Dr Alessandro Fatica (on behalf of Prof. Irene Bozzoni)
|
|
- Sherilyn McLaughlin
- 8 years ago
- Views:
Transcription
1 Dr Alessandro Fatica (on behalf of Prof. Irene Bozzoni) non coding RNAs in human diseases ROUND TABLE ITALY RUSSIA Dubna, December 2010
2 Where is the information that programs our complexity? The biggest surprise of the genome sequencing projects was the discovery that the number of protein-coding genes does not scale strongly or consistently with complexity. Humans (and other vertebrates) have approximately the same number of protein-coding genes (~20,000) as C. elegans, and less than those of plants (Arabidopsis ~28,000, rice ~40,000) and protozoa (~30,000). Most of the proteins are orthologous and have similar functions from nematodes to humans, and many are common with yeast.
3 The proportion of non-coding DNA broadly increases with developmental complexity >90% 40%-70% <1% Vertebrates Ciona (urochordate) Invertebrates Plants Complex fungi (Neurospora) Simple eukaryotes (yeasts, plasmodium, Dictyostelium) Prokaryotes Vertebrates Urochordate Invertebrates Plants Complex fungi Simple eukaryotes Prokaryotes Mattick et al. Trends Genetics (2010).
4 Non coding RNAs (ncrnas) in human Genome >90% RNA 2% 98% mrnas non coding RNAs 5000 nt length Proteins rrnas large long ncrnas with mostly unkonwn function ncrnas ~100 nt trnas snrnas snornas rrnas small nt micrornas piwirnas endo-sirna. tiny
5 Functions of regulatory ncrnas Chromatin modification and epigenetic memory Transcriptional regulation Splicing RNA modification and editing Control of mrna turnover Control of mrna translation Amaral et al., Science
6 Our interests 1. ncrnas as therapeutic tools 2. ncrnas in gene regulatory networks
7 1.ncRNAs as therapeutic tools ncrna can be engineered in order to produce molecules that can interfere with gene expression in a sequencespecific way Therapeutic ncrnas: Antisense Aptamers Ribozymes Modifying RNAs RNA interference micrornas
8 1.ncRNAs as therapeutic tools ncrna can be engineered in order to produce molecules that can interfere with gene expression in a sequencespecific way Therapeutic ncrnas: Antisense Aptamers Ribozymes Modifying RNAs RNA interference micrornas
9 Antisense RNAs as therapeutic molecules in Duchenne Muscular Dystrophy
10 Duchenne Muscular Dystrophy (DMD) is a severe disorder characterized by rapid progression of muscle degeneration, leading to loss of ambulation and death. X-linked recessive disorder that affects 1 in 3500 live males Histopathology of a Duchenne muscle
11 Dystrophin-The LONGEST GENE of our genome Patients with DMD are deficient in dystrophin, a protein that connects the cytoskeleton of a muscle fiber to the surrounding extraxellular matrix this deficiency causes sarcolemmal instability and muscle degeneration 2,5 Mb genomic locus 14 kb mature mrna (79 exons) 427 kd protein
12 Duchenne Muscular Dystrophy - the deletion - DMD is caused by mutations in the Dystrophin gene that alter the pre-mrna splicing and disrupt the open reading frame of the proteins, producing premature stop codons and mrna degradation CUA AG CUG AAU G CAA Pre-mRNA Splicing out of frame fusion STOP CUA AGCUGAAU G CAA mrna DMD Translation Protein
13 The Exon skypping By skypping the out of frame exon, we can produce a shorter dystrophin protein, converting the DMD phenotype to a Becker phenotype (BMD), a milder form of muscular dystrophy with near-normal life expectancy CUA AG CUG AAU G CAA STOP Splicing Pre-mRNA in frame fusion CUA AGG CAA mrna BMD Translation Protein
14 U1 snrna U2 snrna U4 snrna U5 snrna U6 snrna Pre-mRNA Splicing
15 RNA technology applied to the correction of DMD mutations Antisense RNA can be used to mask motifs involved in normal splicing to induce removal of specific exons snrnp antisense RNA U 1 Ex Exon 1 Exon 2 Exon 3 Pre-mRNA 5 3 Exon 1 Exon 3 mrna w/o exon 2 75% of all known dystrophin mutations can be cured by exon skipping
16 Chimeric U1-exon skippingconstructs STOP - Nuclear localization - Localizes at splice sites - Short expression cassette - Stable expression - No immunogen
17 Exon skyppping in mdx mouse U1#23 Exon 22 Exon 23 Exon 24 Exon 22 Exon 24
18 Dystrophin rescue upon AAV-U1#23 delivery AAV-U1#23 WT mdx Dystrophin Specific force of single muscle fibers Denti et al., Hum Gene Therapy; Denti et al., 2006 PNAS; Denti et al., Hum Gene Therapy
19 Towards clinical trilas on human U1-antisense patent licensed to AMT (Amsterdam Molecular Therapeutics) September 2009 Orphan drug designation by EMEA October Orphan drug designation by FDA
20 Work in progress Improving AAV serotypes and production (AMT) Toxicity and delivery studies in pigs (AMT) Testing new constructs for different human mutations (Sapienza Univ.) Testing exon skipping in human primary cells from DMD patients (Sapienza Univ.)
21 micrornas
22 Human micrornas A novel class of ~20-22 nt long ncrnas. Unknown before 2001 in human distinct micrornas have been identified in human since 2001 (data from MiRBase Release 16.0) Negatively regulate the translation/stability of mrnas By pairing with mrnas they can target almost 50% of all human coding genes mirnas participate in the regulation of almost every cellular process investigated so far Changes in their expression are associated with many human pathologies
23 mirna biogenesis mismatched interaction perfect complementarity
24 mirnas and their targets form complex regulatory networks One microrna can control hundreds different mrnas etc. A single mrna can be controlled by more than one microrna AAAAA
25 mirnas and their targets form complex regulatory networks Different combinations of micrornas can regulate different sets of mrnas etc. mrna-1 mrna-1 mrna-1 mrna-2 mrna-2 mrna-2 mrna-3 mrna-3 mrna-3 mrna-4 mrna-4 mrna-4 Major advantages of microrna regulation Networking and fine-tuning of gene expression Rapid repression
26 1. microrna expression profiling under physiological and pathological conditions: - microarray - qrt-pcr cards - deep sequencing 1. microrna expression regulation (e.g. promoter identification,trans acting factor involvement): - Chromatin immuprecipitation - Luc Reporters Lab interests 2. identification of microrna targets - Stable isotope labeling with amino acids in cell culture (SILAC) - Luc Reporters
27 Model systems for microrna function A. MicroRNA profiling 1.Muscle cells: Disease: normal vs pathological Duchenne muscular dystrophy 2. Hematopoietic cells : normal vs pathological Acute Myeloid Leukemia 3. Neuronal cells: normal vs pathological Neuroblastoma tumors Amyotrophic lateral sclerosis
28 micrornas as biomarkers E.g. profiling of muscle specific microrna in the serum of DMD patients as diagnostic and prognostic tools correlation with clinical assessments monitoring gene therapy fold with respect to WT
29 Model systems for microrna function B. Gene regulatory network controlled by micrornas 1.Myoblast differentiation: Myoblasts Myotubes 2. Myeloid differentiation: Leukemia cell lines Granulocytes or Moncytes 3. Neuronal differentiation: Neuroblastoma cell lines Neurons
30 Identifying networks 1) Forward Differentiation mirna profiling Relevant mirna(s) Computational prediction Gain of function Loss of funtion Target Gene(s) ID 2) Reverse Phenotype Gain of function Loss of funtion Relevant mirna(s) Computational prediction Gene function
31 Identification of mirna regulatory networks in muscle cell differentiation mir-206 mir- 31 Pax7 Dys mir-206: promote muscle stem cell differentiation mir-31: avoid the expression of late differentiation markers Cacchiarelli et al., Cell Metabolism.
32 Identification of mirna regulatory networks in myeloid differentiation AML CD34+ Granulocyte Monocyte 1. Transcription factors microrna gene Differentiation 1. C/EBPα PU.1 c-myc 2. micrornas 3. relevant target mrnas 3. NFIA 2. mir-223 mir-424 mir-342 mir-26 De Marchis et al., Leukemia; Rosa et al., PNAS; Fazi et al., Cell
33 Identification of mirna regulatory networks in neuronal differentiation neuroblastoma cells 1. Transcription factors microrna gene Differentiation neurons 1. REST CREB SP1 2. micrornas 3. relevant mrna targets 2. mir-9 mir-125a mir-125b mir-103 mir-100 mir-324 mir trkc ID2 Smo Laneve et al., NAR; Ferretti et al., Int J Cancer; Ferretti et al., EMBO J; Laneve et al J Biol Chem; Laneve et al., PNAS.
34 Prof. Irene Bozzoni group Duchenne Muscular Dystrophy Acute Myeloid Leukemia Amyotrophic lateral sclerosis Neuroblastoma Davide Cacchiarelli Julie Martone Marcella Cesana Valentina Cazzella Chiara Pinnarò Ivano legnini Olga Sthandier Beatrice Salvatori Arianna Mangiavacchi Marcella Marchioni Alessandro Fatica Stefano Dini Modigliani Giulia Torrelli Alessandro Rosa Mariangela Morlando Ubaldo Gioia Valerio Di Carlo Valeria Bevilacqua Antonella Cinquino Elisa Caffarelli
The world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
More informationHuman Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
More informationThe RNA strategy. RNA as a tool and target in human disease diagnosis and therapy.
The RNA strategy RNA as a tool and target in human disease diagnosis and therapy. The Laboratory of RNA Biology and Biotechnology at the Centre for Integrative Biology (CIBIO) of the University of Trento,
More informationMicro RNAs: potentielle Biomarker für das. Blutspenderscreening
Micro RNAs: potentielle Biomarker für das Blutspenderscreening micrornas - Background Types of RNA -Coding: messenger RNA (mrna) -Non-coding (examples): Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear
More informationMuscular dystrophy clinical manifestations: progressive proximal extremity weakness respiratory muscle weakness cardiomyopathy
Muscular dystrophy clinical manifestations: progressive proximal extremity weakness respiratory muscle weakness cardiomyopathy Muscular dystrophy pathology: muscle fiber degeneration and regeneration Muscular
More informationProtein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
More informationV22: involvement of micrornas in GRNs
What are micrornas? V22: involvement of micrornas in GRNs How can one identify micrornas? What is the function of micrornas? Elisa Izaurralde, MPI Tübingen Huntzinger, Izaurralde, Nat. Rev. Genet. 12,
More informationControl of Gene Expression
Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure
More informationBecker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
More informationJust the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
More informationOutline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction
Outline MicroRNA Bioinformatics Rickard Sandberg Dept. of Cell and Molecular Biology (CMB) Karolinska Institutet! Introduction! microrna target site prediction! Useful resources 2 short non-coding RNAs
More informationControl of Gene Expression
Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems
More informationGene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
More informationmicrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved
microrna 2 micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved Regulate gene expression by binding complementary regions at 3 regions of target mrnas Act as negative
More informationLecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: b.patel@griffith.edu.au What is Gene Expression & Gene Regulation? 1. Gene Expression
More information13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
More informationLezioni Dipartimento di Oncologia Farmacologia Molecolare. RNA interference. Giovanna Damia 29 maggio 2006
Lezioni Dipartimento di Oncologia Farmacologia Molecolare RNA interference Giovanna Damia 29 maggio 2006 RNA INTERFERENCE Sequence-specific gene suppression by dsrnas Gene silencing by dsrna: C. elegans
More information1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
More informationMuscular Dystrophy: Stem Cell Therapy
by Caitlin Pederson Abstract: Genetic disorders affect many people, and muscular dystrophy is a disorder that can greatly decrease the quality of life. Finding treatment to stop or prevent the loss of
More informationName Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
More informationAn Overview of Cells and Cell Research
An Overview of Cells and Cell Research 1 An Overview of Cells and Cell Research Chapter Outline Model Species and Cell types Cell components Tools of Cell Biology Model Species E. Coli: simplest organism
More informationLecture 3: Mutations
Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between
More informationStructure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
More informationRNAi Shooting the Messenger!
RNAi Shooting the Messenger! Bronya Keats, Ph.D. Department of Genetics Louisiana State University Health Sciences Center New Orleans Email: bkeats@lsuhsc.edu RNA interference (RNAi) A mechanism by which
More informationDNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
More informationFunctional and Biomedical Aspects of Genome Research
Functional and Biomedical Aspects of Genome Research 20 11 35 Vorlesung SS 04 Bartsch, Jockusch & Schmitt-John Mi. 9:15-10:00, in W7-135 13 Functional RNAs Thomas Schmitt-John micro RNAs small interfering
More informationLecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
More informationA role of microrna in the regulation of telomerase? Yuan Ming Yeh, Pei Rong Huang, and Tzu Chien V. Wang
A role of microrna in the regulation of telomerase? Yuan Ming Yeh, Pei Rong Huang, and Tzu Chien V. Wang Department of Molecular and Cellular Biology, Chang Gung University, Kwei San, Tao Yuan 333, Taiwan
More informationGenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
More informationLucia Migliore. Transfer of recent evidences concerning genetic and epigenetic risk factors of complex diseases on clinical practice
Lucia Migliore Transfer of recent evidences concerning genetic and epigenetic risk factors of complex diseases on clinical practice Dipartimento di Ricerca Traslazionale e Nuove Tecnologie in Medicina
More informationDIPARTIMENTO di SCIENZE BIOMEDICHE e BIOTECNOLOGICHE
July 15, 2015 Science editor of World Journal of Gastroenterology Jing Yu Email: j.yu@wjgnet.com Dear Prof. Jing Yu, please find enclosed a revised version of our paper Non-coding landscapes of Colorectal
More informationBiological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
More informationGenetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
More informationHow To Understand How Gene Expression Is Regulated
What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation
More informationBasic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
More information岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹 20100803
技 術 專 員 費 軫 尹 20100803 Overview of presentation Basic Biology of RNA interference Application of sirna for gene function? How to study mirna? How to deliver sirna and mirna? New prospects on RNAi research
More informationPart 1: Exon Skipping.
Research approaches for a Therapy of Duchenne Muscular Dystrophy. Part 1: Exon Skipping. First update, published on the 3 rd of October 2009. This is the first update of my report on exon skipping, originally
More informationFrom DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
More informationOutline. interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work?
Outline Outline interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work? What is RNA interference? Recently discovered regulatory level. Genome immune system.
More informationDIAGNOSING CHILDHOOD MUSCULAR DYSTROPHIES
DIAGNOSING CHILDHOOD MUSCULAR DYSTROPHIES Extracts from a review article by KN North and KJ Jones: Recent advances in diagnosis of the childhood muscular dystrophies Journal of Paediatrics and Child Health
More informationDiscovery & Modeling of Genomic Regulatory Networks with Big Data
Discovery & Modeling of Genomic Regulatory Networks with Big Data Hamid Bolouri Division of Human Biology Fred Hutchinson Cancer Research Center labs.fhcrc.org/bolouri I have no financial relationships
More informationSchool of Nursing. Presented by Yvette Conley, PhD
Presented by Yvette Conley, PhD What we will cover during this webcast: Briefly discuss the approaches introduced in the paper: Genome Sequencing Genome Wide Association Studies Epigenomics Gene Expression
More informationmirnaselect pep-mir Cloning and Expression Vector
Product Data Sheet mirnaselect pep-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-C STORAGE: -80ºC QUANTITY: 2 vectors; each contains 100 µl of bacterial glycerol stock Components 1. mirnaselect
More informationFSH Society s 2014 Biennial FSHD Connect Meeting: Natural History Studies
FSH Society s 2014 Biennial FSHD Connect Meeting: Natural History Studies Raymond A. Huml, MS, DVM, RAC Executive Director, Head, Global Biosimilars Business Development and Strategic Planning, Quintiles
More informationSummary of Discussion on Non-clinical Pharmacology Studies on Anticancer Drugs
Provisional Translation (as of January 27, 2014)* November 15, 2013 Pharmaceuticals and Bio-products Subcommittees, Science Board Summary of Discussion on Non-clinical Pharmacology Studies on Anticancer
More informationGene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
More informationSickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes
Protein Structure Polypeptide: Protein: Therefore: Example: Single chain of amino acids 1 or more polypeptide chains All polypeptides are proteins Some proteins contain >1 polypeptide Hemoglobin (O 2 binding
More informationOriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation -Optimal strategies to a successful mirna research project Optimal strategies to a successful mirna research
More informationMUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
More informationRNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
More informationTo be able to describe polypeptide synthesis including transcription and splicing
Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain
More informationEuropean Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
More informationINTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
More informationAppendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
More information7. 2. Regulation of gene expression. Unit 7: Molecular biology and genetics
7. 2 Regulation of gene expression We all start off as one stem cell (a fertilised ovum) that divides to give a ball of cells. These cells then differentiate and become specialised to carry out specific
More informationGene Therapy. The use of DNA as a drug. Edited by Gavin Brooks. BPharm, PhD, MRPharmS (PP) Pharmaceutical Press
Gene Therapy The use of DNA as a drug Edited by Gavin Brooks BPharm, PhD, MRPharmS (PP) Pharmaceutical Press Contents Preface xiii Acknowledgements xv About the editor xvi Contributors xvii An introduction
More informationTranscription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
More informationAP BIOLOGY 2009 SCORING GUIDELINES
AP BIOLOGY 2009 SCORING GUIDELINES Question 4 The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following
More informationProfiling of non-coding RNA classes Gunter Meister
Profiling of non-coding RNA classes Gunter Meister RNA Biology Regensburg University Universitätsstrasse 31 93053 Regensburg Overview Classes of non-coding RNAs Profiling strategies Validation Protein-RNA
More informationComplex Systems BioMedicine: Molecules, Signals, Networks, Diseases
The International School of Advanced Molecular BioMedicine Complex Systems BioMedicine: Molecules, Signals, Networks, Diseases AciTrezza (Catania), Italy, October 2nd-6th, 2009 Hieronymus Bosch: Garden
More informationHuman Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
More informationSystematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh
More informationMir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
More informationMuscular dystrophy: basic facts
Muscular dystrophy: basic facts - heterogenous group of inherited disorders characterized by progressive muscle weakness and wasting (regeneration of muscle tissue fails) - most apparent or symptomatic
More informationModule 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
More informationMicroRNA Mike needs help to degrade all the mrna transcripts! Aaron Arvey ISMB 2010
Target mrna abundance dilutes microrna and sirna activity MicroRNA Mike needs help to degrade all the mrna transcripts! Aaron Arvey ISMB 2010 Target mrna abundance dilutes microrna and sirna activity Erik
More informationTranslation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
More informationPsychoonkology, Sept. 2010 lifestyle factors and epigenetics
Psychoonkology, Sept. 2010 lifestyle factors and epigenetics Alexander G. Haslberger Dep. für Ernährungswissenschaften Univ. of Vienna Working group: Food, GI-Microbiology, Epigenetics Content Health:
More informationmrna EDITING Watson et al., BIOLOGIA MOLECOLARE DEL GENE, Zanichelli editore S.p.A. Copyright 2005
mrna EDITING mrna EDITING http://dbb.urmc.rochester.edu/labs/smith/research_2.htm The number of A to I sites in the human transcriptome >15;000 the vast majority of these sites occurring in Alu repeats
More informationGenetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
More informationIntroduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
More informationThe sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
More informationPathway Analysis : An Introduction
Pathway Analysis : An Introduction Experiments Literature and other KB Data Knowledge Structure in Data through statistics Structure in Knowledge through GO and other Ontologies Gain insight into Data
More informationBiochemistry Major Talk 2014-15. Welcome!!!!!!!!!!!!!!
Biochemistry Major Talk 2014-15 August 14, 2015 Department of Biochemistry The University of Hong Kong Welcome!!!!!!!!!!!!!! Introduction to Biochemistry A four-minute video: http://www.youtube.com/watch?v=tpbamzq_pue&l
More informationtreatments) worked by killing cancerous cells using chemo or radiotherapy. While these techniques can
Shristi Pandey Genomics and Medicine Winter 2011 Prof. Doug Brutlag Chronic Myeloid Leukemia: A look into how genomics is changing the way we treat Cancer. Until the late 1990s, nearly all treatment methods
More informationSommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle
Sommaire projets sélectionnés mesure 29: Soutien à la recherche translationnelle TITLE PROJET NOM HOPITAL Assessment of tumor angiogenesis using PET/CT with 18 F-Galacto- RGD. (PNC_29_001) Division of
More informationFive-year relative survival rates. Cancer. Age-adjusted cancer death rates. Proteomic Technologies for Cancer Biomarker Discovery 2010/3/22
Cancer Five-year relative survival rates Basal lamina Underlyig tissue Normal tissue Carcinoma Invasive carcinoma 1 http://www.cancer.org/docroot/home/index.asp 2 Proteomic Technologies for Cancer Biomarker
More informationBasic Principles of Transcription and Translation
The Flow of Genetic Information The information content of DNA is in the form of specific sequences of nucleotides The DNA inherited by an organism leads to specific traits by dictating the synthesis of
More informationWG5: Informatics. Martin Dugas, Jaakko Hollmen. European Genomics and Epigenomics Study on MDS and AML
WG5: Informatics Martin Dugas, Jaakko Hollmen EuGESMA European Genomics and Epigenomics Study on MDS and AML Presentations from WG5 members Hans Ulrich Klein Detection of Fusion Genes by Targeted Roche
More informationTOOLS sirna and mirna. User guide
TOOLS sirna and mirna User guide Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas)
More informationGenetic Testing for Duchenne and Becker Muscular Dystrophy
Corporate Medical Policy Genetic Testing for Duchenne and Becker Muscular Dystrophy File Name: Origination: Last CAP Review: Next CAP Review: Last Review: genetic_testing_for_duchenne_and_becker_muscular_dystrophy
More informationHUNTINGTON S DISEASE THERAPIES RESEARCH UPDATE
HUNTINGTON S DISEASE MULTIDISCIPLINARY CLINIC HUNTINGTON S DISEASE THERAPIES RESEARCH UPDATE From gene to treatments The gene that causes Huntington s disease (HD) was discovered in 1993. Since then, enormous
More informationM110.726 The Nucleus M110.727 The Cytoskeleton M340.703 Cell Structure and Dynamics
of Biochemistry and Molecular Biology 1. Master the knowledge base of current biochemistry, molecular biology, and cellular physiology Describe current knowledge in metabolic transformations conducted
More informationBiotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
More informationGENE REGULATION. Teacher Packet
AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures
More informationA Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
More informationPART 3.3: MicroRNA and Cancer
BIBM 2010 Tutorial: Epigenomics and Cancer PART 3.3: MicroRNA and Cancer Dec 18, 2010 Sun Kim at Indiana University Outline of Part 3.3 Background on microrna Role of microrna in cancer MicroRNA pathway
More informationAlgorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
More informationNeuromuscular diseases
Neuromuscular diseases Spinal muscular atrophy - SMA characterized by degeneration of the anterior horn cells in the spinal cord and motor nuclei in the lower brainstem. SMA type 1, is also known as Werdnig-
More informationActivity 7.21 Transcription factors
Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation
More informationRNA Structure and folding
RNA Structure and folding Overview: The main functional biomolecules in cells are polymers DNA, RNA and proteins For RNA and Proteins, the specific sequence of the polymer dictates its final structure
More informationGenomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
More informationChapter 18 Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection
More informationOverview of Eukaryotic Gene Prediction
Overview of Eukaryotic Gene Prediction CBB 231 / COMPSCI 261 W.H. Majoros What is DNA? Nucleus Chromosome Telomere Centromere Cell Telomere base pairs histones DNA (double helix) DNA is a Double Helix
More informationGenetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
More informationCancer Genomics: What Does It Mean for You?
Cancer Genomics: What Does It Mean for You? The Connection Between Cancer and DNA One person dies from cancer each minute in the United States. That s 1,500 deaths each day. As the population ages, this
More informationLEUKEMIA LYMPHOMA MYELOMA Advances in Clinical Trials
LEUKEMIA LYMPHOMA MYELOMA Advances in Clinical Trials OUR FOCUS ABOUT emerging treatments Presentation for: Judith E. Karp, MD Advancements for Acute Myelogenous Leukemia Supported by an unrestricted educational
More informationAnalysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics
Analysis and Integration of Big Data from Next-Generation Genomics, Epigenomics, and Transcriptomics Christopher Benner, PhD Director, Integrative Genomics and Bioinformatics Core (IGC) idash Webinar,
More informationCell Biology Questions and Learning Objectives
Cell Biology Questions and Learning Objectives (with hypothetical learning materials that might populate the objective) The topics and central questions listed here are typical for an introductory undergraduate
More informationRecombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
More information