Hierarchical Bayesian Modeling of the HIV Response to Therapy

Size: px
Start display at page:

Download "Hierarchical Bayesian Modeling of the HIV Response to Therapy"

Transcription

1 Hierarchical Bayesian Modeling of the HIV Response to Therapy Shane T. Jensen Department of Statistics, The Wharton School, University of Pennsylvania March 23, 2010 Joint Work with Alex Braunstein and Jon McAuliffe

2 Therapy: Disrupting the HIV infection cycle Drugs are a popular medical strategies for keep viral load down by disrupting infection cycle of HIV Drug therapies: drugs designed to bind to surface of HIV and prevent it from attaching to target cells We will model a promising new type of treatment Antisense gene therapy: allow HIV to bind to target cell and release viral RNA, but then attack viral RNA directly before it can be integrated into target cell genome HIV will try to evolve (change either protein or RNA) to escape this therapy

3 Drug Therapy versus Gene Therapy Illustration +',-$%&"'()*$!"#"$%&"'()*$ HIV Drug Therapy HIV Virion HIV viral RNA HIV Gene Therapy cytosol nucleus

4 Mutation and Recombination Primary mechanisms for evolution: Mutation: change of identity of a single RNA nucleotide. Can also delete nucleotides Recombination: two viral RNA sequences are spliced to produce a hybrid sequence.!"#$"#"%!"#$"#"%!"$$"#"%!"$$"#"% HIV has one of the highest rates of mutation/recombination of any organism ever seen

5 Population Genetics Due to high mutation and recombination rates, individuals infected with HIV can have several distinct HIV strains Need to model HIV as a population of sequences, not a specific sequence, that evolves in response to therapy

6 Issues with Evolutionary Response Goal is to model the evolutionary response (through mutation and recombination) of HIV to therapy Three crucial components of problem must be addressed: Mutation vs. recombination Rates for both processes of sequence change must be modeled simultaneously Spatial heterogeneity Therapies target specific regions of HIV genome and so evolution could also be in specific locations Two sample comparison Real interest is differences in mutation and recombination rates between treatment and control sequences

7 Overview of our Approach The coalescent with recombination: a population genetics model we build upon to model mutation and recombination rates for a population of sequences We expand previous coalescent-based approaches to allow changes at nucleotide level (instead of protein level) Blocking structure for mutation and recombination rates Allows for spatial heterogeneity while still sharing information between neighboring sequence regions Hierarchical prior distribution handles two sample structure Allows for differential treatment effect while pooling information between treatment and control sequences

8 Notation Data are aligned nucleotide sequences H = (H C, H T ) H C = (h C 1,..., hc n ) are control sequences of length L H T = (h T 1,..., ht m) are treatment sequences of length L Parameters of interest are Θ = (ρ C, ρ T, µ C, µ T ) ρ are recombination rates (treatment and control) µ are mutation rates (treatment and control) All rates also vary spatially along length of sequences Ancestry G relates all sequences to each other Need model that relates data H to unknowns G and Θ

9 Coalescent model for sequence history G Coalescent: sequences coalesce into common lineages back to their most recent common ancestor '()(*+,-)".3$" '()(*+,-)".3#" '()(*+,-)".3!" '()(*+,-)"."/01**().2"!" #" $" %" &" Mutation rates µ easy to build into coalescent model G Recombination can also be included in coalescent G

10 Estimation with Coalescent Sequence ancestry G is not of direct interest: goal is mutation and recombination rates Θ Maximum likelihood estimation sup Θ,G p(h Θ, G) or integration over all possible ancestries G p(h Θ) = G p(h Θ, G) p(g) are both very difficult tasks given the large space of G Even for a relatively small number of sequences, such as 100, the space of possible G is huge.

11 Product of Approximate Conditionals Marginal likelihood p(h Θ) intractable over all G PAC (Product of approximate conditionals) likelihood p(h Θ) = p(h 1 Θ) p(h 2 h 1, Θ)p(h 3 h 2, h 1, Θ) ˆp(h 1 Θ) ˆp(h 2 h 1, Θ)ˆp(h 3 h 2, h 1, Θ) Approximate sequence h k+1 as a mosaic of sequences (h 1,..., h k ) generated by a hidden Markov model ˆp(h k+1 h 1:k, Θ) calculated using forward summing algorithm for HMMs. Depends on ordering of sequences so average calculation over several different orderings

12 Structure on Mutation and Recombination PAC likelihood allows us to more easily integrate out ancestry G so we can focus on modeling of parameters Θ Θ includes mutation rates µ and recombination rates ρ Now need additional structure in our model to address: Spatial heterogeneity: different rates for mutation and recombination in different sequence regions Two-samples comparison: want to estimate differential rates between treatment vs. control populations Should allow us to estimate differential evolution response to therapy

13 Hierarchical Blocking Structure Hierarchical prior on mutation µ and recombination ρ Rates vary along sequence in piece-wise constant way e.g. B µ contiguous blocks (µ 1,..., µ Bµ ) of mutation rates Treatment µ T j vs. control µ C j vary around block-specific µ j

14 Blocking Structure Example Grand central mutation and recombination rates (gray) Central mutation/recombination rate for each block (blue) Treatment and control rates around central rate (black)

15 Model Implementation PAC likelihood ˆp(H Θ) gives sequences H as function of mutation and recombination rates Θ Hierarchical prior distribution P(Θ) for spatial heterogeneity and two sample comparison Focus on posterior distribution for inference: p(θ H) ˆp(H Θ) p(θ) MCMC implementation: Gibbs and Metropolis-Hastings moves for most parameters as well as reversible jump moves for the blocking structure

16 MCMC moves 1 Reversible jump moves for blocking structure: 1 Choose block uniformly to split or merge with a neighbor 2 Move block boundary to the left or right 2 Gibbs moves for rate parameters 1 Sample treatment vs control rates (µ T j, µ C j ) for each block 2 Sample central mutation rate µ j for each block 3 Sample grand central mutation rate µ 0 4 Sample variance of treatment and control mutation rates σ 2 µ 5 Sample variance of central mutation rates σ 2 µ 0 3 Same set of blocking and rate moves for recombination 4 MH move for transition/transversion ratio κ

17 Application to Antisense Gene Therapy VIRxSYS gene therapy: data generated in vitro from a sample of wt-hiv that were exposed to VIRxSYS gene therapy and a control sample Focus on treatment effects: differential mutation rate µ T µ C and recombination rate ρ T ρ C for each location along the sequence

18 Mutation Treatment Effect of Antisense Gene Therapy The large increase in mutation overlaps with the antisense target region. Increases in mutation to the left of antisense target region are consistent with other gene therapy studies.

19 Recombination Treatment Effect of Antisense Gene Therapy The area of decreased recombination corresponds to the area of increased mutation, but it is not significant. Wide posterior intervals in part because recombination does not seem to have a strong spatial signal

20 Simpler Approaches for Mutation Simplest approach would just be to examine mutation directly through segregating sites Segregating sites are nucleotide locations where at least one sequence in the sample differs from the others. A!GATTACA!CAT!ATTACC A!GATTACA!CAT!ATTGCC A!GATTACA!CAT!ATTACC A!GACTACAGCAT!ATTACC A!GATTACA!CAT!ATTAAC

21 Comparison to Segregating Sites Compare segregating sites (blue = treatment, red = control) to posterior differential mutation rate µ T µ C Higher density of segregating sites around elevated mutation area, but our model allows sharing of information between closely located sites

22 Summary Our sophisticated model allows us to measure viral evolutionary change through spatially-varying recombination and mutation at the nucleotide level. Our model measures pairwise differences in mutation and recombination between treatment and control groups, allowing estimation of spatially varying treatment effects. Our methodology able to detect biologically relevant signal in two HIV applications: Identified drug-resistant mutations in Enfuvirtide drug therapy Detect elevated mutation rates that overlap with antisense target in VIRxSYS gene therapy

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Bayesian coalescent inference of population size history

Bayesian coalescent inference of population size history Bayesian coalescent inference of population size history Alexei Drummond University of Auckland Workshop on Population and Speciation Genomics, 2016 1st February 2016 1 / 39 BEAST tutorials Population

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

Statistics Graduate Courses

Statistics Graduate Courses Statistics Graduate Courses STAT 7002--Topics in Statistics-Biological/Physical/Mathematics (cr.arr.).organized study of selected topics. Subjects and earnable credit may vary from semester to semester.

More information

Methods for big data in medical genomics

Methods for big data in medical genomics Methods for big data in medical genomics Parallel Hidden Markov Models in Population Genetics Chris Holmes, (Peter Kecskemethy & Chris Gamble) Department of Statistics and, Nuffield Department of Medicine

More information

Protein Protein Interaction Networks

Protein Protein Interaction Networks Functional Pattern Mining from Genome Scale Protein Protein Interaction Networks Young-Rae Cho, Ph.D. Assistant Professor Department of Computer Science Baylor University it My Definition of Bioinformatics

More information

A Bootstrap Metropolis-Hastings Algorithm for Bayesian Analysis of Big Data

A Bootstrap Metropolis-Hastings Algorithm for Bayesian Analysis of Big Data A Bootstrap Metropolis-Hastings Algorithm for Bayesian Analysis of Big Data Faming Liang University of Florida August 9, 2015 Abstract MCMC methods have proven to be a very powerful tool for analyzing

More information

To be able to describe polypeptide synthesis including transcription and splicing

To be able to describe polypeptide synthesis including transcription and splicing Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain

More information

Comparative genomic hybridization Because arrays are more than just a tool for expression analysis

Comparative genomic hybridization Because arrays are more than just a tool for expression analysis Microarray Data Analysis Workshop MedVetNet Workshop, DTU 2008 Comparative genomic hybridization Because arrays are more than just a tool for expression analysis Carsten Friis ( with several slides from

More information

Master's projects at ITMO University. Daniil Chivilikhin PhD Student @ ITMO University

Master's projects at ITMO University. Daniil Chivilikhin PhD Student @ ITMO University Master's projects at ITMO University Daniil Chivilikhin PhD Student @ ITMO University General information Guidance from our lab's researchers Publishable results 2 Research areas Research at ITMO Evolutionary

More information

A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML

A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML 9 June 2011 A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML by Jun Inoue, Mario dos Reis, and Ziheng Yang In this tutorial we will analyze

More information

Lecture/Recitation Topic SMA 5303 L1 Sampling and statistical distributions

Lecture/Recitation Topic SMA 5303 L1 Sampling and statistical distributions SMA 50: Statistical Learning and Data Mining in Bioinformatics (also listed as 5.077: Statistical Learning and Data Mining ()) Spring Term (Feb May 200) Faculty: Professor Roy Welsch Wed 0 Feb 7:00-8:0

More information

Bayesian Phylogeny and Measures of Branch Support

Bayesian Phylogeny and Measures of Branch Support Bayesian Phylogeny and Measures of Branch Support Bayesian Statistics Imagine we have a bag containing 100 dice of which we know that 90 are fair and 10 are biased. The

More information

Structure and Function of DNA

Structure and Function of DNA Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

BASIC STATISTICAL METHODS FOR GENOMIC DATA ANALYSIS

BASIC STATISTICAL METHODS FOR GENOMIC DATA ANALYSIS BASIC STATISTICAL METHODS FOR GENOMIC DATA ANALYSIS SEEMA JAGGI Indian Agricultural Statistics Research Institute Library Avenue, New Delhi-110 012 seema@iasri.res.in Genomics A genome is an organism s

More information

Tutorial on Markov Chain Monte Carlo

Tutorial on Markov Chain Monte Carlo Tutorial on Markov Chain Monte Carlo Kenneth M. Hanson Los Alamos National Laboratory Presented at the 29 th International Workshop on Bayesian Inference and Maximum Entropy Methods in Science and Technology,

More information

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org

PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,

More information

Gaussian Processes to Speed up Hamiltonian Monte Carlo

Gaussian Processes to Speed up Hamiltonian Monte Carlo Gaussian Processes to Speed up Hamiltonian Monte Carlo Matthieu Lê Murray, Iain http://videolectures.net/mlss09uk_murray_mcmc/ Rasmussen, Carl Edward. "Gaussian processes to speed up hybrid Monte Carlo

More information

Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling

Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material

More information

Imperfect Debugging in Software Reliability

Imperfect Debugging in Software Reliability Imperfect Debugging in Software Reliability Tevfik Aktekin and Toros Caglar University of New Hampshire Peter T. Paul College of Business and Economics Department of Decision Sciences and United Health

More information

MUTATION, DNA REPAIR AND CANCER

MUTATION, DNA REPAIR AND CANCER MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful

More information

Bayesian Statistics in One Hour. Patrick Lam

Bayesian Statistics in One Hour. Patrick Lam Bayesian Statistics in One Hour Patrick Lam Outline Introduction Bayesian Models Applications Missing Data Hierarchical Models Outline Introduction Bayesian Models Applications Missing Data Hierarchical

More information

Probabilistic Models for Big Data. Alex Davies and Roger Frigola University of Cambridge 13th February 2014

Probabilistic Models for Big Data. Alex Davies and Roger Frigola University of Cambridge 13th February 2014 Probabilistic Models for Big Data Alex Davies and Roger Frigola University of Cambridge 13th February 2014 The State of Big Data Why probabilistic models for Big Data? 1. If you don t have to worry about

More information

Christfried Webers. Canberra February June 2015

Christfried Webers. Canberra February June 2015 c Statistical Group and College of Engineering and Computer Science Canberra February June (Many figures from C. M. Bishop, "Pattern Recognition and ") 1of 829 c Part VIII Linear Classification 2 Logistic

More information

Final Project Report

Final Project Report CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes

More information

Gene Therapy and Genetic Counseling. Chapter 20

Gene Therapy and Genetic Counseling. Chapter 20 Gene Therapy and Genetic Counseling Chapter 20 What is Gene Therapy? Treating a disease by replacing, manipulating or supplementing a gene The act of changing an individual s DNA sequence to fix a non-functional

More information

The world of non-coding RNA. Espen Enerly

The world of non-coding RNA. Espen Enerly The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often

More information

In developmental genomic regulatory interactions among genes, encoding transcription factors

In developmental genomic regulatory interactions among genes, encoding transcription factors JOURNAL OF COMPUTATIONAL BIOLOGY Volume 20, Number 6, 2013 # Mary Ann Liebert, Inc. Pp. 419 423 DOI: 10.1089/cmb.2012.0297 Research Articles A New Software Package for Predictive Gene Regulatory Network

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office

More information

Human Genome and Human Genome Project. Louxin Zhang

Human Genome and Human Genome Project. Louxin Zhang Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular

More information

Pairwise Sequence Alignment

Pairwise Sequence Alignment Pairwise Sequence Alignment carolin.kosiol@vetmeduni.ac.at SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold

More information

Bayesian Hidden Markov Models for Alcoholism Treatment Tria

Bayesian Hidden Markov Models for Alcoholism Treatment Tria Bayesian Hidden Markov Models for Alcoholism Treatment Trial Data May 12, 2008 Co-Authors Dylan Small, Statistics Department, UPenn Kevin Lynch, Treatment Research Center, Upenn Steve Maisto, Psychology

More information

Approximating the Coalescent with Recombination. Niall Cardin Corpus Christi College, University of Oxford April 2, 2007

Approximating the Coalescent with Recombination. Niall Cardin Corpus Christi College, University of Oxford April 2, 2007 Approximating the Coalescent with Recombination A Thesis submitted for the Degree of Doctor of Philosophy Niall Cardin Corpus Christi College, University of Oxford April 2, 2007 Approximating the Coalescent

More information

2011.008a-cB. Code assigned:

2011.008a-cB. Code assigned: This form should be used for all taxonomic proposals. Please complete all those modules that are applicable (and then delete the unwanted sections). For guidance, see the notes written in blue and the

More information

Finding Clusters in Phylogenetic Trees: A Special Type of Cluster Analysis

Finding Clusters in Phylogenetic Trees: A Special Type of Cluster Analysis Finding lusters in Phylogenetic Trees: Special Type of luster nalysis Why try to identify clusters in phylogenetic trees? xample: origin of HIV. NUMR: Why are there so many distinct clusters? LUR04-7 SYNHRONY:

More information

Genetic modification for cell pedigree labels to aid disease treatment

Genetic modification for cell pedigree labels to aid disease treatment Genetic modification for cell pedigree labels to aid disease treatment Ronald L. Rivest rivest@mit.edu March 10, 2014 Abstract We suggest modifying the human genome in order to aid in the treatment of

More information

bitter is de pil Linos Vandekerckhove, MD, PhD

bitter is de pil Linos Vandekerckhove, MD, PhD 4//24 Current HIV care HIV copies/ ml plasma Viral load Welcome to the Digital droplet PCR age! bitter is de pil Linos Vandekerckhove, MD, PhD Latent HIV reservoir Time at Ghent University Hospital 2 HIV

More information

AP Biology Essential Knowledge Student Diagnostic

AP Biology Essential Knowledge Student Diagnostic AP Biology Essential Knowledge Student Diagnostic Background The Essential Knowledge statements provided in the AP Biology Curriculum Framework are scientific claims describing phenomenon occurring in

More information

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

Various Viral Vectors Necessary for Gene Therapy Delivery Systems. Abstract

Various Viral Vectors Necessary for Gene Therapy Delivery Systems. Abstract Patibandla 1 Yamini Patibandla Dr. Rance LeFebvre COSMOS UC Davis Cluster 7 29 July 2013 Various Viral Vectors Necessary for Gene Therapy Delivery Systems Abstract A leading movement in today s times,

More information

HUMAN GENETIC TESTING PATENTS : ELIGIBILITY AND ENFORCEMENT

HUMAN GENETIC TESTING PATENTS : ELIGIBILITY AND ENFORCEMENT HUMAN GENETIC TESTING PATENTS : ELIGIBILITY AND ENFORCEMENT FRENCH APPROACH DENISE HIRSCH HEAD OF IP THE ENVIRONNENT Patentability of living organism was a public debate in France focusing on ethical issues

More information

Bioinformatics Grid - Enabled Tools For Biologists.

Bioinformatics Grid - Enabled Tools For Biologists. Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis

More information

Introduction to Genome Annotation

Introduction to Genome Annotation Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT

More information

Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations

Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations Heuristics for the Sorting by Length-Weighted Inversions Problem on Signed Permutations AlCoB 2014 First International Conference on Algorithms for Computational Biology Thiago da Silva Arruda Institute

More information

More details on the inputs, functionality, and output can be found below.

More details on the inputs, functionality, and output can be found below. Overview: The SMEEACT (Software for More Efficient, Ethical, and Affordable Clinical Trials) web interface (http://research.mdacc.tmc.edu/smeeactweb) implements a single analysis of a two-armed trial comparing

More information

Inference on Phase-type Models via MCMC

Inference on Phase-type Models via MCMC Inference on Phase-type Models via MCMC with application to networks of repairable redundant systems Louis JM Aslett and Simon P Wilson Trinity College Dublin 28 th June 202 Toy Example : Redundant Repairable

More information

Lesson 3 Reading Material: Oncogenes and Tumor Suppressor Genes

Lesson 3 Reading Material: Oncogenes and Tumor Suppressor Genes Lesson 3 Reading Material: Oncogenes and Tumor Suppressor Genes Becoming a cancer cell isn t easy One of the fundamental molecular characteristics of cancer is that it does not develop all at once, but

More information

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino

More information

MAKING AN EVOLUTIONARY TREE

MAKING AN EVOLUTIONARY TREE Student manual MAKING AN EVOLUTIONARY TREE THEORY The relationship between different species can be derived from different information sources. The connection between species may turn out by similarities

More information

Innovations in Molecular Epidemiology

Innovations in Molecular Epidemiology Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

Mitochondrial DNA Analysis

Mitochondrial DNA Analysis Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)

More information

Modeling the Distribution of Environmental Radon Levels in Iowa: Combining Multiple Sources of Spatially Misaligned Data

Modeling the Distribution of Environmental Radon Levels in Iowa: Combining Multiple Sources of Spatially Misaligned Data Modeling the Distribution of Environmental Radon Levels in Iowa: Combining Multiple Sources of Spatially Misaligned Data Brian J. Smith, Ph.D. The University of Iowa Joint Statistical Meetings August 10,

More information

Systems Biology through Data Analysis and Simulation

Systems Biology through Data Analysis and Simulation Biomolecular Networks Initiative Systems Biology through Data Analysis and Simulation William Cannon Computational Biosciences 5/30/03 Cellular Dynamics Microbial Cell Dynamics Data Mining Nitrate NARX

More information

Functional Data Analysis of MALDI TOF Protein Spectra

Functional Data Analysis of MALDI TOF Protein Spectra Functional Data Analysis of MALDI TOF Protein Spectra Dean Billheimer dean.billheimer@vanderbilt.edu. Department of Biostatistics Vanderbilt University Vanderbilt Ingram Cancer Center FDA for MALDI TOF

More information

Localised Sex, Contingency and Mutator Genes. Bacterial Genetics as a Metaphor for Computing Systems

Localised Sex, Contingency and Mutator Genes. Bacterial Genetics as a Metaphor for Computing Systems Localised Sex, Contingency and Mutator Genes Bacterial Genetics as a Metaphor for Computing Systems Outline Living Systems as metaphors Evolutionary mechanisms Mutation Sex and Localized sex Contingent

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

Microarray Technology

Microarray Technology Microarrays And Functional Genomics CPSC265 Matt Hudson Microarray Technology Relatively young technology Usually used like a Northern blot can determine the amount of mrna for a particular gene Except

More information

The Basics of Graphical Models

The Basics of Graphical Models The Basics of Graphical Models David M. Blei Columbia University October 3, 2015 Introduction These notes follow Chapter 2 of An Introduction to Probabilistic Graphical Models by Michael Jordan. Many figures

More information

http://www.univcan.ca/programs-services/international-programs/canadianqueen-elizabeth-ii-diamond-jubilee-scholarships/

http://www.univcan.ca/programs-services/international-programs/canadianqueen-elizabeth-ii-diamond-jubilee-scholarships/ QUANTITATIVE BIOLOGY AND MEDICAL GENETICS FOR THE WORLD PROGRAM ANNOUNCEMENT The "Quantitative Biology and Medical Genetics for the World" program at McGill is offering a number of prestigious Queen Elizabeth

More information

Centre for Central Banking Studies

Centre for Central Banking Studies Centre for Central Banking Studies Technical Handbook No. 4 Applied Bayesian econometrics for central bankers Andrew Blake and Haroon Mumtaz CCBS Technical Handbook No. 4 Applied Bayesian econometrics

More information

Biological Sciences Initiative. Human Genome

Biological Sciences Initiative. Human Genome Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.

More information

Genetics Lecture Notes 7.03 2005. Lectures 1 2

Genetics Lecture Notes 7.03 2005. Lectures 1 2 Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several

More information

Markov Chain Monte Carlo Simulation Made Simple

Markov Chain Monte Carlo Simulation Made Simple Markov Chain Monte Carlo Simulation Made Simple Alastair Smith Department of Politics New York University April2,2003 1 Markov Chain Monte Carlo (MCMC) simualtion is a powerful technique to perform numerical

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

Activity 7.21 Transcription factors

Activity 7.21 Transcription factors Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

Bayesian Statistical Analysis in Medical Research

Bayesian Statistical Analysis in Medical Research Bayesian Statistical Analysis in Medical Research David Draper Department of Applied Mathematics and Statistics University of California, Santa Cruz draper@ams.ucsc.edu www.ams.ucsc.edu/ draper ROLE Steering

More information

Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment

Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's dilemma To understand... Multiple sequence alignment Substitution matrices Phylogenetic trees You first need

More information

SYMPOSIUM. June 15, 2013. Photonics Center Colloquium Room (906) 8 Saint Mary's St., Boston, MA 02215 Boston University

SYMPOSIUM. June 15, 2013. Photonics Center Colloquium Room (906) 8 Saint Mary's St., Boston, MA 02215 Boston University SYMPOSIUM June 15, 2013 Photonics Center Colloquium Room (906) 8 Saint Mary's St., Boston, MA 02215 Bette Korber Los Alamos National Labs HIV evolution and the neutralizing antibody response We have recently

More information

Basics of Statistical Machine Learning

Basics of Statistical Machine Learning CS761 Spring 2013 Advanced Machine Learning Basics of Statistical Machine Learning Lecturer: Xiaojin Zhu jerryzhu@cs.wisc.edu Modern machine learning is rooted in statistics. You will find many familiar

More information

1. Introduction Gene regulation Genomics and genome analyses Hidden markov model (HMM)

1. Introduction Gene regulation Genomics and genome analyses Hidden markov model (HMM) 1. Introduction Gene regulation Genomics and genome analyses Hidden markov model (HMM) 2. Gene regulation tools and methods Regulatory sequences and motif discovery TF binding sites, microrna target prediction

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

Hidden Markov Models

Hidden Markov Models 8.47 Introduction to omputational Molecular Biology Lecture 7: November 4, 2004 Scribe: Han-Pang hiu Lecturer: Ross Lippert Editor: Russ ox Hidden Markov Models The G island phenomenon The nucleotide frequencies

More information

Computational Statistics for Big Data

Computational Statistics for Big Data Lancaster University Computational Statistics for Big Data Author: 1 Supervisors: Paul Fearnhead 1 Emily Fox 2 1 Lancaster University 2 The University of Washington September 1, 2015 Abstract The amount

More information

Section 5. Stan for Big Data. Bob Carpenter. Columbia University

Section 5. Stan for Big Data. Bob Carpenter. Columbia University Section 5. Stan for Big Data Bob Carpenter Columbia University Part I Overview Scaling and Evaluation data size (bytes) 1e18 1e15 1e12 1e9 1e6 Big Model and Big Data approach state of the art big model

More information

DNA Sequence Alignment Analysis

DNA Sequence Alignment Analysis Analysis of DNA sequence data p. 1 Analysis of DNA sequence data using MEGA and DNAsp. Analysis of two genes from the X and Y chromosomes of plant species from the genus Silene The first two computer classes

More information

The Proportional Odds Model for Assessing Rater Agreement with Multiple Modalities

The Proportional Odds Model for Assessing Rater Agreement with Multiple Modalities The Proportional Odds Model for Assessing Rater Agreement with Multiple Modalities Elizabeth Garrett-Mayer, PhD Assistant Professor Sidney Kimmel Comprehensive Cancer Center Johns Hopkins University 1

More information

PS 271B: Quantitative Methods II. Lecture Notes

PS 271B: Quantitative Methods II. Lecture Notes PS 271B: Quantitative Methods II Lecture Notes Langche Zeng zeng@ucsd.edu The Empirical Research Process; Fundamental Methodological Issues 2 Theory; Data; Models/model selection; Estimation; Inference.

More information

HENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT

HENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT HENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT Kimberly Bishop Lilly 1,2, Truong Luu 1,2, Regina Cer 1,2, and LT Vishwesh Mokashi 1 1 Naval Medical Research Center, NMRC Frederick, 8400 Research Plaza,

More information

Genomes and SNPs in Malaria and Sickle Cell Anemia

Genomes and SNPs in Malaria and Sickle Cell Anemia Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing

More information

1 Prior Probability and Posterior Probability

1 Prior Probability and Posterior Probability Math 541: Statistical Theory II Bayesian Approach to Parameter Estimation Lecturer: Songfeng Zheng 1 Prior Probability and Posterior Probability Consider now a problem of statistical inference in which

More information

RNA and Protein Synthesis

RNA and Protein Synthesis Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic

More information

DnaSP, DNA polymorphism analyses by the coalescent and other methods.

DnaSP, DNA polymorphism analyses by the coalescent and other methods. DnaSP, DNA polymorphism analyses by the coalescent and other methods. Author affiliation: Julio Rozas 1, *, Juan C. Sánchez-DelBarrio 2,3, Xavier Messeguer 2 and Ricardo Rozas 1 1 Departament de Genètica,

More information

Bayesian Analysis for the Social Sciences

Bayesian Analysis for the Social Sciences Bayesian Analysis for the Social Sciences Simon Jackman Stanford University http://jackman.stanford.edu/bass November 9, 2012 Simon Jackman (Stanford) Bayesian Analysis for the Social Sciences November

More information

Statistical mechanics for real biological networks

Statistical mechanics for real biological networks Statistical mechanics for real biological networks William Bialek Joseph Henry Laboratories of Physics, and Lewis-Sigler Institute for Integrative Genomics Princeton University Initiative for the Theoretical

More information

A HYBRID GENETIC ALGORITHM FOR THE MAXIMUM LIKELIHOOD ESTIMATION OF MODELS WITH MULTIPLE EQUILIBRIA: A FIRST REPORT

A HYBRID GENETIC ALGORITHM FOR THE MAXIMUM LIKELIHOOD ESTIMATION OF MODELS WITH MULTIPLE EQUILIBRIA: A FIRST REPORT New Mathematics and Natural Computation Vol. 1, No. 2 (2005) 295 303 c World Scientific Publishing Company A HYBRID GENETIC ALGORITHM FOR THE MAXIMUM LIKELIHOOD ESTIMATION OF MODELS WITH MULTIPLE EQUILIBRIA:

More information

Environmental Remote Sensing GEOG 2021

Environmental Remote Sensing GEOG 2021 Environmental Remote Sensing GEOG 2021 Lecture 4 Image classification 2 Purpose categorising data data abstraction / simplification data interpretation mapping for land cover mapping use land cover class

More information

Immunology Ambassador Guide (updated 2014)

Immunology Ambassador Guide (updated 2014) Immunology Ambassador Guide (updated 2014) Immunity and Disease We will talk today about the immune system and how it protects us from disease. Also, we ll learn some unique ways that our immune system

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium

More information

Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS

Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS Lab 2/Phylogenetics/September 16, 2002 1 Read: Tudge Chapter 2 PHYLOGENETICS Objective of the Lab: To understand how DNA and protein sequence information can be used to make comparisons and assess evolutionary

More information

Principles of Evolution - Origin of Species

Principles of Evolution - Origin of Species Theories of Organic Evolution X Multiple Centers of Creation (de Buffon) developed the concept of "centers of creation throughout the world organisms had arisen, which other species had evolved from X

More information

BayesX - Software for Bayesian Inference in Structured Additive Regression

BayesX - Software for Bayesian Inference in Structured Additive Regression BayesX - Software for Bayesian Inference in Structured Additive Regression Thomas Kneib Faculty of Mathematics and Economics, University of Ulm Department of Statistics, Ludwig-Maximilians-University Munich

More information