Article Review. DNA-methylation effect on co-transcriptional splicing is dependent on GC-architecture of the exon-intron structure
|
|
- Carmel Fitzgerald
- 7 years ago
- Views:
Transcription
1 Article Review DNA-methylation effect on co-transcriptional splicing is dependent on GC-architecture of the exon-intron structure 15 March 2013 Genome Research 1
2 Article Genome Research, 15 March 2013, pre-print Publication in 6 months Sahar Gelfman, Noa Cohen, Ahuvi Yearim and Gil Ast Department of Human Molecular Genetics & Biochemistry, Sackler Faculty of Medicine, Tel-Aviv University, Israel 2
3 Field of interest Methylation influence on exons recognition and splicing mechanism. 3
4 Quality Pluses: Field overview Lots of references to related works, data sets Minuses: Not well-written Results aren t clear Only average effect was considered Observes correlation but doesn t explain it 4
5 Already known Splicing is co-trascriptional introns removed while transcript is attached to the DNA by RNA pol II GC content Increased in exons mcg/cg level in exons higher than in introns (Schwartz 2009) The level of mcg/cg decreases with increasing GC levels (..) DNA-methylation Affects transcription Strong exon-boundaries marker (Lauren 2010) Possible splicing regulator (Lauren 2010) Depletion of mc in Hox genes --> removing pol II stalling and facilitating transcriptional elongation and efficient splicing (Tao et al. 2010) 5
6 Background Article: Lister et al. (2009) revealed that there is a higher level of CpG-methylation on exons than on flanking introns. However, this difference was dissolved when values were divided by cytosine composition, since exons have a higher GC content, on average, than their flanking introns (Schwartz et al. 2009) Mean mc/c Profiles Over Genomic Regions. Gene body regions were divided in 20 bins from 5' to 3' end, and the mean mc/c level within each bin for each methylation type was determined (mcg/cg black, mchg/chg red, CHH/CHH blue). (Lister et al. (2009)) 6
7 Already known Nucleosome occupancy Increased along exons (Schwartz et al. 2009) Strongly biased towards high GC content (..) Positioning of nucleosomes Partially determined by the DNA sequence and GC content (..) Chromatin remodelers changes positioning (..) DNA-methylation - chromatin remodeler: rigid nucleosomal conformation binding of methyl-binding proteins (MBPs) Nucleosome - roadblock for polii (polii pauses, unwind DNA, release nucleosome, transcription elongation) (..) Transcriptional pausing may allow co-transcriptional recognition of splicing signals in the pre-mrna (de la Mata et al. 2003). 2 models: Intron recognition, Exon recognition (Amit et al. 2012) 7
8 Hypothesis Change in nucleosome occupancy that accompanies DNA methylation might have an indirect influence on pol II elongation rate and co-transcriptional splicing. RNA PolII pauses at splice sites and let other factors (probably methylation binding proteins) to recognize splice site and take decision to do alternative splicing or not. 8
9 Main Question 1. Could the roles of epigenetic modifications in splicing be a side effect of the GC content of the exons? 2. How could one isolate the measured levels of DNA-methylation and nucleosome occupancy on exons, and conclude a biological role unbiased by GC-content? 9
10 Exons groups Exons by GC content architecture 1. Differential GC - significantly higher GC in exons than flanking introns (p-value < 0.05) 2. Leveled GC - same GC level Exons by Splicing behaviour Alternative - optional included in gene mrnas Constitutive - always in included in gene mrnas 10
11 Agenda Investigations Role of mcg as exons bounds marker Role of mcg in exons recognition and inclusion in mrna Influence of CG dinucleotide on chromatine organization (nucleosome positioning) Role of GC content in exons recognition and chromatin organization Article results Article Bottle necks 11
12 mcg As Exons Marker Differential exons exon based splicing recognition 15,874 exons (RefSeq,? by Amit 2012) Leveled exons intron based splicing recognition 16,269 exons (RefSeq,? by Amit 2012) H1 cells, Salk methylome data (Lister 2009) GC content ATTGGGGCAC - 60% GC content, 0% CG ACGCCAATCG - 60% GC content, 40% CG mcg/cg avg. methylation level per base for each group = (sum of methylation level at each pos) / (exons number with CG in this position) [discussion:?] 12
13 mcg As Exons Marker mcg/cg significantly high in exons vs introns, both groups (p-value < 2.2 x ) intron vs. exons mcg/cg methylation level increase: +6% - differential exons +30% - leveled exons!!!! 13
14 mcg As Exons Marker Basic DNA methylation level by base calls ([?:mc/c]) - strong exons signal CG abundance - strong exons signal in agreement with already know CG di-nucleotide abundance works (Karlin 1995, Gentles 2001) 14
15 mcg As Exons Marker RRBS (reduced representation bisulfite sequencing) - most loci and CpG-rich promoters regions; approx. 5% CpG Mouse - RRBS data exons - nearly same results, noise!!! 15
16 mcg As Exons Marker Different tissues: show nearly same pattern 16
17 mcg As Exons Marker Nucleosome occupancy on exons vs flanking introns (Amit et al. 2012): differential exons : 50% increase leveled exons: 10% increase Although nucleosomes occupancy differs both have strong methylation signal on exons. Group weakly marked by nucleosomes is more significantly marked by methylated CpG 17
18 mc For Exon Recognition mcg/cg level in alternatively and constitutively spliced exons examined to evaluate DNA methylation role in recognition Exons splicing types (alt/const) obtained from RNA-Seq (H1 cellline) SpliceTrap tool - For every exon it quantifies the extent to which it is included, skipped or subjected to size variations due to alternative 3 / 5 splice sites or Intron Retention. In addition, SpliceTrap can quantify alternative splicing within a single cellular condition, with no need of a background set of reads. SpliceTrap approaches the expression-level estimation of each exon as an independent Bayesian inference problem exons with canonical splicing differential exons : 7413 (5734 const, 1679 alternative) leveled exons: 6037 (4936 const, 1101 alternative) 18
19 mc For Exon Recognition exon-intron CG structure as expected in constitutive/alternative exons groups 19
20 mc For Exon Recognition mcg/cg general signal pattern same for differential & leveled GC constitutive exons (multiple t-test, p-value < 2.2x10-16 ) mcg/cg lower in alternative vs. constitutive exons (multiple t-test, p-value < 2.2x10-16 ) 20
21 mc For Exon Recognition Nucleosome occupancy signal Differential GC exons - strong Leveled GC exons - weak 21
22 CG & Chromatine Structure High mcg/cg level was observed near 3, 5 splice sites Does presence of CG dinucleotide in splice signal consensus lead to high mcg/cg? Control dataset pseudo exons (Ke et al. 2011): Pseudo exons - intronic sequences having lengths between 50 and 250 nt and splice site motif score close to splice sites scores In addition, pseudo exons had to be at least 100 nt away from the closest real exon Pseudo exons not biased to any GC differential in exons vs introns 22
23 CG & Chromatine Structure Pseudo exons not biased to any GC differential in exons vs introns 23
24 CpG & Chromatine CG abundance higher in lev., diff. but same in pseudo exons CG high increased (mc in 70% of cases) -> 3 : -5; 5 : -2, +4 3 peaks positions may have a regulatory role. 24
25 CpG & Chromatine Peaks role as chromatin remodelers? Was shown that certain DNA sequences with high affinity binding to the histone can direct nucleosome positioning (Lowary and Widom 1998) DNA methylation may have an intrinsic effect on nucleosome positioning on the DNA (Chodavarapu et al. 2010; Cedar and Bergman 2012) No method found for single by methylation & chromatin organization quantification. CD4+ T cells nucleosomes data (Schones et al. 2008).[discussion:] running average, on 20 nt window 25
26 CpG & Chromatine Methylated CG: ES cells % CG methylated (Lister 2009) [JetBioLabs: 74-87%] 70-88% CG in differentiated & leveled GC groups methylated (Fig.1) => CG dinucleotide acts as representative of methylated position. [discussion:!!!] 70-88% is mlevel of CG-not same %CG methylated Exons sub groups based on mc peak positions CG composition group: CG at the peak position GC composition group: C G, but not GC at the peak position not-c composition group: other nucleotides ( i.e AA,AT,AC,AG..) AG composition group (not-c sub-group): AG at peak position GC group - control for CG group (same GC content) AG group for 5 : -2 position 26
27 CpG & Chromatine Leveled exons - increased nucleosome occupancy when Any of the 3 peak positions is a CG in the group Near 3 peak positions for CG compared to others (multiple t-tests, p-value < ) other positions - trend of increased nucleosome occupancy when a CG is present but the effect is smaller that at the peak. 27
28 CpG & Chromatine Differential exons - less nucleosome occupancy Depleted signal when -5 at 3 site is CG comparing with GC (p-value < 0.006) Small increase for -2 (p-value < ) and +4 (p-value < 0.043) at 5 site other positions - increasing occupancy not observed, occupancy is not significantly affected by dinucleotide composition near the splice site. 28
29 CpG & Chromatine Question: Does CG peaks express some special GC-content signal? CG at 3 peak positions doesn t significantly affect GC content of any sub-group Cannot explain strong nucleosome occupancy signal of CG group in leveled exons 29
30 CpG & Chromatine 3 CG peaks detected close to splicing sites CG at peaks are frequently methylated => Probably directs nucleosomes binding mediated by MBP (methylation binding proteins) Nucleosomal signal Differential CG group - weak CG peaks effect Leveled CG group - strong CG peaks nucleosomal signal => Exons recognition mechanism may depend on the GC environment of exon/gene/location (will be in further works) 30
31 GC Content Role Perhaps difference in epigentic pattern is chromosomes specific due to different GC content? Are Exon-intron patterns (Fig 1,2) dependent on GC content? Isochore maps (Costantini et al. 2006) Isochore maps - regions >= 300 K bases with homogeneous GC content. Core (GC > 46%) and Desert (GC < 46%) parts 31
32 GC Content Role Leveled & Differential group not equally distributed along genome Differential - more in lower GC chromosomes Leveled - in high GC chromosomes 32
33 GC Content Role Exons H1 were divided in core (53 102) and desert (85 979) exons exons RNA-seq data contains only => alt. and const. exons were considered as EST-based (expressed sequence tag) 33
34 GC Content Role Methylation is strong exons marker for both core and desert exons 34
35 GC Content Role Methylated CG level drops (desert & core groups) in alternative exons vs. const. exons Mean mcg level increase for const. vs. alt exons groups core exons +24% mcg level (6 443 of ) desert exons +19% mcg level (9 649 of alt.) 35
36 GC Content Role Nucleosomes occupancy low GC regions: often on exons than introns high GC regions: spread along both exons and introns 36
37 Results Alternative Constitutive Differential Leveled GC content Nucleosomes occupancy n/a n/a high exons marking weak exons marking but CG-related signal presence at 3 positions GC-content dependent Methylation Lower mcpg level on alternative comparing to const. spliced exons Clear marking; Stronger signal on leveled exons; Intronic mc reduction near splice sites. Exons marking GC content independent 37
38 Results GC content bias elimination - Leveled & Diff exons Group weakly marked by nucleosomes is more significantly marked by methylated CpG In a Leveled GC architecture methylated CpGs accompanied higher inclusion of exons, i.e. exons are recognized and aren t removed by splicing. Not the absolute methylation value that distinguishes const. vs alt. exons, but the differential in the ratio of mcpg/cpg between exon and introns, which is also dependent in the general GC environment Supports for the role of DNA methylation as a splicing regulator 38
39 Discussion =?=> CpG methylation can be a part of the code that allows the splicing machinery to locate exons that have no GC differential. Identified a strong decrease in methylated CpGs in alternative exons and their flanking sequences compared with constitutive exons =?=> lower DNA methylation levels of the whole intron-exon-intron strip are associated with suboptimal recognition of alternatively spliced exons Effect on splicing of a strong DNA methylation signal in a leveled GCarchitecture may be indirectly through pol II stalling ( =?=> detected peak in CG abundance) =?=> peaks in CpG methylation at the 5 and 3 splice sites act as the central area binding for the nucleosomal splicing barrier, while the drop in methylated CpGs in intronic flanking regions of leveled GC exons point to the entry/exit regions of the nucleosome. 39
40 Article bottle necks Only CG methylation in ES cells considered, much reasonable to check CG methylation in differentiated cells mcg/cg average methylation level is a vague characteristics. It shows methylation variability at position among different cells in passage. More over Lister (2009) showed that there are large PMM domains in DNA. Seems mcg/cg signal in all cases was induced by higher CG density and signal Nucleosomes binding isn t clear, Chip-Seq based methods provides positions with precision about +/ bp Authors replace mcg with just CG presence in exons. Such trick seemed to be incorrect. Hard to interpret trends in average for a particular exon. 40
41 Tel-Aviv University Differential & Leveled GC content, short/long introns. 2 splicing models (intron/exon recognition). (Amit et al. 2012) Chromatin organization role in splicing (Schwartz et al. 2009) 41
EPIGENETICS DNA and Histone Model
EPIGENETICS ABSTRACT A 3-D cut-and-paste model depicting how histone, acetyl and methyl molecules control access to DNA and affect gene expression. LOGISTICS TIME REQUIRED LEARNING OBJECTIVES DNA is coiled
More informationDiscovery & Modeling of Genomic Regulatory Networks with Big Data
Discovery & Modeling of Genomic Regulatory Networks with Big Data Hamid Bolouri Division of Human Biology Fred Hutchinson Cancer Research Center labs.fhcrc.org/bolouri I have no financial relationships
More informationIntroduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director
Introduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director Gene expression depends upon multiple factors Gene Transcription
More informationIntroduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
More informationProtein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
More informationGENE REGULATION. Teacher Packet
AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures
More informationControl of Gene Expression
Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure
More informationControl of Gene Expression
Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems
More informationHow Sequencing Experiments Fail
How Sequencing Experiments Fail v1.0 Simon Andrews simon.andrews@babraham.ac.uk Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine
More informationCore Facility Genomics
Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray
More informationSchool of Nursing. Presented by Yvette Conley, PhD
Presented by Yvette Conley, PhD What we will cover during this webcast: Briefly discuss the approaches introduced in the paper: Genome Sequencing Genome Wide Association Studies Epigenomics Gene Expression
More informationDNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
More informationShouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center
Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing
More informationStandards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium
Standards, Guidelines and Best Practices for RNA-Seq V1.0 (June 2011) The ENCODE Consortium I. Introduction: Sequence based assays of transcriptomes (RNA-seq) are in wide use because of their favorable
More informationBiological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
More informationModule 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
More informationThe Nucleus: DNA, Chromatin And Chromosomes
The Nucleus: DNA, Chromatin And Chromosomes Professor Alfred Cuschieri Department of Anatomy, University of Malta. Objectives By the end of this unit the student should be able to: 1. List the major structural
More informationFrequently Asked Questions Next Generation Sequencing
Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided
More informationAP BIOLOGY 2009 SCORING GUIDELINES
AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following
More informationLecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
More informationGenetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
More informationA Brief Introduction on DNase-Seq Data Aanalysis
A Brief Introduction on DNase-Seq Data Aanalysis Hashem Koohy, Thomas Down, Mikhail Spivakov and Tim Hubbard Spivakov s and Fraser s Lab September 13, 2014 1 Introduction DNaseI is an enzyme which cuts
More informationExpression Quantification (I)
Expression Quantification (I) Mario Fasold, LIFE, IZBI Sequencing Technology One Illumina HiSeq 2000 run produces 2 times (paired-end) ca. 1,2 Billion reads ca. 120 GB FASTQ file RNA-seq protocol Task
More informationAnalysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics
Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics Christopher Benner, PhD Director, Integrative Genomics and Bioinformatics Core (IGC) idash Webinar,
More informationComparing Methods for Identifying Transcription Factor Target Genes
Comparing Methods for Identifying Transcription Factor Target Genes Alena van Bömmel (R 3.3.73) Matthew Huska (R 3.3.18) Max Planck Institute for Molecular Genetics Folie 1 Transcriptional Regulation TF
More informationComputational localization of promoters and transcription start sites in mammalian genomes
Computational localization of promoters and transcription start sites in mammalian genomes Thomas Down This dissertation is submitted for the degree of Doctor of Philosophy Wellcome Trust Sanger Institute
More informationHuman Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
More informationBioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
More informationTo be able to describe polypeptide synthesis including transcription and splicing
Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain
More informationOverview of Eukaryotic Gene Prediction
Overview of Eukaryotic Gene Prediction CBB 231 / COMPSCI 261 W.H. Majoros What is DNA? Nucleus Chromosome Telomere Centromere Cell Telomere base pairs histones DNA (double helix) DNA is a Double Helix
More informationTranscription in prokaryotes. Elongation and termination
Transcription in prokaryotes Elongation and termination After initiation the σ factor leaves the scene. Core polymerase is conducting the elongation of the chain. The core polymerase contains main nucleotide
More informationAppendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
More informationHow To Understand How Gene Expression Is Regulated
What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation
More informationAlgorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
More informationMORPHEUS. http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix.
MORPHEUS http://biodev.cea.fr/morpheus/ Prediction of Transcription Factors Binding Sites based on Position Weight Matrix. Reference: MORPHEUS, a Webtool for Transcripton Factor Binding Analysis Using
More informationHow many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
More informationPrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene
More informationThe world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
More information2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
More informationINTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
More informationChallenges associated with analysis and storage of NGS data
Challenges associated with analysis and storage of NGS data Gabriella Rustici Research and training coordinator Functional Genomics Group gabry@ebi.ac.uk Next-generation sequencing Next-generation sequencing
More informationDiscovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat
Bioinformatique et Séquençage Haut Débit, Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat 1 RNA Transcription to RNA and subsequent
More informationLecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression
More informationSystematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh
More informationReplication Study Guide
Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have
More informationSystems Biology through Data Analysis and Simulation
Biomolecular Networks Initiative Systems Biology through Data Analysis and Simulation William Cannon Computational Biosciences 5/30/03 Cellular Dynamics Microbial Cell Dynamics Data Mining Nitrate NARX
More informationIntroduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
More informationInteraktionen von Nukleinsäuren und Proteinen
Sonja Prohaska Computational EvoDevo Universitaet Leipzig June 9, 2015 DNA is never naked in a cell DNA is usually in association with proteins. In all domains of life there are small, basic chromosomal
More informationNext Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took
More informationLezioni Dipartimento di Oncologia Farmacologia Molecolare. RNA interference. Giovanna Damia 29 maggio 2006
Lezioni Dipartimento di Oncologia Farmacologia Molecolare RNA interference Giovanna Damia 29 maggio 2006 RNA INTERFERENCE Sequence-specific gene suppression by dsrnas Gene silencing by dsrna: C. elegans
More informationGenomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
More informationName Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
More informationChapter 5: Organization and Expression of Immunoglobulin Genes
Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed
More informationTranscription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
More informationLinking the Epigenome to the Genome: Correlation of Different Features to DNA Methylation of CpG Islands
Linking the Epigenome to the Genome: Correlation of Different Features to DNA Methylation of CpG Islands Clemens Wrzodek*, Finja Büchel, Georg Hinselmann, Johannes Eichner, Florian Mittag, Andreas Zell
More informationFlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript
More informationRNAseq / ChipSeq / Methylseq and personalized genomics
RNAseq / ChipSeq / Methylseq and personalized genomics 7711 Lecture Subhajyo) De, PhD Division of Biomedical Informa)cs and Personalized Biomedicine, Department of Medicine University of Colorado School
More information13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
More informationNext Generation Sequencing: Adjusting to Big Data. Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013
Next Generation Sequencing: Adjusting to Big Data Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa 29.10.2013 Outline Human Genome Project Next-Generation Sequencing Personalized Medicine
More informationAntibody Structure, and the Generation of B-cell Diversity CHAPTER 4 04/05/15. Different Immunoglobulins
Antibody Structure, and the Generation of B-cell Diversity B cells recognize their antigen without needing an antigen presenting cell CHAPTER 4 Structure of Immunoglobulin G Different Immunoglobulins Differences
More informationGene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
More informationRETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
More informationDNA and the Cell. Version 2.3. English version. ELLS European Learning Laboratory for the Life Sciences
DNA and the Cell Anastasios Koutsos Alexandra Manaia Julia Willingale-Theune Version 2.3 English version ELLS European Learning Laboratory for the Life Sciences Anastasios Koutsos, Alexandra Manaia and
More informationReduced Representation Bisulfite-Seq A Brief Guide to RRBS
April 17, 2013 Reduced Representation Bisulfite-Seq A Brief Guide to RRBS What is RRBS? Typically, RRBS samples are generated by digesting genomic DNA with the restriction endonuclease MspI. This is followed
More informationRT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial
RT 2 Profiler PCR Array: Web-Based Data Analysis Tutorial Samuel J. Rulli, Jr., Ph.D. qpcr-applications Scientist Samuel.Rulli@QIAGEN.com Pathway Focused Research from Sample Prep to Data Analysis! -2-
More informationControl of Gene Expression
Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
More informationSpecial report. Chronic Lymphocytic Leukemia (CLL) Genomic Biology 3020 April 20, 2006
Special report Chronic Lymphocytic Leukemia (CLL) Genomic Biology 3020 April 20, 2006 Gene And Protein The gene that causes the mutation is CCND1 and the protein NP_444284 The mutation deals with the cell
More informationNew Technologies for Sensitive, Low-Input RNA-Seq. Clontech Laboratories, Inc.
New Technologies for Sensitive, Low-Input RNA-Seq Clontech Laboratories, Inc. Outline Introduction Single-Cell-Capable mrna-seq Using SMART Technology SMARTer Ultra Low RNA Kit for the Fluidigm C 1 System
More informationGenome-wide measurements of protein-dna interaction by chromatin immunoprecipitation
Genome-wide measurements of protein-dna interaction by chromatin immunoprecipitation D. Puthier. laboratoire INSERM, Aix-Marseille Université, TAGC/INSERM U928, Parc Scientifique de Luminy case 928 Outline
More informationStructure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
More informationGenetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
More informationPREDA S4-classes. Francesco Ferrari October 13, 2015
PREDA S4-classes Francesco Ferrari October 13, 2015 Abstract This document provides a description of custom S4 classes used to manage data structures for PREDA: an R package for Position RElated Data Analysis.
More informationLectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling
Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material
More informationCONTRACTING ORGANIZATION: University of Alabama at Birmingham Birmingham, AL 35294
AD Award Number: W81XWH-08-1-0030 TITLE: Regulation of Prostate Cancer Bone Metastasis by DKK1 PRINCIPAL INVESTIGATOR: Gregory A. Clines, M.D., Ph.D. CONTRACTING ORGANIZATION: University of Alabama at
More informationRNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
More informationGene Expression Analysis
Gene Expression Analysis Jie Peng Department of Statistics University of California, Davis May 2012 RNA expression technologies High-throughput technologies to measure the expression levels of thousands
More informationUnderstanding West Nile Virus Infection
Understanding West Nile Virus Infection The QIAGEN Bioinformatics Solution: Biomedical Genomics Workbench (BXWB) + Ingenuity Pathway Analysis (IPA) Functional Genomics & Predictive Medicine, May 21-22,
More informationCentral Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription
Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional
More informationEuropean Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
More informationCurrent Motif Discovery Tools and their Limitations
Current Motif Discovery Tools and their Limitations Philipp Bucher SIB / CIG Workshop 3 October 2006 Trendy Concepts and Hypotheses Transcription regulatory elements act in a context-dependent manner.
More informationHuman-Mouse Synteny in Functional Genomics Experiment
Human-Mouse Synteny in Functional Genomics Experiment Ksenia Krasheninnikova University of the Russian Academy of Sciences, JetBrains krasheninnikova@gmail.com September 18, 2012 Ksenia Krasheninnikova
More informationPreciseTM Whitepaper
Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis
More information1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
More informationHierarchical Bayesian Modeling of the HIV Response to Therapy
Hierarchical Bayesian Modeling of the HIV Response to Therapy Shane T. Jensen Department of Statistics, The Wharton School, University of Pennsylvania March 23, 2010 Joint Work with Alex Braunstein and
More informationThe Making of the Fittest: Evolving Switches, Evolving Bodies
OVERVIEW MODELING THE REGULATORY SWITCHES OF THE PITX1 GENE IN STICKLEBACK FISH This hands-on activity supports the short film, The Making of the Fittest:, and aims to help students understand eukaryotic
More informationSample Questions for Exam 3
Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.
More informationGraphical Modeling for Genomic Data
Graphical Modeling for Genomic Data Carel F.W. Peeters cf.peeters@vumc.nl Joint work with: Wessel N. van Wieringen Mark A. van de Wiel Molecular Biostatistics Unit Dept. of Epidemiology & Biostatistics
More informationPrimePCR Assay Validation Report
Gene Information Gene Name sorbin and SH3 domain containing 2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SORBS2 Human Arg and c-abl represent the mammalian
More informationTranscription: RNA Synthesis, Processing & Modification
Transcription: RNA Synthesis, Processing & Modification 1 Central dogma DNA RNA Protein Reverse transcription 2 Transcription The process of making RNA from DNA Produces all type of RNA mrna, trna, rrna,
More informationDNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
More informationMeDIP-chip service report
MeDIP-chip service report Wednesday, 20 August, 2008 Sample source: Cells from University of *** Customer: ****** Organization: University of *** Contents of this service report General information and
More informationBBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS
BBSRC TECHNOLOGY STRATEGY: TECHNOLOGIES NEEDED BY RESEARCH KNOWLEDGE PROVIDERS 1. The Technology Strategy sets out six areas where technological developments are required to push the frontiers of knowledge
More informationTranslation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
More informationFinal Project Report
CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes
More informationName Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
More informationPlant Growth & Development. Growth Stages. Differences in the Developmental Mechanisms of Plants and Animals. Development
Plant Growth & Development Plant body is unable to move. To survive and grow, plants must be able to alter its growth, development and physiology. Plants are able to produce complex, yet variable forms
More informationQuantitative proteomics background
Proteomics data analysis seminar Quantitative proteomics and transcriptomics of anaerobic and aerobic yeast cultures reveals post transcriptional regulation of key cellular processes de Groot, M., Daran
More informationFaculty of Medicine. Settore disciplinare: BIO/10. functional domains. Monica Soldi. IFOM-IEO Campus, Milan. Matricola n. R08407
PhD degree in Molecular Medicine European School of Molecular Medicine (SEMM), University of Milan and University of Naples Federico II Faculty of Medicine Settore disciplinare: BIO/10 Establishment and
More informationSearching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
More information