TOOLS sirna and mirna. User guide

Save this PDF as:

Size: px
Start display at page:

Download "TOOLS sirna and mirna. User guide"


1 TOOLS sirna and mirna User guide

2 Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas) are short, double-stranded RNA molecules that bind specific messenger RNA (mrna) molecules and decrease their activities by preventing an mrna from producing a protein. TOOLS sirna oligos undergo vigorous process monitoring and strict quality control, produce under ISO9000 quality standard system. Chemical Modified sirna exhibits greater longevity in cell culture and stability in cell culture and in serum, enhancing the ability for this to be used for in vivo applications and has much more extensional effective time than Standard sirna. TOOLS in vitro/vivo mirna mimics inhibitors are chemically-modified and optimized nucleic acids designed to specifically target the microrna (mirna) molecules in animals. Endogenous micrornas are small, regulatory RNAs that are expressed in animals and plants that affect the translation of target mrnas. The mature nucleotide, single-stranded mirnas specifically target a protein complex to regulate translation at the level of mrna. Specifications Products (1 OD) sirna mirna mimics mirna inhibitor nmol Molecular weight ~13300 ~13300 ~6500 weight 33 ug 33 ug 33 ug Concentration 20 um (20 pmol/ul) 20 um (20 pmol/ul) 20 um (20 pmol/ul) (when adding 125 ul H 2O) (when adding 125 ul H 2O) (when adding 250 ul H 2O) 1

3 Ordering information sirna In vitro sirna or chemically-modified sirna In vivo sirna or chemically-modified sirna Negative Control sirna FAM Negative Control sirna Positive Control sirna sirna set (Guaranteed >70% knock-down in mrna level) 3 x 1OD target sirna 1 x 0.5OD negative control sirna 1 x 0.5OD FAM labeled negative control sirna 1 x 0.5OD positive control sirna Chemically-modified sirna set(guaranteed >70% knock-down in mrna level) 3 x 1OD Chemically-modified target sirna 1 x 0.5OD negative control sirna 1 x 0.5OD FAM labeled negative control sirna 1 x 0.5OD positive control sirna 2OD/4OD/8OD 1OD 1OD 1OD mirna mimics & inhibitors In vitro mirna mimics In vitro mirna mimics negative control In vitro chemically-modified mirna inhibitor In vitro chemically-modified mirna inhibitor negative control In vivo chemically-modified mirna mimics In vivo chemically-modified mirna inhibitor In vivo mirna mimics & inhibitor negative control 2OD/4OD 2OD 2OD/4OD 2OD 2

4 sirna transfection guide: Cell Culture Before Transfection It is advised that before starting your transfection experiment, put your cells on your cell plate, then add proper culture medium, lastly incubate cells for 24 hrs to be 70%-90% by confluence. Transfection reagent: TOOLSoothFect transfection reagent (Cat.No. NFT-KA00) Culture vessel Surface Area (mm 2 /well) Cell Density Volume of plating Medium(ul/well) 96-well x x ul 48-well x x ul 24-well x x ul 12-well x x ml 6-well x x ml 35 mm x x ml 60 mm x x ml Culture vessel sirna Volume of plating Transfection reagent mediun (ul/well) 96-well 5 pmol 100ul 0.25 ul 24-well 20 pmol 500ul 1 ul 12-well 40 pmol 1ml 2 ul 6-well 100 pmol 2ml 5 ul 35 mm 100 pmol 2ml 5 ul 60 mm 600 pmol 5ml 10 ul mirna mimics or inhibitor transfection guide: mirna Culture Dish Transfection reagent (mimics or inhibitor) Cell density (cells/well) Final volume (per well) 96-well ul 3 pmol ml 24-well ul 15 pmol ml 12-well 1-3 ul 30 pmol ml 6-well 2-5 ul 75 pmol ml 3

5 In vivo sirna delivery guide: Delivery route (dissolve in vivo sirna in PBS or RNase free water or OptiMEM) Intravenous Intraperitoneal Intracranial Systemic delivery dosage: nmol/g body weight Mice (body weight 15-20g): 3-4 nmol (40-50ug) Rat (body weight g): nmol ( ug) A sirna dose of 5mg/kg/day is recommended as a starting point for experiments. In vivo mirna (mimics or inhibitor) delivery guide: Delivery route (dissolve in vivo mirna in PBS or normal saline:) Intravenous Intraperitoneal Intracranial 5-80ug/g body weight or 200nmol(3 times) Local delivery: 1-10nmol(0.5-4OD), volume: 30ul~100ul; TOOLS mirna modification example: hsa-mir-137 agomirs sense : 5' UUAUUGCUUAAGAAUACGCGUAG 3' antisense: 5' AsCsGCGUAUUCUUAAGCAAUAsAsUsUs-Chol- 3' Storage Store TOOLS sirna or mirna at 20 C 4

6 sirna or mirna FAQs : What is the best method of delivering sirnas into the cell? There are several methods that are used for delivering sirnas into cells including lipid-based transfection, electroporation, calcium phosphate co-precipitation, microinjection and vector delivery techniques. The choice between these methods is often a result of several factors including the ability of the cells to tolerate the delivery method, susceptibility to viral infection, and the growth properties of the cells. Although lipid-based transfection is one of the more commonly used methods for adherent cells, suspension cells are often more difficult to transfect and generally have higher rates of delivery with electroporation techniques. Is there a quick method for monitoring transfection efficiency? TOOLS has developed several options including a family of fluorescent-labeled sirnas and a novel RNA-based reagent known as sirna transfection Control. The uptake of sirnas can be visualized with the appropriate filters on a confocal microscope or by flow cytometry. Alternatively, fluorescent-labeled sirna is cytotoxic when successfully delivered into cells. Cells that have efficiently taken up this transfection control typically undergo apoptosis within 24 to 48 hours. This phenotypic outcome can easily be monitored using standard cell viability methods (e.g., alamarblue, MTT cytotoxicity, Trypan Blue dye exclusion, JC1 dye, or other appropriate assays). What is the best time-frame for monitoring sirna-dependent decreases in target mrna expression levels? In target protein levels? Generally, target mrna levels are decreased after 24 hours post-transfection following transfection of a gene-specific sirna duplex. However, maximal silencing may be reached at a later time point, so it is advisable to assay target mrna in a time-course study. In most cases, silencing will be maximal at 24 to 48 hours following transfection. Cellular target protein levels should be examined starting at 24 hours and assayed until a minimum level is noted, often 48 to 96 hours or greater. As always, it is important to verify transfection efficiency using an appropriate positive control. If there is no decrease in protein levels within this time frame, it may be necessary to perform a second sirna transfection, use a stabilized sirna, or develop a vector-based silencing cassette that can continuously produce the sirna for extended periods of time. 5

HiPerFect Transfection Reagent Handbook

HiPerFect Transfection Reagent Handbook Fifth Edition October 2010 HiPerFect Transfection Reagent Handbook For transfection of eukaryotic cells with sirna and mirna Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the

More information

Instructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control

Instructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control is a is a state of the art transfection reagent, specifically designed for the transfer of sirna and mirna into a variety of eukaryotic cell types. is a state of the art transfection reagent, specifically

More information

岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹 20100803

岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹 20100803 技 術 專 員 費 軫 尹 20100803 Overview of presentation Basic Biology of RNA interference Application of sirna for gene function? How to study mirna? How to deliver sirna and mirna? New prospects on RNAi research

More information

Dicer Substrate RNAi Design

Dicer Substrate RNAi Design INTEGRATED DNA TECHNOLOGIES, INC. Dicer Substrate RNAi Design How to design and order 27-mer Dicer-substrate Duplex RNAs for use as RNA interference reagents The following document provides a summary of

More information

MicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control

MicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control MicroRNA formation mirna s are processed from several precursor stages Mammalian genomes seem to have 100 s of mirna s Nucleotides in positions 2-8 of an mirna are considered the mirna seed 5 Methyl-G

More information


CODICE DESCRIZIONE QUANTITA' PREZZO EURO Broad Spectrum Plasmid DNA and sirna/mirna Transfection MIR 6000 TransIT-X2 Dynamic Delivery System 1.5 ml 823,35 MIR 6003 TransIT-X2 Dynamic Delivery System 0.3 ml 196,35 MIR 6004 TransIT-X2 Dynamic Delivery

More information

Functional and Biomedical Aspects of Genome Research

Functional and Biomedical Aspects of Genome Research Functional and Biomedical Aspects of Genome Research 20 11 35 Vorlesung SS 04 Bartsch, Jockusch & Schmitt-John Mi. 9:15-10:00, in W7-135 13 Functional RNAs Thomas Schmitt-John micro RNAs small interfering

More information

RNAi Shooting the Messenger!

RNAi Shooting the Messenger! RNAi Shooting the Messenger! Bronya Keats, Ph.D. Department of Genetics Louisiana State University Health Sciences Center New Orleans Email: RNA interference (RNAi) A mechanism by which

More information

QIAGEN Transfection Technologies

QIAGEN Transfection Technologies QIAGEN Transfection Technologies Efficient and robust transfection for all your applications Sample & Assay Technologies Table of contents QIAGEN solutions for efficient transfection Transfection is a

More information

Biological Stability and Activity of sirna in Ionic Liquids**

Biological Stability and Activity of sirna in Ionic Liquids** Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Supporting Information Biological Stability and Activity of sirna in Ionic Liquids** Romiza R.

More information

RNAi. Martin Latterich

RNAi. Martin Latterich RNAi Martin Latterich Contributors Abbreviations Preface i x ( xi xiii 1 Methods in RNA interference 1 Martin Latterich and Dalia Halawan i References 2 2 RNAi reagent design 3 Bernd Jagla and Nathalie

More information

Especially developed for the transfection of mammalian cells with sirna or mirna

Especially developed for the transfection of mammalian cells with sirna or mirna METAFECTENE SI Especially developed for the transfection of mammalian cells with sirna or mirna For ordering information, MSDS, publications and application notes see Description Cat. No.

More information

Lezioni Dipartimento di Oncologia Farmacologia Molecolare. RNA interference. Giovanna Damia 29 maggio 2006

Lezioni Dipartimento di Oncologia Farmacologia Molecolare. RNA interference. Giovanna Damia 29 maggio 2006 Lezioni Dipartimento di Oncologia Farmacologia Molecolare RNA interference Giovanna Damia 29 maggio 2006 RNA INTERFERENCE Sequence-specific gene suppression by dsrnas Gene silencing by dsrna: C. elegans

More information

MicroRNA Mike needs help to degrade all the mrna transcripts! Aaron Arvey ISMB 2010

MicroRNA Mike needs help to degrade all the mrna transcripts! Aaron Arvey ISMB 2010 Target mrna abundance dilutes microrna and sirna activity MicroRNA Mike needs help to degrade all the mrna transcripts! Aaron Arvey ISMB 2010 Target mrna abundance dilutes microrna and sirna activity Erik

More information

The world of non-coding RNA. Espen Enerly

The world of non-coding RNA. Espen Enerly The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often

More information

Transfection reagent for visualizing lipofection with DNA. For ordering information, MSDS, publications and application notes see www.biontex.

Transfection reagent for visualizing lipofection with DNA. For ordering information, MSDS, publications and application notes see www.biontex. METAFECTENE FluoR Transfection reagent for visualizing lipofection with DNA For ordering information, MSDS, publications and application notes see Description Cat. No. Size METAFECTENE

More information


EXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES C GUGAAG EXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES MicroRNA-adapted shrna (shrna mir ) for increased, specific and consistent knockdown. MicroRNA PROCESSING PATHWAY UTILIZED FOR shrna mir Developed

More information

RNA-based therapeutics hold significant potential as promising

RNA-based therapeutics hold significant potential as promising Supplement to the May 2011 Issue of 2011 The Industry s Authoritative Source MicroRNA Therapeutics Perspectives in MicroRNA Therapeutics Kevin Steffy, Charles Allerson, and Balkrishen Bhat

More information

Gene Silencing Oligos (GSOs) Third Generation Antisense

Gene Silencing Oligos (GSOs) Third Generation Antisense Gene Silencing Oligos (GSOs) Third Generation Antisense Walter R. Strapps, Ph.D. Executive Director, RNA Therapeutics Idera Pharmaceuticals Cambridge, MA NASDAQ: IDRA Idera is a leader

More information

SmartFlare RNA Detection Probes: Principles, protocols and troubleshooting

SmartFlare RNA Detection Probes: Principles, protocols and troubleshooting Technical Guide SmartFlare RNA Detection Probes: Principles, protocols and troubleshooting Principles of SmartFlare technology RNA detection traditionally requires transfection, laborious sample prep,

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. (A) MicroRNA 212 enhances IS from pancreatic β-cells. INS-1 832/3 β-cells were transfected with precursors for mirnas 212, 375, or negative control oligonucleotides. 48 hrs after

More information

MEF Starter Nucleofector Kit

MEF Starter Nucleofector Kit page 1 of 7 MEF Starter Nucleofector Kit for Mouse Embryonic Fibroblasts (MEF) MEF display significant phenotypic variations which depend on the strain, the genetic background of the mice they are isolated

More information

Dicer-Substrate sirna Technology

Dicer-Substrate sirna Technology As featured in BioRadiations 120 Dicer-Substrate sirna Technology Advances in sirna Designs Improve Gene-Specific Silencing Steve Kulisch, Teresa Esch, Christina Whitman-Guliaev, and Teresa Rubio, Bio-Rad

More information

Title: Mapping T cell epitopes in PCV2 capsid protein - NPB #08-159. Date Submitted: 12-11-09

Title: Mapping T cell epitopes in PCV2 capsid protein - NPB #08-159. Date Submitted: 12-11-09 Title: Mapping T cell epitopes in PCV2 capsid protein - NPB #08-159 Investigator: Institution: Carol Wyatt Kansas State University Date Submitted: 12-11-09 Industry summary: Effective circovirus vaccines

More information

Micro RNAs: potentielle Biomarker für das. Blutspenderscreening

Micro RNAs: potentielle Biomarker für das. Blutspenderscreening Micro RNAs: potentielle Biomarker für das Blutspenderscreening micrornas - Background Types of RNA -Coding: messenger RNA (mrna) -Non-coding (examples): Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear

More information

mirnaselect pep-mir Cloning and Expression Vector

mirnaselect pep-mir Cloning and Expression Vector Product Data Sheet mirnaselect pep-mir Cloning and Expression Vector CATALOG NUMBER: MIR-EXP-C STORAGE: -80ºC QUANTITY: 2 vectors; each contains 100 µl of bacterial glycerol stock Components 1. mirnaselect

More information

Outline. interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work?

Outline. interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work? Outline Outline interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work? What is RNA interference? Recently discovered regulatory level. Genome immune system.

More information

ArC Amine Reactive Compensation Bead Kit

ArC Amine Reactive Compensation Bead Kit ArC Amine Reactive Compensation Bead Kit Catalog no. A1346 Table 1. Contents and storage information. Material Amount Composition Storage Stability ArC reactive beads (Component A) ArC negative beads (Component

More information

Proto col. GoClone Repor ter Construc ts: Sample Protocol for Adherent Cells. Tech support: 877-994-8240. Luciferase Assay System

Proto col. GoClone Repor ter Construc ts: Sample Protocol for Adherent Cells. Tech support: 877-994-8240. Luciferase Assay System Luciferase Assay System Proto col GoClone Repor ter Construc ts: Sample Protocol for Adherent Cells LightSwitch Luciferase Assay System GoClone Reporter Assay Workflow Step 1: Seed cells in plate format.

More information



More information

MEF Nucleofector Kit 1 and 2

MEF Nucleofector Kit 1 and 2 page 1 of 7 MEF Nucleofector Kit 1 and 2 for Mouse Embryonic Fibroblasts (MEF) MEF display significant phenotypic variations which depend on the strain, the genetic background of the they are isolated

More information

RNA Viruses. A Practical Approac h. Alan J. Cann

RNA Viruses. A Practical Approac h. Alan J. Cann RNA Viruses A Practical Approac h Alan J. Cann List of protocols page xiii Abbreviations xvii Investigation of RNA virus genome structure 1 A j. Easton, A.C. Marriott and C.R. Pringl e 1 Introduction-the

More information

Thermo Scientific DharmaFECT Transfection Reagents

Thermo Scientific DharmaFECT Transfection Reagents Thermo Scientific Transfection Reagents Maintain cell viability with lipids specially formulated to deliver sirna Achieve robust sirna uptake for dependable gene silencing Expand your RNAi applications

More information

Protein Expression. A Practical Approach J. HIGGIN S

Protein Expression. A Practical Approach J. HIGGIN S Protein Expression A Practical Approach S. J. HIGGIN S B. D. HAMES List of contributors Abbreviations xv Xvi i 1. Protein expression in mammalian cell s Marlies Otter-Nilsson and Tommy Nilsso n 1. Introduction

More information

Application Note No. 2 / July 2012. Quantitative Assessment of Cell Quality, Viability and Proliferation. System

Application Note No. 2 / July 2012. Quantitative Assessment of Cell Quality, Viability and Proliferation. System Application Note No. 2 / July 2012 Quantitative Assessment of Cell Quality, Viability and Proliferation System Quantitative Assessment of Cell Quality, Viability and Proliferation Introduction In vitro

More information

CFSE Cell Division Assay Kit

CFSE Cell Division Assay Kit CFSE Cell Division Assay Kit Item No. 10009853 Customer Service 800.364.9897 * Technical Support 888.526.5351 TABLE OF CONTENTS GENERAL INFORMATION 3 Materials Supplied 4 Precautions

More information

Inhibition of MicroRNA Sensitizes 3D Breast Cancer Microtissues to Radiation Therapy

Inhibition of MicroRNA Sensitizes 3D Breast Cancer Microtissues to Radiation Therapy CASE STUDY High Content Image Analysis Inhibition of MicroRNA Sensitizes 3D Breast Cancer Microtissues to Radiation Therapy Dr. Nataša Anastasov leads the Personalized Radiation Therapy Group within the

More information

Guidance. 2. Definitions. 1. Introduction

Guidance. 2. Definitions. 1. Introduction Work with naked DNA or RNA (including oligonucleotides, sirna, mirna, sequences that code for highly biologically active molecules and full length viral genomes) Guidance 1. Introduction The following

More information

Fast, easy and effective transfection reagent for mammalian cells

Fast, easy and effective transfection reagent for mammalian cells METAFECTENE EASY + Fast, easy and effective transfection reagent for mammalian cells For ordering information, MSDS, publications and application notes see Description Cat. No. Size METAFECTENE

More information


RNAi: principle DNA RNA PROTEIN RNAi: principle RNAi DNA RNA PROTEIN Transcription (nucleus) Translation (cytoplasm) Many diseases develop from the undesirable production of specific proteins (oncogene products, mutant proteins, toxins,

More information

Classic Immunoprecipitation

Classic Immunoprecipitation 292PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 A Geno Technology, Inc. (USA) brand name Classic Immunoprecipitation Utilizes Protein A/G Agarose for Antibody Binding (Cat.

More information

School of Nursing. Presented by Yvette Conley, PhD

School of Nursing. Presented by Yvette Conley, PhD Presented by Yvette Conley, PhD What we will cover during this webcast: Briefly discuss the approaches introduced in the paper: Genome Sequencing Genome Wide Association Studies Epigenomics Gene Expression

More information

Practical Cell Analysis

Practical Cell Analysis Practical Cell Analysis Dimitri Pappas Dept of Chemistry & Biochemistry, Texas Tech University, USA WILEY A John Wiley and Sons, Ltd, Publication Contents Preface Acknowledgments xiii xix 1 Getting Started

More information

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line

2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line i 1 INTRODUCTION 1.1 Human Hepatitis B virus (HBV) 1 1.1.1 Pathogenesis of Hepatitis B 1 1.1.2 Genome organization of HBV 3 1.1.3 Structure of HBV virion 5 1.1.4 HBV life cycle 5 1.1.5 Experimental models

More information

The Steps. 1. Transcription. 2. Transferal. 3. Translation

The Steps. 1. Transcription. 2. Transferal. 3. Translation Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order

More information

Supplemental Information. McBrayer et al. Supplemental Data

Supplemental Information. McBrayer et al. Supplemental Data 1 Supplemental Information McBrayer et al. Supplemental Data 2 Figure S1. Glucose consumption rates of MM cell lines exceed that of normal PBMC. (A) Normal PBMC isolated from three healthy donors were

More information

博 士 論 文 ( 要 約 ) A study on enzymatic synthesis of. stable cyclized peptides which. inhibit protein-protein interactions

博 士 論 文 ( 要 約 ) A study on enzymatic synthesis of. stable cyclized peptides which. inhibit protein-protein interactions 博 士 論 文 ( 要 約 ) 論 文 題 目 A study on enzymatic synthesis of stable cyclized peptides which inhibit protein-protein interactions ( 蛋 白 質 間 相 互 作 用 を 阻 害 する 安 定 な 環 状 化 ペプチドの 酵 素 合 成 に 関 する 研 究 ) 氏 名 張 静 1

More information

DP419 RNAsimple Total RNA Kit. RNAprep pure Series. DP501 mircute mirna Isolation Kit. DP438 MagGene Viral DNA / RNA Kit. DP405 TRNzol Reagent

DP419 RNAsimple Total RNA Kit. RNAprep pure Series. DP501 mircute mirna Isolation Kit. DP438 MagGene Viral DNA / RNA Kit. DP405 TRNzol Reagent Overview of TIANGEN Products DP419 RNAsimple Total RNA Kit DP430 RNAprep pure Kit(For Cell/Bacteria) DP315/DP315-R TIANamp Virus DNA/RNA Kit DP431 RNAprep pure Kit (For Tissue) Silica-membrane Technology

More information

KMS-Specialist & Customized Biosimilar Service

KMS-Specialist & Customized Biosimilar Service KMS-Specialist & Customized Biosimilar Service 1. Polyclonal Antibody Development Service KMS offering a variety of Polyclonal Antibody Services to fit your research and production needs. we develop polyclonal

More information

Five-year relative survival rates. Cancer. Age-adjusted cancer death rates. Proteomic Technologies for Cancer Biomarker Discovery 2010/3/22

Five-year relative survival rates. Cancer. Age-adjusted cancer death rates. Proteomic Technologies for Cancer Biomarker Discovery 2010/3/22 Cancer Five-year relative survival rates Basal lamina Underlyig tissue Normal tissue Carcinoma Invasive carcinoma 1 2 Proteomic Technologies for Cancer Biomarker

More information

RAPAd mirna Adenoviral Expression System Catalog #: VPK-253

RAPAd mirna Adenoviral Expression System Catalog #: VPK-253 DATENBLATT RAPAd mirna Adenoviral Expression System Catalog #: VPK-253 FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction MicroRNAs (mirnas) are 18 24 nucleotide RNA molecules that

More information

Animal Cell Culture. Third Edition. A Practical Approach OXJORD VNIVVRSITY 1'RVSS

Animal Cell Culture. Third Edition. A Practical Approach OXJORD VNIVVRSITY 1'RVSS Animal Cell Culture Third Edition A Practical Approach Edited by John R. W. Masters 3rd Floor Research Laboratories, University College London OXJORD VNIVVRSITY 1'RVSS Contents List of protocols page xiii

More information


PROTOCOL. Immunocytochemistry (ICC) MATERIALS AND EQUIPMENT REQUIRED PROTOCOL Immunocytochemistry (ICC) 1850 Millrace Drive, Suite 3A Eugene, Oregon 97403 11-07 MATERIALS AND EQUIPMENT REQUIRED Materials: MitoSciences primary monoclonal antibody/antibodies Fluorophore-conjugated

More information

Biosafety considerations of new dsrna molecules

Biosafety considerations of new dsrna molecules Biosafety considerations of new dsrna molecules GM-free Europe Conference 2015 May 6-8 Berlin, Germany Dr. Sarah Agapito Current GMOs Plant transformed to produce new protein A G C U G G C A A U G U C

More information

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results

More information

HighPure Maxi Plasmid Kit

HighPure Maxi Plasmid Kit HighPure Maxi Plasmid Kit For purification of high pure plasmid DNA with high yields PP120109 HighPure Maxi Plasmid Kit Kit Contents Storage DP116 Contents RNaseA (100 mg/ml) Buffer

More information

In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab)

In vitro analysis of pri-mirna processing. by Drosha-DGCR8 complex. (Narry Kim s lab) In vitro analysis of pri-mirna processing by Drosha-DGCR8 complex (Narry Kim s lab) 1-1. Preparation of radiolabeled pri-mirna transcript The RNA substrate for a cropping reaction can be prepared by in

More information

Peptide Antibody Production

Peptide Antibody Production Peptide Antibody Production A) Peptide BioSynthesis (, 800-227-0627) B) Conjugation of peptide to KLH (Imject Maleimide Activated KLH, PIERCE=Thermo #77605, 10 mg) C) Peptide affinity

More information

SureSilencing shrna Plasmids

SureSilencing shrna Plasmids User Manual BIOMOL GmbH Waidmannstr. 35 22769 Hamburg Phone:+49-40-8532600 or 0800-2466651 (D) Fax: +49-40-85326022 or 0800-2466652 (D) SureSilencing shrna Plasmids Genome-Wide

More information

Advanced Drug Delivery Reviews

Advanced Drug Delivery Reviews Advanced Drug Delivery Reviews 61 (2009) 746 759 Contents lists available at ScienceDirect Advanced Drug Delivery Reviews journal homepage: sirna vs. shrna: Similarities and

More information

Morpholino, sirna, and S-DNA Compared: Impact of Structure and Mechanism of Action on Off-Target Effects and Sequence Specificity

Morpholino, sirna, and S-DNA Compared: Impact of Structure and Mechanism of Action on Off-Target Effects and Sequence Specificity Current Topics in Medicinal Chemistry, 2007, 7, 651-660 651 Morpholino, sirna, and S-DNA Compared: Impact of Structure and Mechanism of Action on ff-target Effects and Sequence Specificity James E. Summerton*

More information

CHAPTER 40 The Mechanism of Protein Synthesis

CHAPTER 40 The Mechanism of Protein Synthesis CHAPTER 40 The Mechanism of Protein Synthesis Problems: 2,3,6,7,9,13,14,15,18,19,20 Initiation: Locating the start codon. Elongation: Reading the codons (5 3 ) and synthesizing protein amino carboxyl.

More information

Summary of Discussion on Non-clinical Pharmacology Studies on Anticancer Drugs

Summary of Discussion on Non-clinical Pharmacology Studies on Anticancer Drugs Provisional Translation (as of January 27, 2014)* November 15, 2013 Pharmaceuticals and Bio-products Subcommittees, Science Board Summary of Discussion on Non-clinical Pharmacology Studies on Anticancer

More information

The EpiOcular Model. Protocol, Performance and Experience

The EpiOcular Model. Protocol, Performance and Experience The EpiOcular Model Protocol, Performance and Experience Rodger Curren, Ph.D., John Harbell, Ph.D. and Kevin Trouba, Ph.D. Institute for In Vitro Sciences, Inc. EpiOcular Outline Background Protocol Performance

More information

Transcription and Translation of DNA

Transcription and Translation of DNA Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes

More information



More information

Post-transcriptional control of gene expression

Post-transcriptional control of gene expression Post-transcriptional control of gene expression Possible post-transcriptional controls on gene expression Only a few of these controls are likely to be important for any one gene Mecanismo de processamento

More information

Basic Overview of Preclinical Toxicology Animal Models

Basic Overview of Preclinical Toxicology Animal Models Basic Overview of Preclinical Toxicology Animal Models Charles D. Hebert, Ph.D., D.A.B.T. December 5, 2013 Outline Background In Vitro Toxicology In Vivo Toxicology Animal Models What is Toxicology? Background

More information

Mouse ES Cell Nucleofector Kit

Mouse ES Cell Nucleofector Kit page 1 of 7 Mouse ES Cell Nucleofector Kit for Mouse Embryonic Stem Cells Cell type Origin Cells derived from mouse blastocysts. Morphology Round cells growing in clumps. Important remarks! 1. This protocol

More information

BLOCK-iT Products: Powerful tools to advance RNAi analysis

BLOCK-iT Products: Powerful tools to advance RNAi analysis BLOCK-iT RNAi Products BLOCK-iT Products: Powerful tools to advance RNAi analysis With BLOCK-iT RNAi Technology you can: Get powerful blocking and easily generate functional RNAi data Effectively prepare

More information

TaqMan Fast Advanced Master Mix. Protocol

TaqMan Fast Advanced Master Mix. Protocol TaqMan Fast Advanced Master Mix Protocol For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in this document is subject to change without notice. APPLIED

More information

pcas-guide System Validation in Genome Editing

pcas-guide System Validation in Genome Editing pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible

More information

Optimized Tandem amirna Mediates Stronger Inhibitory Effects on Hepatitis B Virus Infection

Optimized Tandem amirna Mediates Stronger Inhibitory Effects on Hepatitis B Virus Infection Optimized Tandem amirna Mediates Stronger Inhibitory Effects on Hepatitis B Virus Infection Chunwen Pu 1,2, Lifen Wang 2,*, Xiaohui Miao 3,*, Yong Zhang 1, Chunmeng Jiang 2, Wei Liu 1, Weixiang Sun 1,

More information


TECHNICAL INSIGHTS TECHNOLOGY ALERT TECHNICAL INSIGHTS TECHNOLOGY ALERT UNLOCKING BREAST CANCER TUMORS' DRUG RESISTANCE A troubling phenomenon in breast cancer treatment is that some patients tumors become resistant to treatments over time.

More information

RNA & Protein Synthesis

RNA & Protein Synthesis RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis

More information

Functional RNAs; RNA catalysts, mirna,

Functional RNAs; RNA catalysts, mirna, Functional RNAs; RNA catalysts, mirna, srna, RNAi... RNAs have many functions rrna (ribosomal RNA) trna (transfer RNA) mrna (Messenger RNA) snrna (including snorna) ) (Small nuclear RNA- splicing) Other

More information

Fluorescein Isothiocyanate (FITC)- conjugated Antibodies

Fluorescein Isothiocyanate (FITC)- conjugated Antibodies USER GUIDE Fluorescein Isothiocyanate (FITC)- conjugated Antibodies Catalog Numbers R933-25, R953-25, R963-25 Document Part Number 25-0376 Publication Number MAN0000194 Revision 2.0 For Research Use Only.

More information

Hypoxyprobe -1 Plus Kit Kit contents:

Hypoxyprobe -1 Plus Kit Kit contents: Updated 2015 1 PRODUCT INSERT Hypoxyprobe, Inc 121 Middlesex Turnpike Burlington, MA 01803 USA Hypoxyprobe -1 Plus Kit Kit contents: Solid pimonidazole HCl (Hypoxyprobe -1) FITC conjugated

More information

Engineering of Yellow Mosaic Virus Resistance (YMVR) in Blackgram. Project ID: 1 April 2000 to 31 August 2004. Project Duration:

Engineering of Yellow Mosaic Virus Resistance (YMVR) in Blackgram. Project ID: 1 April 2000 to 31 August 2004. Project Duration: Engineering of Yellow Mosaic Virus Resistance (YMVR) in Blackgram ID: Duration: Coordinator in Switzerland: PS1 1 April 2000 to 31 August 2004 Prof. Thomas Hohn University of Basel Botanisches Institut

More information

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes

More information

TECHNICAL BULLETIN. TRI Reagent For processing tissues, cells cultured in monolayer or cell pellets. Catalog Number T9424 Store at room temperature.

TECHNICAL BULLETIN. TRI Reagent For processing tissues, cells cultured in monolayer or cell pellets. Catalog Number T9424 Store at room temperature. TRI Reagent For processing tissues, cells cultured in monolayer or cell pellets Catalog Number T9424 Store at room temperature. TECHNICAL BULLETIN Product Description TRI Reagent is a quick and convenient

More information

Protein transfer from SDS-PAGE to nitrocellulose membrane using the Trans-Blot SD cell (Western).

Protein transfer from SDS-PAGE to nitrocellulose membrane using the Trans-Blot SD cell (Western). Western Blot SOP Protein transfer from SDS-PAGE to nitrocellulose membrane using the Trans-Blot SD cell (Western). Date: 8/16/05, 10/31/05, 2/6/06 Author: N.Oganesyan, R. Kim Edited by: R. Kim Summary:

More information

Investigating the role of a Cryptosporidium parum apyrase in infection

Investigating the role of a Cryptosporidium parum apyrase in infection Investigating the role of a Cryptosporidium parum apyrase in infection David Riccardi and Patricio Manque Abstract This project attempted to characterize the function of a Cryptosporidium parvum apyrase

More information

PreciseTM Whitepaper

PreciseTM Whitepaper Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis

More information

Competition between Small RNAs: A Quantitative View

Competition between Small RNAs: A Quantitative View 1712 Biophysical Journal Volume 102 April 2012 1712 1721 Competition between Small RNAs: A Quantitative View Adiel Loinger, D Yael Shemla, D Itamar Simon, Hanah Margalit, and Ofer Biham * Racah Institute

More information


PRACTICE TEST QUESTIONS PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.

More information

AAGPs TM Anti-Aging Glyco Peptides. Enhancing Cell, Tissue and Organ Integrity Molecular and biological attributes of lead AAGP molecule

AAGPs TM Anti-Aging Glyco Peptides. Enhancing Cell, Tissue and Organ Integrity Molecular and biological attributes of lead AAGP molecule AAGPs TM Anti-Aging Glyco Peptides Enhancing Cell, Tissue and Organ Integrity Molecular and biological attributes of lead AAGP molecule 1 Acknowledgements This presentation was prepared by Dr. Samer Hussein

More information

Primetime for KNIME:

Primetime for KNIME: Primetime for KNIME: Towards an Integrated Analysis and Visualization Environment for RNAi Screening Data F. Oliver Gathmann, Ph. D. Director IT, Cenix BioScience Presentation for: KNIME User Group Meeting

More information

Quality Assurance in Blood Cell Labelling

Quality Assurance in Blood Cell Labelling Quality Assurance in Blood Cell Labelling Sietske Rubow Radiopharmacist Nuclear Medicine Tygerberg Hospital and Stellenbosch University Overview What is QA QA in Blood Cell Labelling Staff

More information

Fighting the Battles: Conducting a Clinical Assay

Fighting the Battles: Conducting a Clinical Assay Fighting the Battles: Conducting a Clinical Assay 6 Vocabulary: In Vitro: studies in biology that are conducted using components of an organism that have been isolated from their usual biological surroundings

More information

Protein Synthesis How Genes Become Constituent Molecules

Protein Synthesis How Genes Become Constituent Molecules Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein

More information

Gene Models & Bed format: What they represent.

Gene Models & Bed format: What they represent. GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,

More information

LightSwitch Dual Assay System DA010 (100 assays)

LightSwitch Dual Assay System DA010 (100 assays) LightSwitch Dual Assay System DA010 (100 assays)! Description The LightSwitch Dual Assay System is used to normalize for variation between transfection replicates in cell lines that are particularly difficult

More information

H. Richard Alexander, Jr., M.D. Department of Surgery and The Greenebaum Cancer Center University of Maryland School of Medicine Baltimore, Md

H. Richard Alexander, Jr., M.D. Department of Surgery and The Greenebaum Cancer Center University of Maryland School of Medicine Baltimore, Md Major Advances in Cancer Prevention, Diagnosis and Treatment~ Why Mesothelioma Leads the Way H. Richard Alexander, Jr., M.D. Department of Surgery and The Greenebaum Cancer Center University of Maryland

More information

The RNA strategy. RNA as a tool and target in human disease diagnosis and therapy.

The RNA strategy. RNA as a tool and target in human disease diagnosis and therapy. The RNA strategy RNA as a tool and target in human disease diagnosis and therapy. The Laboratory of RNA Biology and Biotechnology at the Centre for Integrative Biology (CIBIO) of the University of Trento,

More information

In Silico Evidence of the Relationship Between mirnas and sirnas

In Silico Evidence of the Relationship Between mirnas and sirnas The Open Applied Informatics Journal, 2008, 2, 9-13 9 In Silico Evidence of the Relationship Between mirnas and sirnas L. Montanucci 1, P. Fariselli *,1, P.L. Martelli 1, I. Rossi 1,2 and R. Casadio 1

More information

CytoSelect 48-Well Cell Adhesion Assay (ECM Array, Colorimetric Format)

CytoSelect 48-Well Cell Adhesion Assay (ECM Array, Colorimetric Format) Product Manual CytoSelect 48-Well Cell Adhesion Assay (ECM Array, Colorimetric Format) Catalog Number CBA-070 CBA-070-5 48 assays 5 x 48 assays FOR RESEARCH USE ONLY Not for use in diagnostic procedures

More information

V22: involvement of micrornas in GRNs

V22: involvement of micrornas in GRNs What are micrornas? V22: involvement of micrornas in GRNs How can one identify micrornas? What is the function of micrornas? Elisa Izaurralde, MPI Tübingen Huntzinger, Izaurralde, Nat. Rev. Genet. 12,

More information

Interim Progress Report R&D Project 348. Development of a Field Test Kit for Detection of Blue-Green Algal Toxins

Interim Progress Report R&D Project 348. Development of a Field Test Kit for Detection of Blue-Green Algal Toxins Interim Progress Report R&D Project 348 Development of a Field Test Kit for Detection of Blue-Green Algal Toxins Biocode Limited November 1992 R&D 348/04/A ENVIRONMENT AGENCY 135357 CONTENTS SUMMARY KEYWORDS

More information