MRC-Holland MLPA. Description version 24;

Size: px
Start display at page:

Download "MRC-Holland MLPA. Description version 24; 23-11-2011"

Transcription

1 SALSA MS-MLPA probemix ME030-C1 BWS/RSS Lot C As compared to version B2 (lots B2-0309, B & B2-1110), three probes for H19 and two for KCNQ1 have been replaced. One H19 has been removed and one CDKN1C probe added. For the NSD1 gene involved in Sotos syndrome, two probes have been included. Finally, several reference probes, the digestion control probe, and the 88 and 96 nt denaturation control fragments, have been replaced. Beckwith-Wiedemann syndrome (BWS) is a clinically heterogeneous overgrowth syndrome associated with an increased risk for embryonal tumour development. Russell-Silver syndrome (RSS) is a genetically heterogeneous disorder involving both intra-uterine and post-natal growth-retardation. The incidence of both BWS and RSS is estimated to be approximately 1 in 10,000-15,000 and around 85% of the cases are sporadic. These conditions are both caused by a genetic or an epigenetic alteration within two domains of imprinted growth regulatory genes on chromosome 11p15, leading to deregulated expression of the imprinted genes within this region. Approximately 60-70% of the patients have imprinting abnormalities at one of two imprinted domains H19DMR or KvDMR, and these changes are frequently mosaic. Other causes of BWS and RSS are uniparental disomy (UPD), trisomy 11p15 (1%), mutations in the CDKN1C gene (10%), as well as small deletions and translocations. This SALSA MS- BWS/RSS ME030-C1 probemix is capable of rapidly detecting most causes of BWS and RSS, as both copy numbers and methylation status of the 11p15 region can be determined. This MS- MLPA assay for BWS/RSS can also be useful for screening of childhood cancers, in particular Wilms tumour. A strong linkage between methylation of the H19DMR locus, but not KvDMR, has been described in these patients resulting in biallelic expression of the IGF2 gene. Because of similarities between BWS and Sotos syndrome 2 probes for NSD1 have been added. The ME030-C1 probemix contains 26 probes specific for the BWS/RSS 11p15 region. Eleven of these probes contain a HhaI recognition site and provide information about the methylation status of the target sequence. Besides the detection of aberrant methylation, all 26 probes present will give information on copy number changes in the analyzed sample. 2 probes are added in the NSD1 region which is associated with Sotos syndrome, a disease that share a similar phenotype. In addition, 13 reference probes are present which detect genes located outside the BWS/RSS region. Finally, one digestion control probe is included. This is a probe which contains a HhaI recognition site that is unmethylated in most blood derived control DNA samples. Therefore, this probe does not generate a signal after HhaI digestion in normal controls and can be used to confirm complete digestion by the HhaI enzyme. This SALSA MS- probemix can be used to detect aberrant methylation of one or more sequences of the KvDMR and H19DMR domains in the 11p15 BWS/RS region. Methylation levels can be different for different tissues. Please use DNA derived from the same type of tissue and purified by the same method as reference sample. This SALSA probemix can also be used to detect deletions/duplications of one or more sequences in the 11p15 region in a DNA sample. Heterozygous deletions of recognition sequences should give a 35-50% reduced relative peak area of the amplification product of that probe. Note that a mutation or polymorphism in the sequence detected by a probe can also cause a reduction in relative peak area, even when not located exactly on the ligation site! In addition, some probe signals are more sensitive to sample purity and small changes in experimental conditions. Therefore, deletions and duplications detected by MLPA should always be confirmed by other methods. Not all deletions and duplications detected by MLPA will be pathogenic; users should always verify the latest scientific literature when interpreting their findings. Finally, note that many defects in these genes, such as small (point) mutations, will not be detected by this SALSA test. We have no information on what percentage of defects in these genes is caused by deletions/duplications of complete exons. SALSA MS- probemixes and reagents are sold by for research purposes and to demonstrate the possibilities of the MLPA technique. They are not CE/FDA certified for use in diagnostic procedures. Purchase of the SALSA MS- test probemixes and reagents includes a limited license to use these products for research purposes. The use of this SALSA MS- probemix and reagents requires a thermocycler with heated lid and sequence type electrophoresis equipment. Different fluorescent PCR primers are available. The MLPA SALSA probemix ME030-C1 BWS/RSS Page 1 of 8

2 technique has been first described in Nucleic Acid Research 30, e57 (2002). The MS-MLPA method for the detection of both copy numbers and methylation changes was described in Nucleic Acid Research 33, e128 by Nygren et al More information Website : info@mlpa.com (information & technical questions); order@mlpa.com (for orders) Mail : bv; Willem Schoutenstraat 6, 1057 DN Amsterdam, the Netherlands References of SALSA MS- probemix ME030 Scott RH et al. (2008) Methylation-specific MLPA (MS-MLPA) robustly detects and distinguishes 11p15 abnormalities associated with overgrowth and growth retardation. J Med Genet. 45: Priolo M et al. (2008). MS-MLPA is a specific and sensitive technique for detecting all chromosome imprinting defects of BWS and SRS in a single-tube experiment. Eur J Hum Genet. 16: Zeschnigk M. et al. (2008). IGF2/H19 hypomethylation in Silver-Russell syndrome and isolated hemihypoplasia. Eur J Hum Genet. 16: Figure 1. Scheme of the imprinted gene cluster on chromosome 11p15. Methylation-specific MLPA Please note that each MS-MLPA reaction generates two samples that need analysis by capillary electrophoresis: one undigested sample for copy number detection and one digested sample for methylation detection. A modification of the MLPA technique, MS-MLPA allows the detection of both copy number changes and unusual methylation levels of different sequences in one simple reaction. MLPA probes for methylation quantification are similar to normal MLPA probes, except that the sequence detected by the MS-MLPA probe contains the sequence recognized by the methylation-sensitive restriction enzyme HhaI. Similar to ordinary MLPA reactions, the MS-MLPA protocol starts with sample DNA denaturation and overnight hybridization. The reaction then is split into two tubes. One tube is processed as a standard MLPA reaction. This reaction provides information on copy number changes. The other tube of the MLPA hybridization reaction is incubated with the methylation-sensitive HhaI endonuclease while simultaneously, the hybridized probes are ligated. Hybrids of (unmethylated) probe oligonucleotides and unmethylated sample DNA are digested by the HhaI enzyme. Digested probes will not be exponentially amplified by PCR and hence will not generate a signal when analyzed by capillary electrophoresis. In contrast, if the sample DNA is methylated, the hemimethylated probe-sample DNA hybrids are prevented from being digested by HhaI and the ligated probes will generate a signal. More information about MS-MLPA can be found in the MS-MLPA protocol. Please note that this product cannot be used with an alternative protocol in which the genomic DNA is first digested with Hha1, followed by MLPA reactions on both digested and undigested genomic DNA. Digestion control probes Digestion control probes are unmethylated in most blood derived DNA samples. The signals of the digestion control probes should be gone upon complete digestion by HhaI. SALSA probemix ME030-C1 BWS/RSS Page 2 of 8

3 Data analysis The ME030-C1 BWS/RSS probemix contains 42 MLPA probes with amplification products between 129 and 463 nt. In addition, it contains 9 control fragments generating an amplification product smaller than 120 nt: four DNA Quantity fragments (Q-fragments) at nt, three DNA denaturation control fragments (D-fragments) at nt, one X-fragment at 100 nt and one Y-fragment at 105 nt. More information on how to interpret observations on these control fragments can be found in the MLPA protocol. The analysis of MS-MLPA probemixes consists of two parts: 1) determining copy numbers by comparing different undigested samples (all MLPA probemixes), and 2) determining methylation patterns by comparing each undigested sample to its digested counterpart (MS-MLPA probemixes only). The second part is unique for MS-MLPA probemixes and serves to semi-quantify the percentage of methylation within a given sample. Intra-sample data normalisation (all samples) For analysis of MLPA results, not the absolute fluorescence values but intra-normalized data are used (relative peak areas). The data generated in the digested and undigested sample should first be normalized intra-sample by dividing the signal of each probe by the signal of every reference probe in that sample, thus creating as many ratios per probe as there are reference probes. Subsequently, the median of all these produced ratios per probe should be taken; this is the probe s Normalisation Constant. This Normalization Constant can then be used for sample to reference sample comparison, both for copy number and digestion determination. Copy numbers determination (comparison between undigested samples) The final probe ratio, or ploidy status, of each probe in each sample is calculated by dividing a) the Normalization Constant of each probe obtained on the undigested patient sample by b) the average Normalization Constant of that probe obtained on the undigested reference samples. Methylation analysis (comparing digested and undigested samples) Methylation status of MS-MLPA probes* is calculated by dividing a) the Normalization Constant of each MS- MLPA probe obtained on the digested patient sample by b) the Normalization Constant of each MS-MLPA probe obtained on the corresponding undigested sample. Multiplying this value by 100 gives an estimation of the percentage methylation. Aberrant methylation can then be identified by comparing the methylation status of one or more MS-MLPA probes in the sample in question to that obtained on reference samples. *Note: An MS-MLPA probe targets a single specific HhaI site in a CpG island; an unusual methylation status for a particular CpG-site does not necessarily mean that the whole CpG island has an unusual methylation status! Data used for normalization should be obtained within a single experiment. Only samples purified by the same method should be compared. Confirmation of most exons deletions and amplifications can be done by e.g. Southern blots, long range PCR, FISH. H19 locus and KCNQ1OT1 locus The four MS-MLPA probes targeting the H19 gene and the four MS-MLPA probes targeting the KCNQ1OT1 locus, are located very close to each other within each locus. It is expected that all MS-MLPA probes per locus provide similar results. We recommend using the average, or the median, methylation status of these probes to determine to methylation status of the loci and to disregard aberrant methylation detected by a single MS-MLPA probe. Note that Coffalyser, the MLPA analysis tool developed at, can be downloaded free of charge from our website Info/remarks/suggestions for improvement: info@mlpa.com. SALSA probemix ME030-C1 BWS/RSS Page 3 of 8

4 Table 1. SALSA MS-MLPA ME030-C1 BWS/RSS probemix Length (nt) SALSA MLPA probe Hha1 site % methylated in normal blood-derived DNA % expected signal reduction Q-fragments: DNA quantity; only visible with less than 100 ng sample DNA D-fragments: Low signal of 88 or 96 nt fragment indicates incomplete denaturation 100 X-fragment: Specific for the X chromosome 105 Y-fragment: Specific for the Y chromosome Chromosomal position ref. BWS/RSS 129 * Reference probe L q H19 probe L20532 Yes 50% 50% H19DMR/IC1 141 KCNQ1OT1 probe L19191 Yes 50% 50% KvDMR/IC2 148 * Reference probe L q Reference probe L q H19 probe L Region 166 KCNQ1OT1 probe L05782 Yes 50% 50% KvDMR/IC2 171 ± IGF2 probe L20841 Yes 0% 100% 5 DMR0 178 * Reference probe L q H19 probe L08764 Yes 50% 50% H19DMR/IC1 190 * H19 probe L Region 196 ± CDKN1C probe L Exon * Reference probe L q * Reference probe L q H19 probe L Region 221 * KCNQ1 probe L Exon * H19 probe L Exon * H19 probe L16503 Yes 50% 50% H19DMR/IC1 256 Reference probe L p KCNQ1 probe L Exon KCNQ1OT1 probe L19204 Yes 50% 50% KvDMR/IC2 284 ± IGF2 probe L Exon * Reference probe L q H19 probe L05772 Yes 50% 50% H19DMR/IC1 310 Reference probe L q * NSD1 probe L (Exon 24) 328 KCNQ1 probe L Exon * Reference probe L q *± CDKN1C probe L18042 Yes 10% 90% Exon *# Digestion Control probe L09311 Yes 0% 100% 8p KCNQ1 probe L Exon * KCNQ1 probe L Exon * Reference probe L q KCNQ1OT1 probe L06781 Yes 50% 50% KvDMR/IC2 400 KCNQ1 probe L Exon ± KCNQ1 probe L Exon * NSD1 probe L (Exon 22) 427 * Reference probe L q ± KCNQ1 probe L Exon ± CDKN1C probe L Exon ± H19 probe L Region 463 * Reference probe L p25 * New in version C1 (from lot C onwards). Changed in version C1 (from lot C onwards). Small change in length, no change in sequence detected. ± These probes are located within, or close to, a very strong CpG island. A low signal of these probes can be due to incomplete sample DNA denaturation, e.g. due to the presence of salt in the sample DNA. SALSA probemix ME030-C1 BWS/RSS Page 4 of 8

5 # Digestion control: warns for insufficient digestion. Upon digestion, this probe should not give a signal. More variable. Note: Exon numbering might be different as compared to literature! Please notify us of any mistakes: info@mlpa.com. The identity of the genes detected by the reference probes is available on request: info@mlpa.com. Table 2. ME030 probes arranged according to chromosomal location Length (nt) SALSA MLPA probe Gene / exon Hha1 site 418 * L02071 NSD1-319 * L02529 NSD1 - GenBank Ligation site NM_ ; NM_ ; Chromosomal position Distance to next probe kb * L19241 H L01713 H L05772 H19 Yes 238 * L16503 H19 Yes L08764 H19 Yes L20532 H19 Yes L11143 H L11141 H * L19242 H L05778 IGF L05775 IGF2 Yes L02903 KCNQ1-221 * L16502 KCNQ L04802 KCNQ L19240 KCNQ L20510 KCNQ L19204 KCNQ1OT1 Yes L05782 KCNQ1OT1 Yes L06781 KCNQ1OT1 Yes L19191 KCNQ1OT1 Yes L18343 KCNQ1-373 * L16504 KCNQ1 - NR_ ; NR_ ; 178nt NR_ ; 342nt NR_ ; 486nt NR_ ; 657nt NR_ ; 961nt NR_ ; 3282 nt NR_ ; 3798 nt NR_ ; 6778 nt NM_ ; NM_ ; 318nt after exon 4; NM_ ; nt before exon NR_ ; NR_ ; NR_ ; NR_ ; 190 nt kb kb kb kb kb kb kb kb kb kb kb kb kb kb kb kb kb kb kb kb kb kb SALSA probemix ME030-C1 BWS/RSS Page 5 of 8

6 Length (nt) SALSA MLPA probe Gene / exon Hha1 site L21092 KCNQ1 - GenBank Ligation site Chromosomal position Distance to next probe kb L20842 CDKN1C - NM_ ; kb L05768 CDKN1C - NM_ ; kb 346 * L18042 CDKN1C Yes NM_ ; * New in version C1 (from lot C onwards). Changed in version C1 (from lot C onwards). Small change in length, no change in sequence detected. The NM_ , NR_ , NM_ , NM_ , and NM_ sequences are reference standards in the NCBI RefSeqGene project. Table 3. Sequences detected by the ME030-C1 probes Length SALSA MLPA (nt) probe Partial sequence with HhaI site L20532 CAGGCCCTCTGGGATGTGGAAGGGCTGGC-CGCGCCTTCGGCAAACCCTCTGTTCCCA L19191 GATCGGTTTTGATGCCACCCGGGCTCAGAT-TGGCCCAGCGGGTCCAGCGCCGCATGAG L01713 GCGGGGAGGCCGTCTTTGGAGAA-TTCCAGGATGGGTGCTGGGTGAGAGAGACGTGGTA L05782 GACCGTGTTCAAACCCTCCCAGAGAGA-TGGGGAGGGCCGCGCTGAGGAGAGTCTG L05775 TCAAGCCACCTGCATCTGCACTCA-GACGGGGCGCACCCGCAGTGCAGCCTCC L08764 GTAGAGTGCGCCCGCGAGCCGTA-AGCACAGCCCGGCAACATGCGGTCTTCAGAGT L19242 GGAGCAGGCAAACACCTCGGGCTATTTGCTTT-CTAATGGGGCATTTGCATGTGTATAGG L05768 GTCCCTCCGCAGCACATCCACGAT-GGAGCGTCTTGTCGCCCGTGGGACCTTC L11141 GAATCGATAAAGGATGGGGATCAATGG-TGTTTGTGCACTGTGCGGTCTGTGCCCAATT L16502 GACCTACCTCTAGTGTGTGCTTACCAGCTA-ATGGATGACTGGGTTTTCGAAGCACTGTC L19241 GACCACCAGCCACCACATCATCCCA-GAGCTGAGCTCCTCCAGCGGGATGACGCCGTCCC L16503 CTGAGGGGCAGAGGGAAGTGCCGCAA-ACCCCCTGGTGGGCGCGGTGCCAGCCCCCCA L18343 ACTCTCCACTGCAGGCTGCGGGAAC-ACCATCGGGCCACCATTAAGGTCATTCGACGCA L19204 GCGGGGCACACAGCTCACCTCAGCAA-CGCCAGTGATCACCCGTCCCGCGCCGTCCGC L05778 GCCAGGTCACAGCTGCGGAAACA-GCACTCCTCAACGATGCCACGGCTGCGAC L05772 CGGCCCCCAGCCATGTGCAAAGTA-TGTGCAGGGCGCTGGCAGGCAGGGAGCA L02529 CCAGAAGGAGCGGGCAGCTTCACCTCA-TCAGGTCACACCACAGGCTGATGAGAAGATGC L04802 CTACATCGGCTTCCTGGGCCTCATCT-TCTCCTCGTACTTTGTGTACCTGGCTGAGAAG L18042 CCTCTCCTTTCCCCTTCTTCTCGCT-GTCCTCTCCTCTCTCGCTGCCCGCGTTTGCGCAG L09311 CCTCCTAGCCTGGCGCGCGATT-ATTTGAAGACGCTCACGGAGCGGCTGGCTAGGCTGA L19240 CCTGCAGGTCACAGTCACCACCATCGGCT-ATGGGGACAAGGTGCCCCAGACGTGGGTC L16504 CTTCTCTCCAGGCTGGACCAGTCCAT-TGGGAAGCCCTCACTGTTCATCTCCGTCTCAG L06781 CGTCCTCCTCGGTGCGTCAGTCAT-CGTGGTTCTCCCCGGCGCGCCCCTCGGC L20510 CCTTCTTGGCTCGGGGTTTGCCCTGAAGGT-GCAGCAGAAGCAGAGGCAGAAGCACTTC L21092 CCTCCAGCAGCCAGCCAAACACACAG-AAGGGGACTGCCACCTCCCCTTGCCAGCT L02071 CTAGAATGTCTTGGGAATGGAAAGACTGTT-TGCAAATGTGGAGCCCCGAACTGCAGTG L02903 GCTCTCGGGAATTTGAGGCCTGT-GGCTGCTGTGGACCCTGGGAAAGAGCCTGTGC L20842 CCTCGCTGGGCCTCGGCTGGGACCGTTCATGT-AGCAGCAACCGGCGGCGGCTGCCGCA L11143 CCTGCCTGCAGAAACATCCCGGGTCAA-CAGGCCAGGCACCGCATTGGTTCGCGAG The Hha1 sites are marked with grey. Ligation sites are marked with Note: Exon numbering might be different as compared to literature! Complete probe sequences are available on request: info@mlpa.com. Please notify us of any mistakes: info@mlpa.com. SALSA probemix ME030-C1 BWS/RSS Page 6 of 8

7 SALSA MS-MLPA probemix ME030-C1 BWS/RSS sample pictures Figure 1. Capillary electrophoresis pattern of a sample of approximately 50 ng undigested human male control DNA analyzed with SALSA MLPA probemix ME030-C1 BWS/RSS (lot C1-0711) for the quantification of copy numbers. Figure 2. Capillary electrophoresis pattern of a sample of approximately 50 ng digested human male control DNA analyzed with SALSA MLPA probemix ME030-C1 BWS/RSS (lot C1-0711) to determine the methylation status. SALSA probemix ME030-C1 BWS/RSS Page 7 of 8

8 Implemented Changes the following has been altered compared to the previous product description version(s). Version 24 (06) - Methylation percentage errors corrected in Table 1. - Reference sequence information added below Table 2. Version 23 (05) - Product description adapted to a new product version (version number changed, lot number added, small changes in Table 1 and Table 2, new pictures included). Version 22 (05) - Product description adapted to a new lot (lot number added, new picture included). - Warning added about a SNP for probe L04803 below table 1. - Warning added for CDKN1C probes under table 2d. on page 6. Version 21 (05) - Various minor textual changes on page 1. - Mapview locations updated in table 1. - Various minor layout changes. Version 20 - Product description adapted to a new lot (lot number added, new picture included). - Small textual and layout modifications. Version 19 - Exon numbering of the KCNQ1 gene adjusted to the exon numbering of the NCBI. - More details added about SNP in 142 nt probe L Minor changes to text of Figures 2 & 3. SALSA probemix ME030-C1 BWS/RSS Page 8 of 8

MRC-Holland MLPA. Description version 12; 02-12-2012

MRC-Holland MLPA. Description version 12; 02-12-2012 SALSA MLPA probemix P083-C1 CDH1 Lot C1-0211. As compared to previous B1 version, new in version C1: two CDH1 probes and several reference probes have been replaced/added. In addition, the 88 and 96nt

More information

MRC-Holland MLPA. Related SALSA MLPA probemix P091 CFTR: contains probes for the CFTR gene, related to chronic pancreatitis.

MRC-Holland MLPA. Related SALSA MLPA probemix P091 CFTR: contains probes for the CFTR gene, related to chronic pancreatitis. SALSA MLPA probemix P242-B3 Pancreatitis Lot B3-0215. As compared to version B2 (lot B2-1212), one flanking probe has been removed and four reference probes have been replaced. Hereditary Pancreatitis

More information

MRC-Holland MLPA. Description version 14; 03-12-2012

MRC-Holland MLPA. Description version 14; 03-12-2012 mix P106-B1 MRX Lot 0609. As compared to previous lots (0307, 1005 & 0405), two probes for the HUWE gene and one extra AGTR2 probe have been included. In addition, two ARX probes and one SLC6A8 probe have

More information

MRC-Holland MLPA. Related SALSA MLPA probemixes P417 BAP1: Contains probes for each exon of BAP1 gene on 3p21.

MRC-Holland MLPA. Related SALSA MLPA probemixes P417 BAP1: Contains probes for each exon of BAP1 gene on 3p21. SALSA MLPA probemix P027-C1 Uveal melanoma Lot C1-0814 & C1-0213 & C1-0211: A large number of probes have been replaced by other probes in the same chromosomal regions as compared to previous lots, and

More information

Analysis of the DNA Methylation Patterns at the BRCA1 CpG Island

Analysis of the DNA Methylation Patterns at the BRCA1 CpG Island Analysis of the DNA Methylation Patterns at the BRCA1 CpG Island Frédérique Magdinier 1 and Robert Dante 2 1 Laboratory of Molecular Biology of the Cell, Ecole Normale Superieure, Lyon, France 2 Laboratory

More information

Gene Mapping Techniques

Gene Mapping Techniques Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur

More information

Overview of Genetic Testing and Screening

Overview of Genetic Testing and Screening Integrating Genetics into Your Practice Webinar Series Overview of Genetic Testing and Screening Genetic testing is an important tool in the screening and diagnosis of many conditions. New technology is

More information

Becker Muscular Dystrophy

Becker Muscular Dystrophy Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency

More information

Application Guide... 2

Application Guide... 2 Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

Quantitative 1-Schritt-DNA-Methylierungsanalyse aus genomischer DNA

Quantitative 1-Schritt-DNA-Methylierungsanalyse aus genomischer DNA Quantitative 1-Schritt-DNA-Methylierungsanalyse aus genomischer DNA Molekulare Diagnostik 2011 Departement Klinische Forschung Abteilung für Humangenetik Experimentelle Hämatologie DKF und Labor für Molekulare

More information

Introduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director

Introduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director Introduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director Gene expression depends upon multiple factors Gene Transcription

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information

Information leaflet. Centrum voor Medische Genetica. Version 1/20150504 Design by Ben Caljon, UZ Brussel. Universitair Ziekenhuis Brussel

Information leaflet. Centrum voor Medische Genetica. Version 1/20150504 Design by Ben Caljon, UZ Brussel. Universitair Ziekenhuis Brussel Information on genome-wide genetic testing Array Comparative Genomic Hybridization (array CGH) Single Nucleotide Polymorphism array (SNP array) Massive Parallel Sequencing (MPS) Version 120150504 Design

More information

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED Targeted TARGETED Sequencing sequencing solutions Accurate, scalable, fast Sequencing for every lab, every budget, every application Ion Torrent semiconductor sequencing Ion Torrent technology has pioneered

More information

The following chapter is called "Preimplantation Genetic Diagnosis (PGD)".

The following chapter is called Preimplantation Genetic Diagnosis (PGD). Slide 1 Welcome to chapter 9. The following chapter is called "Preimplantation Genetic Diagnosis (PGD)". The author is Dr. Maria Lalioti. Slide 2 The learning objectives of this chapter are: To learn the

More information

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources

Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold

More information

Methylation Analysis Using Methylation-Sensitive HRM and DNA Sequencing

Methylation Analysis Using Methylation-Sensitive HRM and DNA Sequencing APPLICATION NOTE Methylation Analysis Using Methylation-Sensitive HRM and DNA Sequencing Methylation Analysis Using Methylation Sensitive HRM and DNA Sequencing Abstract DNA methylation is a key epigenetic

More information

The Genetics of Beckwith Wiedemann Syndrome (BWS)

The Genetics of Beckwith Wiedemann Syndrome (BWS) The Genetics of Beckwith Wiedemann Syndrome (BWS) Introduction Beckwith Wiedemann Syndrome (BWS) is an overgrowth disorder caused by changes in the activity of growth promoting and growth suppressing genes.

More information

CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA

CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA Cytogenetics is the study of chromosomes and their structure, inheritance, and abnormalities. Chromosome abnormalities occur in approximately:

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

NATIONAL GENETICS REFERENCE LABORATORY (Manchester)

NATIONAL GENETICS REFERENCE LABORATORY (Manchester) NATIONAL GENETICS REFERENCE LABORATORY (Manchester) MLPA analysis spreadsheets User Guide (updated October 2006) INTRODUCTION These spreadsheets are designed to assist with MLPA analysis using the kits

More information

GENOTYPING ASSAYS AT ZIRC

GENOTYPING ASSAYS AT ZIRC GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed

More information

ZR DNA Sequencing Clean-up Kit

ZR DNA Sequencing Clean-up Kit INSTRUCTION MANUAL ZR DNA Sequencing Clean-up Kit Catalog Nos. D40 & D4051 Highlights Simple 2 Minute Bind, Wash, Elute Procedure Flexible 6-20 µl Elution Volumes Allow for Direct Loading of Samples with

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation

Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation PN 100-9879 A1 TECHNICAL NOTE Single-Cell Whole Genome Sequencing on the C1 System: a Performance Evaluation Introduction Cancer is a dynamic evolutionary process of which intratumor genetic and phenotypic

More information

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of

More information

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application

More information

Comparative genomic hybridization Because arrays are more than just a tool for expression analysis

Comparative genomic hybridization Because arrays are more than just a tool for expression analysis Microarray Data Analysis Workshop MedVetNet Workshop, DTU 2008 Comparative genomic hybridization Because arrays are more than just a tool for expression analysis Carsten Friis ( with several slides from

More information

Genetics Lecture Notes 7.03 2005. Lectures 1 2

Genetics Lecture Notes 7.03 2005. Lectures 1 2 Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several

More information

PicoMaxx High Fidelity PCR System

PicoMaxx High Fidelity PCR System PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED

More information

MEDICAL GENETICS GENERAL OBJECTIVE SPECIFIC OBJECTIVES

MEDICAL GENETICS GENERAL OBJECTIVE SPECIFIC OBJECTIVES SUBJECT MEDICAL GENETICS CREDITS Total: 4.5 Theory 2.5 Practical 2 GENERAL OBJECTIVE To provide students with terminology and knowledge from the field of human genetics that will enable them to understand

More information

Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.

Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers. Unzipping Genes MBPCR014 Beta-Thalassemia Detection Kit P r o d u c t I n f o r m a t i o n Description: Thalassemia is a group of genetic disorders characterized by quantitative defects in globin chain

More information

Design of conditional gene targeting vectors - a recombineering approach

Design of conditional gene targeting vectors - a recombineering approach Recombineering protocol #4 Design of conditional gene targeting vectors - a recombineering approach Søren Warming, Ph.D. The purpose of this protocol is to help you in the gene targeting vector design

More information

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B

INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS

More information

DNA Integrity Number (DIN) For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments

DNA Integrity Number (DIN) For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments DNA Integrity Number () For the Assessment of Genomic DNA Samples in Real-Time Quantitative PCR (qpcr) Experiments Application Note Nucleic Acid Analysis Author Arunkumar Padmanaban Agilent Technologies,

More information

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing.

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing. User manual imegen Anchovies II ID kit Anchovies species (E. encrasicolus and E. japonicus) DNA detection by sequencing Reference: Made in Spain The information in this guide is subject to change without

More information

REQUEST FOR IMAGe SYNDROME TESTING

REQUEST FOR IMAGe SYNDROME TESTING REQUEST FOR IMAGe SYNDROME TESTING Please provide the following information. We cannot perform your test without ALL of this information. PLEASE PRINT ALL ANSWERS PATIENT INFORMATION* FIRST NAME MI LAST

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

REI Pearls: Pitfalls of Genetic Testing in Miscarriage

REI Pearls: Pitfalls of Genetic Testing in Miscarriage The Skinny: Genetic testing of miscarriage tissue is controversial and some people question if testing is helpful or not. This summary will: 1) outline the arguments for and against genetic testing; 2)

More information

ab185916 Hi-Fi cdna Synthesis Kit

ab185916 Hi-Fi cdna Synthesis Kit ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1

More information

The NF1-gene a hotspot for de novo Alu- and L1-insertion?

The NF1-gene a hotspot for de novo Alu- and L1-insertion? The NF1-gene a hotspot for de novo Alu- and L1-insertion? Katharina Wimmer Division Humangenetik, Medizinische Universität Innsbruck Molekulare Diagnostik 2013 Zürich, 1. März, 2013 2 Die im Vortrag vorgestellten

More information

Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005

Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Deutsche Akkreditierungsstelle GmbH German Accreditation Body Annex to the Accreditation Certificate D-PL-13372-01-00 according to DIN EN ISO/IEC 17025:2005 Period of validity: 26.03.2012 to 25.03.2017

More information

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 INSTRUCTION MANUAL ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 Highlights Simple 10 Minute Bind, Wash, Elute Procedure Flexible 15-20 µl Elution Volumes Allow for Direct Loading of Samples

More information

Description: Molecular Biology Services and DNA Sequencing

Description: Molecular Biology Services and DNA Sequencing Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:

More information

Factors Influencing Multiplex Real-Time PCR

Factors Influencing Multiplex Real-Time PCR APPLICATION NOTE Multiplex Real-Time PCR Factors Influencing Multiplex Real-Time PCR Introduction Multiplex PCR is the simultaneous amplification of more than one target sequence in a single reaction [1].

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins

More information

Genetic Testing for Susceptibility to Breast and Ovarian Cancer (BRCA1 and BRCA 2)

Genetic Testing for Susceptibility to Breast and Ovarian Cancer (BRCA1 and BRCA 2) Easy Choice Health Plan, Inc. Harmony Health Plan of Illinois, Inc. M issouri Care, Inc. Ohana Health Plan, a plan offered by WellCare Health Insurance of Arizona, Inc. WellCare Health Insurance of Illinois,

More information

Wissenschaftliche Highlights der GSF 2007

Wissenschaftliche Highlights der GSF 2007 H Forschungszentrum für Umwelt und Gesundheit GmbH in der Helmholtzgemeinschaft Wissenschaftlich-Technische Abteilung Wissenschaftliche Highlights der GSF 2007 Abfrage Oktober 2007 Institut / Selbst. Abteilung

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

EZ DNA Methylation-Lightning Kit Catalog Nos. D5030 & D5031

EZ DNA Methylation-Lightning Kit Catalog Nos. D5030 & D5031 INSTRUCTION MANUAL EZ DNA Methylation-Lightning Kit Catalog Nos. D5030 & D5031 Highlights Fastest method for complete bisulfite conversion of DNA for methylation analysis. Ready-to-use conversion reagent

More information

Validation and Replication

Validation and Replication Validation and Replication Overview Definitions of validation and replication Difficulties and limitations Working examples from our group and others Why? False positive results still occur. even after

More information

DNA Isolation Kit for Cells and Tissues

DNA Isolation Kit for Cells and Tissues DNA Isolation Kit for Cells and Tissues for 10 isolations of 00 mg each for tissue or 5 x 10 7 cultured cells Cat. No. 11 81 770 001 Principle Starting material Application Time required Results Benefits

More information

Real-time quantitative RT -PCR (Taqman)

Real-time quantitative RT -PCR (Taqman) Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR

More information

ChIP TROUBLESHOOTING TIPS

ChIP TROUBLESHOOTING TIPS ChIP TROUBLESHOOTING TIPS Creative Diagnostics Abstract ChIP dissects the spatial and temporal dynamics of the interactions between chromatin and its associated factors CD Creative Diagnostics info@creative-

More information

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of

More information

MUTATION, DNA REPAIR AND CANCER

MUTATION, DNA REPAIR AND CANCER MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful

More information

Single Nucleotide Polymorphisms (SNPs)

Single Nucleotide Polymorphisms (SNPs) Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded

More information

European Medicines Agency

European Medicines Agency European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Mir-X mirna First-Strand Synthesis Kit User Manual

Mir-X mirna First-Strand Synthesis Kit User Manual User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.

More information

INSTRUCTION MANUAL. EZ DNA Methylation Kit Catalog Nos. D5001 & D5002. Highlights. Contents

INSTRUCTION MANUAL. EZ DNA Methylation Kit Catalog Nos. D5001 & D5002. Highlights. Contents INSTRUCTION MANUAL EZ DNA Methylation Kit Catalog Nos. D5001 & D5002 Highlights Streamlined, proven procedure for bisulfite conversion of DNA. Desulphonation and recovery of bisulfite-treated DNA with

More information

High-quality genomic DNA isolation and sensitive mutation analysis

High-quality genomic DNA isolation and sensitive mutation analysis Application Note High-quality genomic DNA isolation and sensitive mutation analysis Izabela Safin, Ivonne Schröder-Stumberger and Peter Porschewski Introduction A major objective of cancer research is

More information

The Human Genome Project

The Human Genome Project The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?

More information

PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide

PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR Results Interpretation Guide Pathogen Detection Systems by Real Time PCR Microbial offers real time PCR based systems for the detection of pathogenic bacteria

More information

Chromosomes, Mapping, and the Meiosis Inheritance Connection

Chromosomes, Mapping, and the Meiosis Inheritance Connection Chromosomes, Mapping, and the Meiosis Inheritance Connection Carl Correns 1900 Chapter 13 First suggests central role for chromosomes Rediscovery of Mendel s work Walter Sutton 1902 Chromosomal theory

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

INTERPRETATION INFORMATION SHEET

INTERPRETATION INFORMATION SHEET Creative Testing Solutions 2424 West Erie Dr. 2205 Highway 121 10100 Martin Luther King Jr. St. No. Tempe, AZ 85282 Bedford, TX 76021 St. Petersburg, FL 33716 INTERPRETATION INFORMATION SHEET Human Immunodeficiency

More information

Molecular typing of VTEC: from PFGE to NGS-based phylogeny

Molecular typing of VTEC: from PFGE to NGS-based phylogeny Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing

More information

Real-time PCR: Understanding C t

Real-time PCR: Understanding C t APPLICATION NOTE Real-Time PCR Real-time PCR: Understanding C t Real-time PCR, also called quantitative PCR or qpcr, can provide a simple and elegant method for determining the amount of a target sequence

More information

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website Biomolecular Core Facility AI Dupont Hospital for Children, Rockland Center One, Room 214 Core: (302) 651-6712, Office: (302) 651-6707, mbcore@nemours.org Katia Sol-Church, Ph.D., Director Jennifer Frenck

More information

Automated DNA sequencing 20/12/2009. Next Generation Sequencing

Automated DNA sequencing 20/12/2009. Next Generation Sequencing DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing

More information

First Strand cdna Synthesis

First Strand cdna Synthesis 380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences

More information

Supplemental Material. Methods

Supplemental Material. Methods Supplemental Material Methods Measurement of lncrnas expression Total RNA was extracted from PAXgene TM tubes using the PAXgene blood RNA kit (Qiagen, Venlo, Netherlands) as described by the manufacturer.

More information

Multiplex your most important

Multiplex your most important Multiplex your most important genetic assays on one platform GenomeLab GeXP Genetic Analysis System Blood Banking Capillary Electrophoresis Centrifugation Flow Cytometry Genomics Lab Automation Lab Tools

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

PrimeSTAR HS DNA Polymerase

PrimeSTAR HS DNA Polymerase Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction

More information

APPLICATION INFORMATION

APPLICATION INFORMATION A-10484A APPLICATION INFORMATION Genetic Analysis SNPS. MUTATIONS AND DNA SEQUENCE VARIATION ANALYSIS USING THE GENOMELAB SNPSTART KIT Nitin Udar, Jana Mariana, Margaret Porter and Doni Clark Beckman Coulter

More information

Recombinant DNA Unit Exam

Recombinant DNA Unit Exam Recombinant DNA Unit Exam Question 1 Restriction enzymes are extensively used in molecular biology. Below are the recognition sites of two of these enzymes, BamHI and BclI. a) BamHI, cleaves after the

More information

Sequencing and microarrays for genome analysis: complementary rather than competing?

Sequencing and microarrays for genome analysis: complementary rather than competing? Sequencing and microarrays for genome analysis: complementary rather than competing? Simon Hughes, Richard Capper, Sandra Lam and Nicole Sparkes Introduction The human genome is comprised of more than

More information

ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.

ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S. A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT

More information

ncounter Gene Expression Assay Manual Total RNA and Cell Lysate Protocols

ncounter Gene Expression Assay Manual Total RNA and Cell Lysate Protocols ncounter Gene Expression Assay Manual Total RNA and Cell Lysate Protocols v.20090807 For research use only. Not for use in diagnostic procedures. Limited License Subject to the terms and conditions of

More information

Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform

Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 3 Sample Prep Workflow, 4 Best Practices, 5 DNA Input Recommendations,

More information

2.500 Threshold. 2.000 1000e - 001. Threshold. Exponential phase. Cycle Number

2.500 Threshold. 2.000 1000e - 001. Threshold. Exponential phase. Cycle Number application note Real-Time PCR: Understanding C T Real-Time PCR: Understanding C T 4.500 3.500 1000e + 001 4.000 3.000 1000e + 000 3.500 2.500 Threshold 3.000 2.000 1000e - 001 Rn 2500 Rn 1500 Rn 2000

More information

Genetics Module B, Anchor 3

Genetics Module B, Anchor 3 Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for

More information

Gene Expression Assays

Gene Expression Assays APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency

More information

BRCA and Breast/Ovarian Cancer -- Analytic Validity Version 2003-6 2-1

BRCA and Breast/Ovarian Cancer -- Analytic Validity Version 2003-6 2-1 ANALYTIC VALIDITY Question 8: Is the test qualitative or quantitative? Question 9: How often is a test positive when a mutation is present (analytic sensitivity)? Question 10: How often is the test negative

More information

Global MicroRNA Amplification Kit

Global MicroRNA Amplification Kit Global MicroRNA Amplification Kit Store kit at -20 C on receipt (ver. 3-060901) A limited-use label license covers this product. By use of this product, you accept the terms and conditions outlined in

More information

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information