Models of Switching in Biophysical Contexts
|
|
|
- Angel Harper
- 9 years ago
- Views:
Transcription
1 Models of Switching in Biophysical Contexts Martin R. Evans SUPA, School of Physics and Astronomy, University of Edinburgh, U.K. March 7, 2011 Collaborators: Paolo Visco (MSC, Paris) Rosalind J. Allen (Edinburgh) Satya N. Majumdar (LPTMS, Paris)
2 Plan Plan I Thoughts on biophysical modelling II Switching between states III Microscopic dynamics: model linear feedback switch IV Macroscopic dynamics: population growth in a catastrophic environment References: P. Visco, R. J. Allen, M. R. Evans, Phys. Rev. Lett. 2008, Phys. Rev. E 2009 P. Visco, R. J. Allen, S. N. Majumdar, M. R. Evans, Biophysical Journal 2010
3 Physics vs Biology Physics vs Biology Physics Unifying Principles Effective Theories; minimal models Mathematical proof e.g. Free energy minimisation Biology System details Models with many parameters to fit data Argumentation e.g. Evolutionary pressures
4 What can physicists bring to biophysical modelling? Ideas from (statistical) physics many particle behaviour non equilibrium phenomena fluctuations and stochastic effects idea of scales Model building savoir faire minimal models exact solutions; good approximations
5 What can physicists bring to biophysical modelling? Ideas from (statistical) physics many particle behaviour non equilibrium phenomena fluctuations and stochastic effects idea of scales Model building savoir faire minimal models exact solutions; good approximations What physicists shouldn t bring Arrogance and ignorance
6 Plan Plan I Thoughts on biophysical modelling II Switching between states III Microscopic dynamics: model linear feedback switch IV Macroscopic dynamics: population growth in a catastrophic environment References: P. Visco, R. J. Allen, M. R. Evans, Phys. Rev. Lett. 2008, Phys. Rev. E 2009 P. Visco, R. J. Allen, S. N. Majumdar, M. R. Evans, Biophysical Journal 2010
7 II Switching: Basic Biology for Physicists Gene Stretch of DNA 1000 base pairs long Transcription by RNAp mrna Translation amino acids production of proteins... Phenotype Regulation regulatory sites at ends of gene known as operators gene switched off/on by binding of repressors/enhancers known as Transcription factors genes can produce transcription factors for themselves or other genes genetic network
8 Heterogeneity Populations of bacteria are often heterogeneous even if environmentally and genetically identical Happens when bacteria frequently switches between different states: Multistable genetic switches Stochastic oscillation between different states It represents a strategy against environmental changes and stresses Examples: Bacterial persistence Phase variation (e.g.: fimbriae)
9 Example: Bacterial persistence Non persistent state Persistent state Vulnerable to antibiotics Resists against antibiotics Fast growth Very slow growth Balaban, Merrin, Chait, Kowalik, Leibler, Science, 2004
10 Examples of population strategies Bet Hedging small fraction of population in unfit persistor state which can survive catastrophes e.g. antibiotics Once and for all Population splits into groups with long lived phenotypes i.e. bistability Defence against immune response small fraction of population in fit state since too successful a population would evoke an immune response
11 Models of genetic switches Existing models for bistable gene regulatory networks Mutually repressing genes Positive feedback loop Typically: bistable systems effective potential But this is not how the most common bacterial phase variation systems work! state state 1 state 2
12 Example: Uropathogenic E.Coli Urinary tract Attached, fimbriated Detached, fimbriated Detached, non fimbriated Attached vulnerable to immune system Detached vulnerable to flushing
13 Example: Uropathogenic E. Coli Non fimbriated state Fimbriated state M. R. Evans Models of Switching in Biophysical Contexts
14 The fim switch DNA inversion switch fim system controls production of fimbriae short piece of DNA can be inserted in two orientations in one orientation fimbrial genes transcribed and fimbriae produced ( on state ) inversion of DNA element mediated by recombinase enzymes FimE recombinase which flips the switch on to off is produced more strongly in the on state orientational control
15 III Model of stochastic linear feedback switch Reaction network k R 1 1 k S 2 on Son + R 1 k S on + R on 3 1 S off + R 1 k 4 S on k4 S off R 1 variations switching reactions Reaction rates k 1 k 2 k on R 1 decay R 1 production 3 R 1 mediated switching (only on to off) k 4 spontaneous switching (both directions)
16 III Model of stochastic linear feedback switch Reaction network k R 1 1 k S 2 on Son + R 1 k S on + R on 3 1 S off + R 1 k 4 S on k4 S off R 1 variations switching reactions In the on state: dn dt = k 2 k 1 n
17 III Model of stochastic linear feedback switch Reaction network k R 1 1 k S 2 on Son + R 1 k S on + R on 3 1 S off + R 1 k 4 S on k4 S off R 1 variations switching reactions In the on state: n(t) = k 2 k 1 [1 exp( k 1 t)] n k 2 k 1 t
18 III Model of stochastic linear feedback switch Reaction network k R 1 1 k S 2 on Son + R 1 k S on + R on 3 1 S off + R 1 k 4 S on k4 S off R 1 variations switching reactions In the off state: dn dt = k 1 n n k 2 k 1 t
19 III Model of stochastic linear feedback switch Reaction network k R 1 1 k S 2 on Son + R 1 k S on + R on 3 1 S off + R 1 k 4 S on k4 S off R 1 variations switching reactions In the off state: n(t) = n 0 exp( k 1 t) n k 2 k 1 t
20 Scales k 2 k 1 0 n τ R τ on Three timescales τ off t τ R relaxation time of n: 1/k 1 τ on on to off switching time: 1/( n on k3 on + k on τ off off to on switching time: 1/k4 off Two n scales n on asymptotic value of n in the on state: k 2 /k 1 n off asymptotic value of n in the off state: 0 4 )
21 Some examples τ R τ S τ R τ S τ R τ S
22 Statistical description Define p s (n, t) probability that there are n enzymes and the switch is in position s {on, off} at time t. Master equation dp s (n) dt = k 1 [(n + 1)p s (n + 1) np s (n)] + k s 2 [p s(n 1) p s (n)] + n[k 1 s 3 p 1 s (n) k s 3 p s(n)] + k 4 [p 1 s (n) p s (n)] Removal of R 1 Production of R 1 (if the switch is on) R 1 mediated switching spontaneous switching
23 Steady state: two coupled equations (n + 1)k 1 p on (n + 1) + k 2 p on (n 1) + k 4 p off (n) (n + 1)k 1 p off (n + 1) + nk on 3 p on(n) + k 4 p on (n) = (nk 1 + k 2 + nk on 3 + k 4)p on (n) = (nk 1 + k 4 )p off (n) Exact solution p on (n) = a 0 (u 1 u 0 ) n n! (η) n (ζ) n 1F 1 (η + n, ζ + n, u 0 ) p off (n) = κδ n,0 + k 2 p on (n 1) p on (n) k 1 n where u 1, u 0, η, ζ are combinations of the reaction rates and κ, a 0 are normalising constants
24 Test against simulations Plot of p(n) = p on (n) + p off (n) Perfect agreement
25 Flipping time distribution Flipping time distribution F on (t)dt probability that the switch flips at time t t + dt Compare with mean first passage times and persistence distributions of stochastic processes We would like to see peak around typical time to be in on-state F(t) m t Can the model achieve this? require df(t) dt > 0 t=0
26 Measurement ensemble F (T ) depends on the initial condition of n i Two choices: Switch change ensemble SCE Steady state ensemble SSE Initial distribution W (n i ) defines the ensemble
27 Relation between ensembles on switch position T T 1 T 2 off Probability that t is an interval T : Prob(T )dt = t time T F SCE (T )dt 0 T F SCE (T )dt Prob(T 2 T )dt = θ(t T 2)dT T (uniform) F SSE (T 2 ) = T 2 Prob(T 2 T )Prob(T )dt = T 2 0 F SCE (T )dt TF SCE (T )dt General relation from renewal theory: df SSE dt = FSCE (T ) T SCE
28 Peak in the distribution never a peak in SSE in SCE require k 2 k on 3 (k 4) 2 k on 3 (k 1 + 2k 4 ) n W (k on 3 )2 n 2 W > 0 k k 2 = k 2 = k3 on Visco, Allen, Evans, PRL (2008);
29 IV Population dynamics in changing environments Consider whether switching rate to a less fit state is advantageous for the population Previous studies Thattai and Van Oudenaarden, Genetics environments, 2 phenotypes, Poissonian environmental changes Kussell and Leibler, Science 2005 many environments and phenotypes, different phentotypes have preferred environment Random switching between phenotypes good strategy when environmental changes unpredictable
30 General scenario Single environment Population of bacteria, say, with two possibles states for individuals: Fit state has fast growth Unfit (persistor) state has slow growth but withstands catastrophes Catastrophes occur stochastically, coupled to growth of population Question: what is best strategy of population to maximise growth?
31 Model Deterministic growth Two subpopulations n A and n B. Exponential growth rates γ A > γ B Individuals switch states with rates k A, k B dn A dt dn B dt = γ A n A + k B n B k A n A, = γ B n B + k A n A k B n B. Stochastic catastrophes Catastrophe rate β(n A, n B ) β is the environmental response function When a catastrophe occurs n A n A < n A, with probability density ν(n A n A ). ν is the catastrophe strength distribution
32 Fitness Biological definition: instantaneous growth rate of population Here f is fraction of population in fit state dn dt Deterministic growth: n A f = n A + n B = γ A n A + γ B n B = (γ B + γf )n df dt = v(f ) = γ(f + f )(f f ), where γ = γ A γ B and f ± are the roots of ( f 2 1 k ) A + k B f k B γ γ = 0.
33 Typical trajectory log(n A ) log(n B ) f + f(t) t Piecewise Deterministic Markov Processes - used extensively in context of queueing theory
34 Catastrophe rate Threshold sigmoid function Catastrophes triggered when a threshold is reached Our choice: β λ (f ) = ξ 2 ( 1 + ) f f λ2 + (f f ) 2 parameters ξ plateau value f threshold value βλ(f) 1 λ = 0.01 λ = 0.1 λ = 1 λ = 10 λ sharpness of the transition f
35 Catastrophe strength n A n A = u n A, where 0 < u < 1 is a random number sampled from: P(u) = (α + 1)u α α > 1 n ν(n n) α = 0.5 α = 0 α = 1 α = 10 1 < α < 0 strong catastrophes α > 0 weak catastrophes n /n To each jump n A n A corresponds a jump f f Catastrophe strengh distribution µ(f f ), where µ(f f ) = Θ(f f ) d m(f ) df m(f ) with m(f ) = ( f ) 1+α 1 f
36 Exact Solution for Stationary State Constant flux condition v(f ) 0 f f f f + β(f )µ(f f ) Recall df dt = v(f ) µ(f f ) = d m(f ) df m(f ) ( ) 1+α f m(f ) = 1 f p(f )v(f ) = f+ f df df p(f )β(f )µ(f f ) f 0
37 Exact Solution for Stationary State Constant flux condition v(f ) 0 f f f f + β(f )µ(f f ) Recall df dt = v(f ) µ(f f ) = d m(f ) df m(f ) ( ) 1+α f m(f ) = 1 f p(f )v(f ) = f+ f df p(f )β(f ) m(f ) f df 0 d df m(f )
38 Exact Solution for Stationary State Constant flux condition v(f ) 0 f f f f + β(f )µ(f f ) Recall df dt = v(f ) µ(f f ) = d m(f ) df m(f ) ( ) 1+α f m(f ) = 1 f p(f )v(f ) m(f ) = f+ f df p(f )β(f ) m(f )
39 Exact Solution for Stationary State Constant flux condition v(f ) 0 f f f f + β(f )µ(f f ) Recall df dt = v(f ) µ(f f ) = d m(f ) df m(f ) ( ) 1+α f m(f ) = 1 f d p(f )v(f ) p(f )β(f ) = df m(f ) m(f )
40 Exact Solution for Stationary State Constant flux condition v(f ) 0 f f f f + β(f )µ(f f ) Recall df dt = v(f ) µ(f f ) = d m(f ) df m(f ) ( ) 1+α f m(f ) = 1 f d p(f )v(f ) p(f )β(f ) = df m(f ) m(f ) p(f ) = C m(f ) ( ) β(f ) v(f ) exp v(f )
41 Examples 1.5 (a) (b) p(f/f+) (c) (d) p(f/f+) f /f f /f +
42 Optimal strategies We characterise the population strategy by the value of k A, which is the control parameter for the population balance. We define Optimal Strategies as the values of k A which maximise the average fitness f in the stationary state. Two optimal strategies emerge: f λ = 10 λ = 1 λ = 0.1 λ = k A
43 Optimal strategies cont. Two possible optimal strategies 1 k A = 0 (no switching to unfit state) 2 k A ka where ka yields f + = f (saturation fitness = response threshold) f(t) 1 no switching switching t t
44 Conclusions for population dynamics in changing environments New kind of environments Catastrophic Responsive Switching can be a good strategy Threshold mechanism (different from bet hedging) Two main strategies: no switching: grow faster oblivious to catastrophes switching: grow slower but try not to get caught Outlook: Generalise to saturating populations
45 Summary Plan I Thoughts on biophysical modelling II Switching between states III Microscopic dynamics: model linear feedback switch IV Macroscopic dynamics: population growth in a catastrophic environment References: P. Visco, R. J. Allen, M.R. Evans, Phys. Rev. Lett 2008, Phys. Rev. E 2009 P. Visco, R. J. Allen, S. N. Majumdar, M.R. Evans, Biophysical Journal 2010
Supplement to Call Centers with Delay Information: Models and Insights
Supplement to Call Centers with Delay Information: Models and Insights Oualid Jouini 1 Zeynep Akşin 2 Yves Dallery 1 1 Laboratoire Genie Industriel, Ecole Centrale Paris, Grande Voie des Vignes, 92290
A Mathematical Model of a Synthetically Constructed Genetic Toggle Switch
BENG 221 Mathematical Methods in Bioengineering Project Report A Mathematical Model of a Synthetically Constructed Genetic Toggle Switch Nick Csicsery & Ricky O Laughlin October 15, 2013 1 TABLE OF CONTENTS
Chapter 6: Biological Networks
Chapter 6: Biological Networks 6.4 Engineering Synthetic Networks Prof. Yechiam Yemini (YY) Computer Science Department Columbia University Overview Constructing regulatory gates A genetic toggle switch;
Stochastic Gene Expression in Prokaryotes: A Point Process Approach
Stochastic Gene Expression in Prokaryotes: A Point Process Approach Emanuele LEONCINI INRIA Rocquencourt - INRA Jouy-en-Josas ASMDA Mataró June 28 th 2013 Emanuele LEONCINI (INRIA) Stochastic Gene Expression
Hydrodynamic Limits of Randomized Load Balancing Networks
Hydrodynamic Limits of Randomized Load Balancing Networks Kavita Ramanan and Mohammadreza Aghajani Brown University Stochastic Networks and Stochastic Geometry a conference in honour of François Baccelli
Brownian Motion and Stochastic Flow Systems. J.M Harrison
Brownian Motion and Stochastic Flow Systems 1 J.M Harrison Report written by Siva K. Gorantla I. INTRODUCTION Brownian motion is the seemingly random movement of particles suspended in a fluid or a mathematical
Planning And Scheduling Maintenance Resources In A Complex System
Planning And Scheduling Maintenance Resources In A Complex System Martin Newby School of Engineering and Mathematical Sciences City University of London London m.j.newbycity.ac.uk Colin Barker QuaRCQ Group
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: [email protected].
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: [email protected] What is Gene Expression & Gene Regulation? 1. Gene Expression
A Uniform Asymptotic Estimate for Discounted Aggregate Claims with Subexponential Tails
12th International Congress on Insurance: Mathematics and Economics July 16-18, 2008 A Uniform Asymptotic Estimate for Discounted Aggregate Claims with Subexponential Tails XUEMIAO HAO (Based on a joint
DNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
Qualitative modeling of biological systems
Qualitative modeling of biological systems The functional form of regulatory relationships and kinetic parameters are often unknown Increasing evidence for robustness to changes in kinetic parameters.
Qualitative analysis of regulatory networks
Qualitative analsis of regulator networks Denis THIEFFRY (LGPD-IBDM, Marseille, France) Introduction Formal tools for the analsis of gene networks Graph-based representation of regulator networks Dnamical
α α λ α = = λ λ α ψ = = α α α λ λ ψ α = + β = > θ θ β > β β θ θ θ β θ β γ θ β = γ θ > β > γ θ β γ = θ β = θ β = θ β = β θ = β β θ = = = β β θ = + α α α α α = = λ λ λ λ λ λ λ = λ λ α α α α λ ψ + α =
RNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
Localised Sex, Contingency and Mutator Genes. Bacterial Genetics as a Metaphor for Computing Systems
Localised Sex, Contingency and Mutator Genes Bacterial Genetics as a Metaphor for Computing Systems Outline Living Systems as metaphors Evolutionary mechanisms Mutation Sex and Localized sex Contingent
CellLine, a stochastic cell lineage simulator: Manual
CellLine, a stochastic cell lineage simulator: Manual Andre S. Ribeiro, Daniel A. Charlebois, Jason Lloyd-Price July 23, 2007 1 Introduction This document explains how to work with the CellLine modules
Trading activity as driven Poisson process: comparison with empirical data
Trading activity as driven Poisson process: comparison with empirical data V. Gontis, B. Kaulakys, J. Ruseckas Institute of Theoretical Physics and Astronomy of Vilnius University, A. Goštauto 2, LT-008
Viscoelasticity of Polymer Fluids.
Viscoelasticity of Polymer Fluids. Main Properties of Polymer Fluids. Entangled polymer fluids are polymer melts and concentrated or semidilute (above the concentration c) solutions. In these systems polymer
Final Mathematics 5010, Section 1, Fall 2004 Instructor: D.A. Levin
Final Mathematics 51, Section 1, Fall 24 Instructor: D.A. Levin Name YOU MUST SHOW YOUR WORK TO RECEIVE CREDIT. A CORRECT ANSWER WITHOUT SHOWING YOUR REASONING WILL NOT RECEIVE CREDIT. Problem Points Possible
Semi-Markov model for market microstructure and HF trading
Semi-Markov model for market microstructure and HF trading LPMA, University Paris Diderot and JVN Institute, VNU, Ho-Chi-Minh City NUS-UTokyo Workshop on Quantitative Finance Singapore, 26-27 september
Self-Organization in Nonequilibrium Systems
Self-Organization in Nonequilibrium Systems From Dissipative Structures to Order through Fluctuations G. Nicolis Universite Libre de Bruxelles Belgium I. Prigogine Universite Libre de Bruxelles Belgium
The Exponential Distribution
21 The Exponential Distribution From Discrete-Time to Continuous-Time: In Chapter 6 of the text we will be considering Markov processes in continuous time. In a sense, we already have a very good understanding
EXIT TIME PROBLEMS AND ESCAPE FROM A POTENTIAL WELL
EXIT TIME PROBLEMS AND ESCAPE FROM A POTENTIAL WELL Exit Time problems and Escape from a Potential Well Escape From a Potential Well There are many systems in physics, chemistry and biology that exist
The Joint Distribution of Server State and Queue Length of M/M/1/1 Retrial Queue with Abandonment and Feedback
The Joint Distribution of Server State and Queue Length of M/M/1/1 Retrial Queue with Abandonment and Feedback Hamada Alshaer Université Pierre et Marie Curie - Lip 6 7515 Paris, France [email protected]
Gene Switches Teacher Information
STO-143 Gene Switches Teacher Information Summary Kit contains How do bacteria turn on and turn off genes? Students model the action of the lac operon that regulates the expression of genes essential for
Performance Analysis of a Telephone System with both Patient and Impatient Customers
Performance Analysis of a Telephone System with both Patient and Impatient Customers Yiqiang Quennel Zhao Department of Mathematics and Statistics University of Winnipeg Winnipeg, Manitoba Canada R3B 2E9
Pricing of an Exotic Forward Contract
Pricing of an Exotic Forward Contract Jirô Akahori, Yuji Hishida and Maho Nishida Dept. of Mathematical Sciences, Ritsumeikan University 1-1-1 Nojihigashi, Kusatsu, Shiga 525-8577, Japan E-mail: {akahori,
Radioactivity III: Measurement of Half Life.
PHY 192 Half Life 1 Radioactivity III: Measurement of Half Life. Introduction This experiment will once again use the apparatus of the first experiment, this time to measure radiation intensity as a function
Nonparametric adaptive age replacement with a one-cycle criterion
Nonparametric adaptive age replacement with a one-cycle criterion P. Coolen-Schrijner, F.P.A. Coolen Department of Mathematical Sciences University of Durham, Durham, DH1 3LE, UK e-mail: [email protected]
Optimal order placement in a limit order book. Adrien de Larrard and Xin Guo. Laboratoire de Probabilités, Univ Paris VI & UC Berkeley
Optimal order placement in a limit order book Laboratoire de Probabilités, Univ Paris VI & UC Berkeley Outline 1 Background: Algorithm trading in different time scales 2 Some note on optimal execution
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
Implementing the combing method in the dynamic Monte Carlo. Fedde Kuilman PNR_131_2012_008
Implementing the combing method in the dynamic Monte Carlo Fedde Kuilman PNR_131_2012_008 Faculteit Technische Natuurwetenschappen Implementing the combing method in the dynamic Monte Carlo. Bachelor End
MAINTAINED SYSTEMS. Harry G. Kwatny. Department of Mechanical Engineering & Mechanics Drexel University ENGINEERING RELIABILITY INTRODUCTION
MAINTAINED SYSTEMS Harry G. Kwatny Department of Mechanical Engineering & Mechanics Drexel University OUTLINE MAINTE MAINTE MAINTAINED UNITS Maintenance can be employed in two different manners: Preventive
Understanding the dynamics and function of cellular networks
Understanding the dynamics and function of cellular networks Cells are complex systems functionally diverse elements diverse interactions that form networks signal transduction-, gene regulatory-, metabolic-
Online Appendix to Stochastic Imitative Game Dynamics with Committed Agents
Online Appendix to Stochastic Imitative Game Dynamics with Committed Agents William H. Sandholm January 6, 22 O.. Imitative protocols, mean dynamics, and equilibrium selection In this section, we consider
Reaction Engineering of Polymer Electrolyte Membrane Fuel Cells
Reaction Engineering of Polymer Electrolyte Membrane Fuel Cells A new approach to elucidate the operation and control of Polymer Electrolyte Membrane (PEM) fuel cells is being developed. A global reactor
University of Maryland Fraternity & Sorority Life Spring 2015 Academic Report
University of Maryland Fraternity & Sorority Life Academic Report Academic and Population Statistics Population: # of Students: # of New Members: Avg. Size: Avg. GPA: % of the Undergraduate Population
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
RNA Structure and folding
RNA Structure and folding Overview: The main functional biomolecules in cells are polymers DNA, RNA and proteins For RNA and Proteins, the specific sequence of the polymer dictates its final structure
STUDENT VERSION INSECT COLONY SURVIVAL OPTIMIZATION
STUDENT VERSION INSECT COLONY SURVIVAL OPTIMIZATION STATEMENT We model insect colony propagation or survival from nature using differential equations. We ask you to analyze and report on what is going
Monte Carlo Methods in Finance
Author: Yiyang Yang Advisor: Pr. Xiaolin Li, Pr. Zari Rachev Department of Applied Mathematics and Statistics State University of New York at Stony Brook October 2, 2012 Outline Introduction 1 Introduction
PHYSICAL REVIEW LETTERS
PHYSICAL REVIEW LETTERS VOLUME 86 28 MAY 21 NUMBER 22 Mathematical Analysis of Coupled Parallel Simulations Michael R. Shirts and Vijay S. Pande Department of Chemistry, Stanford University, Stanford,
Limitations of Equilibrium Or: What if τ LS τ adj?
Limitations of Equilibrium Or: What if τ LS τ adj? Bob Plant, Laura Davies Department of Meteorology, University of Reading, UK With thanks to: Steve Derbyshire, Alan Grant, Steve Woolnough and Jeff Chagnon
CHAPTER 6: Continuous Uniform Distribution: 6.1. Definition: The density function of the continuous random variable X on the interval [A, B] is.
Some Continuous Probability Distributions CHAPTER 6: Continuous Uniform Distribution: 6. Definition: The density function of the continuous random variable X on the interval [A, B] is B A A x B f(x; A,
Nuclear Physics. Nuclear Physics comprises the study of:
Nuclear Physics Nuclear Physics comprises the study of: The general properties of nuclei The particles contained in the nucleus The interaction between these particles Radioactivity and nuclear reactions
MATH4427 Notebook 2 Spring 2016. 2 MATH4427 Notebook 2 3. 2.1 Definitions and Examples... 3. 2.2 Performance Measures for Estimators...
MATH4427 Notebook 2 Spring 2016 prepared by Professor Jenny Baglivo c Copyright 2009-2016 by Jenny A. Baglivo. All Rights Reserved. Contents 2 MATH4427 Notebook 2 3 2.1 Definitions and Examples...................................
Integrating DNA Motif Discovery and Genome-Wide Expression Analysis. Erin M. Conlon
Integrating DNA Motif Discovery and Genome-Wide Expression Analysis Department of Mathematics and Statistics University of Massachusetts Amherst Statistics in Functional Genomics Workshop Ascona, Switzerland
Fractional approaches to dielectric broadband spectroscopy
Fractional approaches to dielectric broadband spectroscopy Simon Candelaresi, Rudolf Hilfer ICP, Uni Stuttgart 2008-02-26 Overview Dielectric Broadband Spectroscopy Use composite fractional time evolution
Online Appendix. Supplemental Material for Insider Trading, Stochastic Liquidity and. Equilibrium Prices. by Pierre Collin-Dufresne and Vyacheslav Fos
Online Appendix Supplemental Material for Insider Trading, Stochastic Liquidity and Equilibrium Prices by Pierre Collin-Dufresne and Vyacheslav Fos 1. Deterministic growth rate of noise trader volatility
4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?
Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.
Second Order Systems
Second Order Systems Second Order Equations Standard Form G () s = τ s K + ζτs + 1 K = Gain τ = Natural Period of Oscillation ζ = Damping Factor (zeta) Note: this has to be 1.0!!! Corresponding Differential
Topic 2: Energy in Biological Systems
Topic 2: Energy in Biological Systems Outline: Types of energy inside cells Heat & Free Energy Energy and Equilibrium An Introduction to Entropy Types of energy in cells and the cost to build the parts
Disease Transmission Networks
Dynamics of Disease Transmission Networks Winfried Just Ohio University Presented at the workshop Teaching Discrete and Algebraic Mathematical Biology to Undergraduates MBI, Columbus, OH, July 31, 2013
BIOE 370 1. Lotka-Volterra Model L-V model with density-dependent prey population growth
BIOE 370 1 Populus Simulations of Predator-Prey Population Dynamics. Lotka-Volterra Model L-V model with density-dependent prey population growth Theta-Logistic Model Effects on dynamics of different functional
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
Transcription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
Non-equilibrium Thermodynamics
Chapter 2 Non-equilibrium Thermodynamics 2.1 Response, Relaxation and Correlation At the beginning of the 21st century, the thermodynamics of systems far from equilibrium remains poorly understood. However,
Generating Random Numbers Variance Reduction Quasi-Monte Carlo. Simulation Methods. Leonid Kogan. MIT, Sloan. 15.450, Fall 2010
Simulation Methods Leonid Kogan MIT, Sloan 15.450, Fall 2010 c Leonid Kogan ( MIT, Sloan ) Simulation Methods 15.450, Fall 2010 1 / 35 Outline 1 Generating Random Numbers 2 Variance Reduction 3 Quasi-Monte
Real-time PCR: Understanding C t
APPLICATION NOTE Real-Time PCR Real-time PCR: Understanding C t Real-time PCR, also called quantitative PCR or qpcr, can provide a simple and elegant method for determining the amount of a target sequence
The Dynamics of a Genetic Algorithm on a Model Hard Optimization Problem
The Dynamics of a Genetic Algorithm on a Model Hard Optimization Problem Alex Rogers Adam Prügel-Bennett Image, Speech, and Intelligent Systems Research Group, Department of Electronics and Computer Science,
Section A. Index. Section A. Planning, Budgeting and Forecasting Section A.2 Forecasting techniques... 1. Page 1 of 11. EduPristine CMA - Part I
Index Section A. Planning, Budgeting and Forecasting Section A.2 Forecasting techniques... 1 EduPristine CMA - Part I Page 1 of 11 Section A. Planning, Budgeting and Forecasting Section A.2 Forecasting
MDM. Metabolic Drift Mutations - Attenuation Technology
MDM Metabolic Drift Mutations - Attenuation Technology Seite 2 Origin of MDM attenuation technology Prof. Dr. Klaus Linde Pioneer in R&D of human and animal vaccines University of Leipzig Germany Origin
Problem Solving 8: RC and LR Circuits
MASSACHUSETTS INSTITUTE OF TECHNOLOGY Department of Physics Problem Solving 8: RC and LR Circuits Section Table and Group (e.g. L04 3C ) Names Hand in one copy per group at the end of the Friday Problem
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
Lecture 13 Linear quadratic Lyapunov theory
EE363 Winter 28-9 Lecture 13 Linear quadratic Lyapunov theory the Lyapunov equation Lyapunov stability conditions the Lyapunov operator and integral evaluating quadratic integrals analysis of ARE discrete-time
Graph theoretic approach to analyze amino acid network
Int. J. Adv. Appl. Math. and Mech. 2(3) (2015) 31-37 (ISSN: 2347-2529) Journal homepage: www.ijaamm.com International Journal of Advances in Applied Mathematics and Mechanics Graph theoretic approach to
13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
RANDOM INTERVAL HOMEOMORPHISMS. MICHA L MISIUREWICZ Indiana University Purdue University Indianapolis
RANDOM INTERVAL HOMEOMORPHISMS MICHA L MISIUREWICZ Indiana University Purdue University Indianapolis This is a joint work with Lluís Alsedà Motivation: A talk by Yulij Ilyashenko. Two interval maps, applied
An exact formula for default swaptions pricing in the SSRJD stochastic intensity model
An exact formula for default swaptions pricing in the SSRJD stochastic intensity model Naoufel El-Bachir (joint work with D. Brigo, Banca IMI) Radon Institute, Linz May 31, 2007 ICMA Centre, University
Chapter 13 Introduction to Nonlinear Regression( 非 線 性 迴 歸 )
Chapter 13 Introduction to Nonlinear Regression( 非 線 性 迴 歸 ) and Neural Networks( 類 神 經 網 路 ) 許 湘 伶 Applied Linear Regression Models (Kutner, Nachtsheim, Neter, Li) hsuhl (NUK) LR Chap 10 1 / 35 13 Examples
2.500 Threshold. 2.000 1000e - 001. Threshold. Exponential phase. Cycle Number
application note Real-Time PCR: Understanding C T Real-Time PCR: Understanding C T 4.500 3.500 1000e + 001 4.000 3.000 1000e + 000 3.500 2.500 Threshold 3.000 2.000 1000e - 001 Rn 2500 Rn 1500 Rn 2000
Hedging Options In The Incomplete Market With Stochastic Volatility. Rituparna Sen Sunday, Nov 15
Hedging Options In The Incomplete Market With Stochastic Volatility Rituparna Sen Sunday, Nov 15 1. Motivation This is a pure jump model and hence avoids the theoretical drawbacks of continuous path models.
Chemical Kinetics. Reaction Rate: The change in the concentration of a reactant or a product with time (M/s). Reactant Products A B
Reaction Rates: Chemical Kinetics Reaction Rate: The change in the concentration of a reactant or a product with time (M/s). Reactant Products A B change in number of moles of B Average rate = change in
Universitätsstrasse 1, D-40225 Düsseldorf, Germany 3 Current address: Institut für Festkörperforschung,
Lane formation in oppositely charged colloidal mixtures - supplementary information Teun Vissers 1, Adam Wysocki 2,3, Martin Rex 2, Hartmut Löwen 2, C. Patrick Royall 1,4, Arnout Imhof 1, and Alfons van
THE DYING FIBONACCI TREE. 1. Introduction. Consider a tree with two types of nodes, say A and B, and the following properties:
THE DYING FIBONACCI TREE BERNHARD GITTENBERGER 1. Introduction Consider a tree with two types of nodes, say A and B, and the following properties: 1. Let the root be of type A.. Each node of type A produces
Part 2: Analysis of Relationship Between Two Variables
Part 2: Analysis of Relationship Between Two Variables Linear Regression Linear correlation Significance Tests Multiple regression Linear Regression Y = a X + b Dependent Variable Independent Variable
Decay of Radioactivity. Radioactive decay. The Math of Radioactive decay. Robert Miyaoka, PhD. Radioactive decay:
Decay of Radioactivity Robert Miyaoka, PhD [email protected] Nuclear Medicine Basic Science Lectures https://www.rad.washington.edu/research/research/groups/irl/ed ucation/basic-science-resident-lectures/2011-12-basic-scienceresident-lectures
e.g. arrival of a customer to a service station or breakdown of a component in some system.
Poisson process Events occur at random instants of time at an average rate of λ events per second. e.g. arrival of a customer to a service station or breakdown of a component in some system. Let N(t) be
STCE. Fast Delta-Estimates for American Options by Adjoint Algorithmic Differentiation
Fast Delta-Estimates for American Options by Adjoint Algorithmic Differentiation Jens Deussen Software and Tools for Computational Engineering RWTH Aachen University 18 th European Workshop on Automatic
