.com CONTENTS Welcome Dye Terminator Sequencing DNA Sequencing Services - Full Service

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing 38. Informationsgespräch der Blutspendezentralefür Wien, Niederösterreich und Burgenland Österreichisches Rotes Kreuz 22. November 2014, Parkhotel Schönbrunn Die Zukunft hat

More information

Beloit College BIOL Emerging Infectious Diseases

Beloit College BIOL Emerging Infectious Diseases Virus classification and life cycle activity For reference Transcription: Krasner p 131 Translation: Krasner p 132-135 Genetic code: Krasner p 135 A virus is an obligate intracellular parasite, meaning

More information


The p53 MUTATION HANDBOOK The p MUTATION HANDBOOK Version 1. /7 Thierry Soussi Christophe Béroud, Dalil Hamroun Jean Michel Rubio Nevado http://p/free.fr The p Mutation HandBook By T Soussi, J.M. Rubio-Nevado, D. Hamroun and C.

More information

FDC-Specific Functions of p55tnfr and IKK2

FDC-Specific Functions of p55tnfr and IKK2 Supplemental Data FDC-Specific Functions of p55tnfr and IKK2 in the Development of FDC Networks and of Antibody Responses Panayiotis Victoratos, Jacques Lagnel, Sotiria Tzima, Marat B. Alimzhanov, Klaus

More information

The effect of trna levels on decoding times of mrna codons Supplementary File

The effect of trna levels on decoding times of mrna codons Supplementary File The effect of trna levels on decoding times of mrna codons Supplementary File Authors: Alexandra Dana 1 and Tamir Tuller 1 *. 1 The Department of Biomedical Engineering, Tel-Aviv University, Tel-Aviv 69978,

More information

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204 Gene Synthesis 191 Mutagenesis 194 Gene Cloning 196 AccuGeneBlock Service 198 Gene Synthesis FAQs 201 User Protocol 204 Gene Synthesis Overview Gene synthesis is the most cost-effective way to enhance

More information

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1 Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation Beginning Perl, Chap 4 6 Example 1 #!/usr/bin/perl -w use strict; # version 1: my @nt = ('A', 'C', 'G', 'T'); for

More information

RT-PCR: Two-Step Protocol

RT-PCR: Two-Step Protocol RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed

More information

Laboratory diagnostic of Avian Influenza in the Caribbean

Laboratory diagnostic of Avian Influenza in the Caribbean Laboratory diagnostic of Avian Influenza in the Caribbean CIRAD, Guadeloupe CIRAD International Research Centre in Agricultural for Development Research, development, training Veterinary medicine and public

More information

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University

Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University Amira A. AL-Hosary PhD of infectious diseases Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine Assiut University Egypt Interpretation of sequence results An overview on

More information

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human Supplementary Information Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human vascular endothelial growth factor 165 revealed by biosensor based assays Yoichi Takakusagi

More information

Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project

Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project Protocol for recovery of sequences flanking insertions in the Drosophila Gene Disruption

More information



More information

Hands on Simulation of Mutation

Hands on Simulation of Mutation Hands on Simulation of Mutation Charlotte K. Omoto P.O. Box 644236 Washington State University Pullman, WA 99164-4236 omoto@wsu.edu ABSTRACT This exercise is a hands-on simulation of mutations and their

More information

Supporting information

Supporting information This journal is The Royal Society of Chemistry 213 New Platform for Convenient Genotyping System Keum-Soo Song, b Satish Balasaheb Nimse, a Junghoon Kim, b Danishmalik Rafiq Sayyed, a Taisun Kim* a a Institute

More information

Gene Finding CMSC 423

Gene Finding CMSC 423 Gene Finding CMSC 423 Finding Signals in DNA We just have a long string of A, C, G, Ts. How can we find the signals encoded in it? Suppose you encountered a language you didn t know. How would you decipher

More information

pcmv6-neo Vector Application Guide Contents

pcmv6-neo Vector Application Guide Contents pcmv6-neo Vector Application Guide Contents Package Contents and Storage Conditions... 2 Product Description... 2 Introduction... 2 Production and Quality Assurance... 2 Methods... 3 Other required reagents...

More information

Provisional inspection method of genetically modified flax (FP967)

Provisional inspection method of genetically modified flax (FP967) Provisional inspection method of genetically modified flax (FP967) The inspection target of this inspection method is flax grains. Extraction and purification of DNA is performed using an anion exchange

More information

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe

Codon usage bias is correlated with gene expression levels in the fission yeast Schizosaccharomyces pombe Codon usage bias is correlated with gene expression levels Blackwell Y Hiraoka usage Publishing et al. bias in fission Inc yeast in the fission yeast Schizosaccharomyces pombe Yasushi Hiraoka 1,2,3, *,

More information

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations

What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations What s the Point? --- Point, Frameshift, Inversion, & Deletion Mutations http://members.cox.net/amgough/mutation_chromosome_translocation.gif Introduction: In biology, mutations are changes to the base

More information

Supplementary Figure 1: Postive and negative control cell lines wers used as positive and negative controls for HPV16 (A,B) and HPV18 (C,D) PCR.

Supplementary Figure 1: Postive and negative control cell lines wers used as positive and negative controls for HPV16 (A,B) and HPV18 (C,D) PCR. Supplementary Figure 1: Postive and negative control cell lines wers used as positive and negative controls for HPV16 (A,B) and HPV18 (C,D) PCR. (A) (C) (B) (D) Supplementary Figure 2: Representative image

More information

NimbleGen SeqCap EZ Library SR User s Guide Version 3.0

NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 NimbleGen SeqCap EZ Library SR User s Guide Version 3.0 For life science research only. Not for use in diagnostic procedures. Copyright 2011 Roche NimbleGen, Inc. All Rights Reserved. Editions Version

More information

Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR. Protocol

Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR. Protocol Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR Protocol 31 January 2011 Joint Research Centre Institute for Health and Consumer Protection Molecular Biology and Genomics

More information

for Detection of Multiple Pathogens and William C. Reeves 1

for Detection of Multiple Pathogens and William C. Reeves 1 Bioelectronic DNA Detection of Human Papillomaviruses Using esensor : A Model System for Detection of Multiple Pathogens Suzanne D. Vernon 1 (svernon@cdc.gov), Daniel H. Farkas 2* (dfarkas@bcm.tmc.edu),

More information


TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR Page 1 of 5 Materials DNase digestion buffer [13 mm Tris-Cl, ph7,5 / 5 mm MgCl2 / 0,12 mm CaCl2] RSS plasmid ptr-uf11 SV40pA Forward primer (10µM) AGC AAT AGC ATC ACA AAT TTC ACA A SV40pA Reverse Primer

More information

TCB No May Technical Bulletin. GS FLX and GS Junior Systems. Short Fragment Removal for the Amplicon Library Preparation Procedure

TCB No May Technical Bulletin. GS FLX and GS Junior Systems. Short Fragment Removal for the Amplicon Library Preparation Procedure TCB No. 2011-007 May 2013 Technical Bulletin GS FLX and GS Junior Systems Short Fragment Removal for the Amplicon Library Preparation Procedure Introduction Some library preparation methods may result

More information

Analysis of BRCA1 and BRCA2 mutations in Brazilian breast cancer patients with positive family history

Analysis of BRCA1 and BRCA2 mutations in Brazilian breast cancer patients with positive family history ORIGINAL ARTICLE Rozany Mucha Dufloth Sílvia Carvalho Juliana Karina Heinrich Júlia Yoriko Shinzato César Cabello dos Santos Luiz Carlos Zeferino Fernando Schmitt Analysis of BRCA1 and BRCA2 mutations

More information

Title : Parallel DNA Synthesis : Two PCR product from one DNA template

Title : Parallel DNA Synthesis : Two PCR product from one DNA template Title : Parallel DNA Synthesis : Two PCR product from one DNA template Bhardwaj Vikash 1 and Sharma Kulbhushan 2 1 Email: vikashbhardwaj@ gmail.com 1 Current address: Government College Sector 14 Gurgaon,

More information

Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians

Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians Vol. 44 No. 3 SCIENCE IN CHINA (Series C) June 2001 Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians KE Yuehai ( `º) 1, SU Bing (3 Á) 1 3, XIAO Junhua

More information

3.5 Renibacterium salmoninarum (Bacterial Kidney Disease, BKD)

3.5 Renibacterium salmoninarum (Bacterial Kidney Disease, BKD) 3.5 Renibacterium salmoninarum (Bacterial Kidney Disease, BKD) - 1 R 3.5 Renibacterium salmoninarum (Bacterial Kidney Disease, BKD) enibacterium salmoninarum infections can occur at any life stage in salmonid

More information

Supplemental Data. Short Article. PPARγ Activation Primes Human Monocytes. into Alternative M2 Macrophages. with Anti-inflammatory Properties

Supplemental Data. Short Article. PPARγ Activation Primes Human Monocytes. into Alternative M2 Macrophages. with Anti-inflammatory Properties Cell Metabolism, Volume 6 Supplemental Data Short Article PPARγ Activation Primes Human Monocytes into Alternative M2 Macrophages with Anti-inflammatory Properties M. Amine Bouhlel, Bruno Derudas, Elena

More information

Blue Heron, Your Gene Synthesis Partner

Blue Heron, Your Gene Synthesis Partner Blue Heron, Your Gene Synthesis Partner You Design it We Build it Simple to Complex Sequences Codon Optimization Any species Variants Single or pooled clone libraries Antibody Affinity Optimization Whole

More information



More information

Heraeus Sepatech, Kendro Laboratory Products GmbH, Berlin. Becton Dickinson,Heidelberg. Biozym, Hessisch Oldendorf. Eppendorf, Hamburg

Heraeus Sepatech, Kendro Laboratory Products GmbH, Berlin. Becton Dickinson,Heidelberg. Biozym, Hessisch Oldendorf. Eppendorf, Hamburg 13 4. MATERIALS 4.1 Laboratory apparatus Biofuge A Centrifuge 5804R FACScan Gel electrophoresis chamber GPR Centrifuge Heraeus CO-AUTO-ZERO Light Cycler Microscope Motopipet Neubauer Cell Chamber PCR cycler

More information

Section 1 Workbook (unit 2) ANSWERS

Section 1 Workbook (unit 2) ANSWERS Section 1 Workbook (unit 2) ANSWERS Complete the following table: nucleotide DNA RN Name: B5. Describe DNA replication 1) Label each base given in the diagram below and describe the 4 primary characteristics

More information

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain?

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain? Networked Systems, COMPGZ01, 2012 Answer TWO questions from Part ONE on the answer booklet containing lined writing paper, and answer ALL questions in Part TWO on the multiple-choice question answer sheet.

More information

Taqman TCID50 for AAV Vector Infectious Titer Determination

Taqman TCID50 for AAV Vector Infectious Titer Determination Page 1 of 8 Purpose: To determine the concentration of infectious particles in an AAV vector sample. This process involves serial dilution of the vector in a TCID50 format and endpoint determination through

More information

Supporting Information. for. Formation of carbohydrate-functionalised. polystyrene and glass slides and their analysis by

Supporting Information. for. Formation of carbohydrate-functionalised. polystyrene and glass slides and their analysis by Supporting Information for Formation of carbohydrate-functionalised polystyrene and glass slides and their analysis by MALDI-TOF MS Martin J. Weissenborn 1, Johannes W. Wehner 2, Christopher J. Gray 1,

More information

Clayton B. Green, Xiaomin Zhao, Kathleen M. Yeater and Lois L. Hoyer INTRODUCTION

Clayton B. Green, Xiaomin Zhao, Kathleen M. Yeater and Lois L. Hoyer INTRODUCTION Microbiology (2005), 151, 1051 1060 DOI 10.1099/mic.0.27696-0 Construction and real-time RT-PCR validation of Candida albicans PALS-GFP reporter strains and their use in flow cytometry analysis of ALS

More information

APOT - Assay. Protocol for HPV16 and 18. Amplification of Papilloma Virus Oncogene Transcripts HPV. E6 E7 E1 Zelluläre DNA poly(a)

APOT - Assay. Protocol for HPV16 and 18. Amplification of Papilloma Virus Oncogene Transcripts HPV. E6 E7 E1 Zelluläre DNA poly(a) E5 E2 E1 APOT - Assay Amplification of Papilloma Virus Oncogene Transcripts URR E6 E7 L1 HPV L2 E4 E6 E7 E1 Zelluläre DNA poly(a) Protocol for HPV16 and 18 Brief summary of the APOT assay Fig.1A shows

More information

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein Assignment 3 Michele Owens Vocabulary Gene: A sequence of DNA that instructs a cell to produce a particular protein Promoter a control sequence near the start of a gene Coding sequence the sequence of

More information


ANALYSIS OF A CIRCULAR CODE MODEL ANALYSIS OF A CIRCULAR CODE MODEL Jérôme Lacan and Chrstan J. Mchel * Laboratore d Informatque de Franche-Comté UNIVERSITE DE FRANCHE-COMTE IUT de Belfort-Montbélard 4 Place Tharradn - BP 747 5 Montbélard

More information

Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae

Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae Journal of Cell and Molecular Research (2011) 3 (1), 1-11 Analysis of synonymous codon usage bias and nucleotide and amino acid composition in 13 species of Flaviviridae Fatemeh Moosavi 1, Hassan Mohabatkar

More information

9. Materials. 9.1 Chemicals Acetic Acid (glacial) Materials. 8-Aminoguanosine Ammonium Hydroxide Ammonium Persulfate.

9. Materials. 9.1 Chemicals Acetic Acid (glacial) Materials. 8-Aminoguanosine Ammonium Hydroxide Ammonium Persulfate. 9. Materials 9.1 Chemicals Acetic Acid (glacial) Acetone Acetonitrile Agarose 8-Aminoguanosine Ammonium Hydroxide Ammonium Persulfate Ampicillin ATP Bromophenol Blue Butanol Chloroform CTP 7-Deaza-GTP

More information

Chapter 9. Applications of probability. 9.1 The genetic code

Chapter 9. Applications of probability. 9.1 The genetic code Chapter 9 Applications of probability In this chapter we use the tools of elementary probability to investigate problems of several kinds. First, we study the language of life by focusing on the universal

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

Module 6: Digital DNA

Module 6: Digital DNA Module 6: Digital DNA Representation and processing of digital information in the form of DNA is essential to life in all organisms, no matter how large or tiny. Computing tools and computational thinking

More information

Gene Finding. Slides by Carl Kingsford

Gene Finding. Slides by Carl Kingsford Gene Finding Slides by Carl Kingsford Genome of the Cow a sequence of 2.86 billion letters enough letters to fill a million pages of a typical book. TATGGAGCCAGGTGCCTGGGGCAACAAGACTGTGGTCACTGAATTCATCCTTCTTGGTCTAACAGAGAACATAG

More information

Supporting Information

Supporting Information Supporting Information Wiley-VCH 2007 69451 Weinheim, Germany Evolving a Thermostable DNA polymerase that Accurately Amplifies Highly-Damaged Templates Christian Gloeckner, Katharina B. M. Sauter, and

More information

Significance of sarcomere gene mutation in patients with dilated cardiomyopathy

Significance of sarcomere gene mutation in patients with dilated cardiomyopathy Significance of sarcomere gene mutation in patients with dilated cardiomyopathy Y.D. Li 1 *, Y.T. Ji 1 *, X.H. Zhou 1, H.L. Li 2, H.T. Zhang 3, Y. Zhang 1, J.X. Li 1, Q. Xing 1, J.H. Zhang 1, Y.F. Hong

More information

I Lq A Simplified Procedure for Developing Multiplex PCRs

I Lq A Simplified Procedure for Developing Multiplex PCRs I Lq A Simplified Procedure for Developing Multiplex PCRs Anthony P. Shuber, 1 Valerie J. Grondin, and Katherine W. Klinger Department of Technology Development, Integrated Genetics, Inc., Framingham Massachusetts

More information

Solution Key Problem Set 3

Solution Key Problem Set 3 Solution Key- 7.016 Problem Set 3 Question 1 The following human pedigree shows the inheritance pattern of a specific disease within a family. Assume that the individuals marrying into the family for all

More information

In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA.

In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA. In this activity, students investigate the gene that codes for CFTR and explore the transcription and translation of DNA. For each student: Science notebook Reproducible Master 6, Cooking Up a Protein

More information

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets

http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets http://www.life.umd.edu/grad/mlfsc/ DNA Bracelets by Louise Brown Jasko John Anthony Campbell Jack Dennis Cassidy Michael Nickelsburg Stephen Prentis Rohm Objectives: 1) Using plastic beads, construct

More information

Five-minute cloning of Taq polymerase-amplified PCR products

Five-minute cloning of Taq polymerase-amplified PCR products TOPO TA Cloning Version R 8 April 2004 25-0184 TOPO TA Cloning Five-minute cloning of Taq polymerase-amplified PCR products Catalog nos. K4500-01, K4500-40, K4510-20, K4520-01, K4520-40, K4550-01, K4550-40,

More information

Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer

Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer Marine Biology DEC 2004; 146(1) : 53-64 http://dx.doi.org/10.1007/s00227-004-1423-6 Copyright 2004 Springer Archimer http://www.ifremer.fr/docelec/ Archive Institutionnelle de l Ifremer The original publication

More information

[ ] : MMP22,MMP29 TIMP21, TIMP22

[ ] : MMP22,MMP29 TIMP21, TIMP22 212 BULL HUNAN MED UNIV 2003,28 (3) MMP22,MMP29,TIMP21 TIMP22,,, (, 410011) [ ] : MMP22,MMP29 TIMP21, TIMP22 mrna : 56 MMP22 mrna, TIMP22 mrna ; MMP22,MMP29, TIMP21, TIMP22 : MMP22 mrna, TIMP22 mrna,mmp22,mmp29,timp21

More information

All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI_ NotI

All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI_ NotI 2. Primer Design 2.1 Multiple Cloning Sites All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI NotI XXX XXX GGA TCC CCG AAT

More information

Cloning, sequencing, and expression of H.a. YNRI and H.a. YNII, encoding nitrate and nitrite reductases in the yeast Hansenula anomala

Cloning, sequencing, and expression of H.a. YNRI and H.a. YNII, encoding nitrate and nitrite reductases in the yeast Hansenula anomala Cloning, sequencing, and expression of H.a. YNRI and H.a. YNII, encoding nitrate and nitrite reductases in the yeast Hansenula anomala -'Pablo García-Lugo 1t, Celedonio González l, Germán Perdomo l, Nélida

More information

Mutations & DNA Technology Worksheet

Mutations & DNA Technology Worksheet Mutations & DNA Technology Worksheet Name Section A: Mutations Mutations are changes in DNA. Somatic mutations occur in non-reproductive cells and won't be passed onto offspring. Mutations that occur in

More information

Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1

Woods Biol Hmwk DNA & Genetic Engineering (key) Pg. 1 Woods Biol Hmwk-6 10-1 DNA & Genetic Engineering (key) Pg. 1 NOTE: Unless otherwise indicated in the problem, DNA will be from the Template strand. Figure 1: Look carefully at Fig s 1 & 2 to determine

More information

2006 7.012 Problem Set 3 KEY

2006 7.012 Problem Set 3 KEY 2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each

More information

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità Identification and characterization of Verocytotoxin-producing Escherichia coli (VTEC) by Real Time PCR amplification of the main virulence genes and the genes associated with the serogroups mainly associated

More information

Event-specific Method for the Quantification of Soybean DAS by Real-time PCR. Validated Method

Event-specific Method for the Quantification of Soybean DAS by Real-time PCR. Validated Method EUROPEAN COMMISSION JOINT RESEARCH CENTRE Institute for Health and Consumer Protection Molecular Biology and Genomics Unit Event-specific Method for the Quantification of Soybean DAS-81419-2 by Real-time

More information



More information

Keywords: human papillomavirus, multiplex real-time PCR, genotyping, hybrid capture, cervical cytology

Keywords: human papillomavirus, multiplex real-time PCR, genotyping, hybrid capture, cervical cytology Establishment of an efficient multiplex real-time PCR assay for human papillomavirus genotyping in cervical cytology specimens: comparison with hybrid capture II J.-H. Lee*, N.-W. Lee, S.-W. Hong, Y.-S.

More information

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme. Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.

More information

4 General PCR Methods Page

4 General PCR Methods Page Table of Contents General PCR Methods Page PCR Protocol Selection Guide...65.1 Basic PCR... 66.1.1 Hot Start PCR - The new Standard... Reagents and Equipment Required... General Considerations

More information

were demonstrated to be, respectively, the catalytic and regulatory subunits of protein phosphatase 2A (PP2A) (29).

were demonstrated to be, respectively, the catalytic and regulatory subunits of protein phosphatase 2A (PP2A) (29). JOURNAL OF VIROLOGY, Feb. 1992, p. 886-893 0022-538X/92/020886-08$02.00/0 Copyright C) 1992, American Society for Microbiology Vol. 66, No. 2 The Third Subunit of Protein Phosphatase 2A (PP2A), a 55- Kilodalton

More information

Rapid, Sensitive, Type Specific PCR Detection of the E7. region of Human Papillomavirus Type 16 and 18 from

Rapid, Sensitive, Type Specific PCR Detection of the E7. region of Human Papillomavirus Type 16 and 18 from Rapid, Sensitive, Type Specific PCR Detection of the E7 region of Human Papillomavirus Type 16 and 18 from Paraffin Embedded Sections of Cervical Carcinoma Iana Lesnikova 1, Marianne Lidang 2 *, Steven

More information

DNA: Molecule of Life

DNA: Molecule of Life DNA: Molecule of Life History DNA Structure Protein Synthesis Gene Regulation History of DNA H I S T O By the 1940 s, scientists knew that chromosomes consisted of both DNA and protein but did not know

More information

Bio 102 Practice Problems Recombinant DNA and Biotechnology

Bio 102 Practice Problems Recombinant DNA and Biotechnology Bio 102 Practice Problems Recombinant DNA and Biotechnology Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which of the following DNA sequences could be the recognition site

More information

DNA pol RNA pol ARS trna Ribosome DNA mrna Protein Transcription Translation Replication A B Acceptor stem D-loop T C loop Anticodon loop Variable loop Relative trna gene copy number 0.0 0.2 0.4

More information

Aipotu Part III: Molecular Biology

Aipotu Part III: Molecular Biology Aipotu Part III: Molecular Biology Introduction: The Biological Phenomenon Under Study In this lab, you will continue to explore the biological mechanisms behind the expression of flower color in a hypothetical

More information

Drosophila NK-homeobox genes

Drosophila NK-homeobox genes Proc. Natl. Acad. Sci. USA Vol. 86, pp. 7716-7720, October 1989 Biochemistry Drosophila NK-homeobox genes (NK-1, NK-2,, and DNA clones/chromosome locations of genes) YONGSOK KIM AND MARSHALL NIRENBERG

More information

Characterization of cdna clones of the family of trypsin/a-amylase inhibitors (CM-proteins) in barley {Hordeum vulgare L.)

Characterization of cdna clones of the family of trypsin/a-amylase inhibitors (CM-proteins) in barley {Hordeum vulgare L.) Characterization of cdna clones of the family of trypsin/a-amylase inhibitors (CM-proteins) in barley {Hordeum vulgare L.) J. Paz-Ares, F. Ponz, P. Rodríguez-Palenzuela, A. Lázaro, C. Hernández-Lucas,

More information

Chapter 12 - DNA Technology

Chapter 12 - DNA Technology Bio 100 DNA Technology 1 Chapter 12 - DNA Technology Among bacteria, there are 3 mechanisms for transferring genes from one cell to another cell: transformation, transduction, and conjugation 1. Transformation

More information

Interleukin-4 Receptor Signal Transduction: Involvement of P62

Interleukin-4 Receptor Signal Transduction: Involvement of P62 Interleukin-4 Receptor Signal Transduction: Involvement of P62 Den Naturwissenschaftlichen Fakultäten der Friedrich Alexander Universität Erlangen Nürnberg zur Erlangung des Doktorgrades vorgelegt von

More information

Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541

Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 PRODUCT INFORMATION Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541 Lot _ Store at -20 C Expiry Date _ www.thermoscientific.com/onebio CERTIFICATE OF ANALYSIS The Phusion Site-Directed Mutagenesis

More information

Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases

Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases Dissertation der Mathematisch-Naturwissenschaftlichen Fakultät der Eberhard Karls Universität

More information

Directed-Mutagenesis and Deletion Generated through an Improved Overlapping-Extension PCR Based Procedure

Directed-Mutagenesis and Deletion Generated through an Improved Overlapping-Extension PCR Based Procedure Research Article Directed-Mutagenesis and Deletion Generated through an Improved Overlapping-Extension PCR Based Procedure Wirojne Kanoksilapatham 1*, Juan M. González 2 and Frank T. Robb 3 1 Department

More information