TOOLS sirna and mirna. User guide

Size: px
Start display at page:

Download "TOOLS sirna and mirna. User guide"

Transcription

1 TOOLS sirna and mirna User guide

2 Introduction RNA interference (RNAi) is a powerful tool for suppression gene expression by causing the destruction of specific mrna molecules. Small Interfering RNAs (sirnas) are short, double-stranded RNA molecules that bind specific messenger RNA (mrna) molecules and decrease their activities by preventing an mrna from producing a protein. TOOLS sirna oligos undergo vigorous process monitoring and strict quality control, produce under ISO9000 quality standard system. Chemical Modified sirna exhibits greater longevity in cell culture and stability in cell culture and in serum, enhancing the ability for this to be used for in vivo applications and has much more extensional effective time than Standard sirna. TOOLS in vitro/vivo mirna mimics inhibitors are chemically-modified and optimized nucleic acids designed to specifically target the microrna (mirna) molecules in animals. Endogenous micrornas are small, regulatory RNAs that are expressed in animals and plants that affect the translation of target mrnas. The mature nucleotide, single-stranded mirnas specifically target a protein complex to regulate translation at the level of mrna. Specifications Products (1 OD) sirna mirna mimics mirna inhibitor nmol Molecular weight ~13300 ~13300 ~6500 weight 33 ug 33 ug 33 ug Concentration 20 um (20 pmol/ul) 20 um (20 pmol/ul) 20 um (20 pmol/ul) (when adding 125 ul H 2O) (when adding 125 ul H 2O) (when adding 250 ul H 2O) 1

3 Ordering information sirna In vitro sirna or chemically-modified sirna In vivo sirna or chemically-modified sirna Negative Control sirna FAM Negative Control sirna Positive Control sirna sirna set (Guaranteed >70% knock-down in mrna level) 3 x 1OD target sirna 1 x 0.5OD negative control sirna 1 x 0.5OD FAM labeled negative control sirna 1 x 0.5OD positive control sirna Chemically-modified sirna set(guaranteed >70% knock-down in mrna level) 3 x 1OD Chemically-modified target sirna 1 x 0.5OD negative control sirna 1 x 0.5OD FAM labeled negative control sirna 1 x 0.5OD positive control sirna 2OD/4OD/8OD 1OD 1OD 1OD mirna mimics & inhibitors In vitro mirna mimics In vitro mirna mimics negative control In vitro chemically-modified mirna inhibitor In vitro chemically-modified mirna inhibitor negative control In vivo chemically-modified mirna mimics In vivo chemically-modified mirna inhibitor In vivo mirna mimics & inhibitor negative control 2OD/4OD 2OD 2OD/4OD 2OD 2

4 sirna transfection guide: Cell Culture Before Transfection It is advised that before starting your transfection experiment, put your cells on your cell plate, then add proper culture medium, lastly incubate cells for 24 hrs to be 70%-90% by confluence. Transfection reagent: TOOLSoothFect transfection reagent (Cat.No. NFT-KA00) Culture vessel Surface Area (mm 2 /well) Cell Density Volume of plating Medium(ul/well) 96-well x x ul 48-well x x ul 24-well x x ul 12-well x x ml 6-well x x ml 35 mm x x ml 60 mm x x ml Culture vessel sirna Volume of plating Transfection reagent mediun (ul/well) 96-well 5 pmol 100ul 0.25 ul 24-well 20 pmol 500ul 1 ul 12-well 40 pmol 1ml 2 ul 6-well 100 pmol 2ml 5 ul 35 mm 100 pmol 2ml 5 ul 60 mm 600 pmol 5ml 10 ul mirna mimics or inhibitor transfection guide: mirna Culture Dish Transfection reagent (mimics or inhibitor) Cell density (cells/well) Final volume (per well) 96-well ul 3 pmol ml 24-well ul 15 pmol ml 12-well 1-3 ul 30 pmol ml 6-well 2-5 ul 75 pmol ml 3

5 In vivo sirna delivery guide: Delivery route (dissolve in vivo sirna in PBS or RNase free water or OptiMEM) Intravenous Intraperitoneal Intracranial Systemic delivery dosage: nmol/g body weight Mice (body weight 15-20g): 3-4 nmol (40-50ug) Rat (body weight g): nmol ( ug) A sirna dose of 5mg/kg/day is recommended as a starting point for experiments. In vivo mirna (mimics or inhibitor) delivery guide: Delivery route (dissolve in vivo mirna in PBS or normal saline:) Intravenous Intraperitoneal Intracranial 5-80ug/g body weight or 200nmol(3 times) Local delivery: 1-10nmol(0.5-4OD), volume: 30ul~100ul; TOOLS mirna modification example: hsa-mir-137 agomirs sense : 5' UUAUUGCUUAAGAAUACGCGUAG 3' antisense: 5' AsCsGCGUAUUCUUAAGCAAUAsAsUsUs-Chol- 3' Storage Store TOOLS sirna or mirna at 20 C 4

6 sirna or mirna FAQs : What is the best method of delivering sirnas into the cell? There are several methods that are used for delivering sirnas into cells including lipid-based transfection, electroporation, calcium phosphate co-precipitation, microinjection and vector delivery techniques. The choice between these methods is often a result of several factors including the ability of the cells to tolerate the delivery method, susceptibility to viral infection, and the growth properties of the cells. Although lipid-based transfection is one of the more commonly used methods for adherent cells, suspension cells are often more difficult to transfect and generally have higher rates of delivery with electroporation techniques. Is there a quick method for monitoring transfection efficiency? TOOLS has developed several options including a family of fluorescent-labeled sirnas and a novel RNA-based reagent known as sirna transfection Control. The uptake of sirnas can be visualized with the appropriate filters on a confocal microscope or by flow cytometry. Alternatively, fluorescent-labeled sirna is cytotoxic when successfully delivered into cells. Cells that have efficiently taken up this transfection control typically undergo apoptosis within 24 to 48 hours. This phenotypic outcome can easily be monitored using standard cell viability methods (e.g., alamarblue, MTT cytotoxicity, Trypan Blue dye exclusion, JC1 dye, or other appropriate assays). What is the best time-frame for monitoring sirna-dependent decreases in target mrna expression levels? In target protein levels? Generally, target mrna levels are decreased after 24 hours post-transfection following transfection of a gene-specific sirna duplex. However, maximal silencing may be reached at a later time point, so it is advisable to assay target mrna in a time-course study. In most cases, silencing will be maximal at 24 to 48 hours following transfection. Cellular target protein levels should be examined starting at 24 hours and assayed until a minimum level is noted, often 48 to 96 hours or greater. As always, it is important to verify transfection efficiency using an appropriate positive control. If there is no decrease in protein levels within this time frame, it may be necessary to perform a second sirna transfection, use a stabilized sirna, or develop a vector-based silencing cassette that can continuously produce the sirna for extended periods of time. 5

Instructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control

Instructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control is a is a state of the art transfection reagent, specifically designed for the transfer of sirna and mirna into a variety of eukaryotic cell types. is a state of the art transfection reagent, specifically

More information

HiPerFect Transfection Reagent Handbook

HiPerFect Transfection Reagent Handbook Fifth Edition October 2010 HiPerFect Transfection Reagent Handbook For transfection of eukaryotic cells with sirna and mirna Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the

More information

岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹 20100803

岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹 20100803 技 術 專 員 費 軫 尹 20100803 Overview of presentation Basic Biology of RNA interference Application of sirna for gene function? How to study mirna? How to deliver sirna and mirna? New prospects on RNAi research

More information

Guidelines for mirna mimic and mirna inhibitor experiments

Guidelines for mirna mimic and mirna inhibitor experiments April 2015 Guidelines for mirna mimic and mirna inhibitor experiments For mirna research Sample & Assay Technologies QIAGEN Sample and Assay Technologies QIAGEN is the leading provider of innovative sample

More information

Dicer Substrate RNAi Design

Dicer Substrate RNAi Design INTEGRATED DNA TECHNOLOGIES, INC. Dicer Substrate RNAi Design How to design and order 27-mer Dicer-substrate Duplex RNAs for use as RNA interference reagents The following document provides a summary of

More information

TransIT-X2 Dynamic Delivery System

TransIT-X2 Dynamic Delivery System Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/6000 INTRODUCTION TransIT-X2 Dynamic Delivery System is an advanced, non-liposomal polymeric system that enables high

More information

INTERFERin in vitro sirna/mirna transfection reagent PROTOCOL. 1 Standard sirna transfection of adherent cells... 2

INTERFERin in vitro sirna/mirna transfection reagent PROTOCOL. 1 Standard sirna transfection of adherent cells... 2 INTERFERin in vitro sirna/mirna transfection reagent PROTOCOL DESCRIPTION INTERFERin is a powerful sirna/mirna transfection reagent that ensures efficient gene silencing and reproducible transfection in

More information

Ambion Anti-miR mirna Inhibitors and Pre-miR mirna Precursors Uncover mirna Function

Ambion Anti-miR mirna Inhibitors and Pre-miR mirna Precursors Uncover mirna Function Product Bulletin Ambion Anti-miR mirna Inhibitors and Pre-miR mirna Precursors Ambion Anti-miR mirna Inhibitors and Pre-miR mirna Precursors Uncover mirna Function With Ambion Pre-miR mirna Precursors

More information

The next generation of mirna modulators: new mirvana mirna mimics and inhibitors. Dr. Amy Lam Field Application Scientist

The next generation of mirna modulators: new mirvana mirna mimics and inhibitors. Dr. Amy Lam Field Application Scientist The next generation of mirna modulators: new mirvana mirna mimics and inhibitors Dr. Amy Lam Field Application Scientist Noncoding RNAs?? Noncoding transcripts Regulatory ncrnas mirna (microrna) pirna

More information

INSTRUCTION MANUAL riboxx FECT

INSTRUCTION MANUAL riboxx FECT INSTRUCTION MANUAL sirna, mirna, and RNA Transfection Reagent Version 1.0 CONTENTS A. DESCRIPTION 1 B. SPECIFICATIONS 1 C. PROTOCOL 2 C.1 TRANSFECTION PROTOCOL FOR ADHERENT CELLS 2 C.2 TRANSFECTION PROTOCOL

More information

mircury LNA microrna Inhibitor Library Instruction manual

mircury LNA microrna Inhibitor Library Instruction manual mircury LNA microrna Inhibitor Library Instruction manual 2 Literature citations: Please refer to mircury LNA microrna Inhibitor Library, organism and version when describing a procedure for publication

More information

Functional Analysis. mircury LNA microrna Inhibitors and Target Site Blockers

Functional Analysis. mircury LNA microrna Inhibitors and Target Site Blockers Functional Analysis mircury LNA microrna Inhibitors and Target Site Blockers Instruction manual v1.0 June 2013 Table of contents Product Summary...........................................................

More information

BioT. Table of Contents. Cell Transfection Manual. Introduction Major Features 4. Storage Condition. 4. Important Note 4

BioT. Table of Contents. Cell Transfection Manual. Introduction Major Features 4. Storage Condition. 4. Important Note 4 Cell Transfection Manual Table of Contents Introduction... 3 Major Features 4 Storage Condition. 4 Important Note 4 Plasmid Transfection Protocol... 5 sirna Transfection Protocol.. 8 Plasmid and sirna

More information

Designing an RNAi Experiment using Nucleofection

Designing an RNAi Experiment using Nucleofection Technical Reference Guide Designing an RNAi Experiment using Nucleofection The Nucleofector Technology is well suited for the transfection of sirna duplexes or shrna vectors into both primary cells and

More information

TransIT -293 Transfection Reagent

TransIT -293 Transfection Reagent TransIT -293 Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/2700 INTRODUCTION TransIT -293 Transfection Reagent is specifically optimized to provide

More information

sirna Duplexes & RNAi Explorer

sirna Duplexes & RNAi Explorer P r o d u c t S p e c i f i c a t i o n s Guaranteed RNAi Explorer kit with Fl/Dabcyl Molecular Beacon Catalog No.:27-6402-01 Guaranteed RNAi Explorer kit with Fluorescein/Tamra TaqMan Catalog No.:27-6402-01

More information

MicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control

MicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control MicroRNA formation mirna s are processed from several precursor stages Mammalian genomes seem to have 100 s of mirna s Nucleotides in positions 2-8 of an mirna are considered the mirna seed 5 Methyl-G

More information

Functional Analysis. mircury LNA microrna Mimics

Functional Analysis. mircury LNA microrna Mimics Functional Analysis mircury LNA microrna Mimics Instruction manual v1.0 April 2014 Table of Contents Product summary......................................................... 3 Content..................................................................

More information

TransIT -Oligo Transfection Reagent Product # MIR 2160, MIR 2164, MIR 2165, MIR Volume of TransIT -Oligo Reagent. 5 ml (5 1 ml) MIR 2165

TransIT -Oligo Transfection Reagent Product # MIR 2160, MIR 2164, MIR 2165, MIR Volume of TransIT -Oligo Reagent. 5 ml (5 1 ml) MIR 2165 Page 1 of 5 Lit.# ML016 Rev. 3/31/05 TransIT -Oligo Transfection Reagent Product # MIR 2160, MIR 2164, MIR 2165, MIR 2166 Product Name Volume of TransIT -Oligo Reagent Product No. 0.4 ml MIR 2164 TransIT

More information

Optimized Protocol sirna Test Kit for Cell Lines and Adherent Primary Cells

Optimized Protocol sirna Test Kit for Cell Lines and Adherent Primary Cells page 1 of 8 sirna Test Kit for Cell Lines and Adherent Primary Cells Kit principle Co-transfection of pmaxgfp, encoding the green fluorescent protein (GFP) from Pontellina p. with an sirna directed against

More information

RNAi Shooting the Messenger!

RNAi Shooting the Messenger! RNAi Shooting the Messenger! Bronya Keats, Ph.D. Department of Genetics Louisiana State University Health Sciences Center New Orleans Email: bkeats@lsuhsc.edu RNA interference (RNAi) A mechanism by which

More information

Functional and Biomedical Aspects of Genome Research

Functional and Biomedical Aspects of Genome Research Functional and Biomedical Aspects of Genome Research 20 11 35 Vorlesung SS 04 Bartsch, Jockusch & Schmitt-John Mi. 9:15-10:00, in W7-135 13 Functional RNAs Thomas Schmitt-John micro RNAs small interfering

More information

Especially developed for the transfection of mammalian cells with sirna or mirna

Especially developed for the transfection of mammalian cells with sirna or mirna METAFECTENE SI Especially developed for the transfection of mammalian cells with sirna or mirna For ordering information, MSDS, publications and application notes see www.biontex.com Description Cat. No.

More information

TransIT -2020 Transfection Reagent

TransIT -2020 Transfection Reagent Quick Reference Protocol, MSDS and Certificate of Analysis available at mirusbio.com/5400 INTRODUCTION TransIT -2020 Transfection Reagent is a high-performance, animal-origin free, broad spectrum reagent

More information

Biological Stability and Activity of sirna in Ionic Liquids**

Biological Stability and Activity of sirna in Ionic Liquids** Electronic Supplementary Material (ESI) for ChemComm. This journal is The Royal Society of Chemistry 2014 Supporting Information Biological Stability and Activity of sirna in Ionic Liquids** Romiza R.

More information

CODICE DESCRIZIONE QUANTITA' PREZZO EURO

CODICE DESCRIZIONE QUANTITA' PREZZO EURO Broad Spectrum Plasmid DNA and sirna/mirna Transfection MIR 6000 TransIT-X2 Dynamic Delivery System 1.5 ml 823,35 MIR 6003 TransIT-X2 Dynamic Delivery System 0.3 ml 196,35 MIR 6004 TransIT-X2 Dynamic Delivery

More information

Functional Analysis. mircury LNA microrna Inhibitor library

Functional Analysis. mircury LNA microrna Inhibitor library Functional Analysis mircury LNA microrna Inhibitor library Instruction manual v2.0 April 2015 Table of contents Product Summary... 3 Content... 3 Additional required materials... 4 Product description...

More information

Everything You Need for RNAi. Shedding Light on RNAi. The Use of Bioluminescent Reporter Genes for RNAi Optimization

Everything You Need for RNAi. Shedding Light on RNAi. The Use of Bioluminescent Reporter Genes for RNAi Optimization Everything You Need for RNAi Effective RNA interference experiments are comprised of two basic steps: 1) Finding an effective sirna target sequence and 2) Expressing that target sequence in cells. In the

More information

Manual for: sirna-trans Maximo Reagent

Manual for: sirna-trans Maximo Reagent Manual for: sirna-trans Maximo Reagent Contact: info@geneon.net; www.geneon.net GeneON GmbH Germany GeneON GmbH / Protocol sirna-trans reagent vs. 1.3 / www.geneon.net / - 0 - sirna-trans reagent Instruction

More information

RNA Interference (RNAi) and DsiRNAs

RNA Interference (RNAi) and DsiRNAs RNA Interference (RNAi) and DsiRNAs Contents 1. Introduction to RNAi... 1 2. Dicer-Substrate RNAi Technology... 2 3. Designing sirnas... 3 3.1 Location... 3 3.2 Modification... 3 3.3 Thermodynamic stability...

More information

MicroRNA Mike needs help to degrade all the mrna transcripts! Aaron Arvey ISMB 2010

MicroRNA Mike needs help to degrade all the mrna transcripts! Aaron Arvey ISMB 2010 Target mrna abundance dilutes microrna and sirna activity MicroRNA Mike needs help to degrade all the mrna transcripts! Aaron Arvey ISMB 2010 Target mrna abundance dilutes microrna and sirna activity Erik

More information

Functional Analysis of mirna

Functional Analysis of mirna Functional Analysis of mirna Martin Kreutz Martin.Kreutz@qiagen.com Scientist, Product Development Legal Disclaimer QIAGEN products shown here are intended for molecular biology applications. These products

More information

RNAi. Martin Latterich

RNAi. Martin Latterich RNAi Martin Latterich Contributors Abbreviations Preface i x ( xi xiii 1 Methods in RNA interference 1 Martin Latterich and Dalia Halawan i References 2 2 RNAi reagent design 3 Bernd Jagla and Nathalie

More information

Pre-made anti-microrna (for human and mouse) lentivirus User Manual

Pre-made anti-microrna (for human and mouse) lentivirus User Manual Pre-made anti-microrna (for human and mouse) lentivirus User Manual Catalog# Product Name Amounts A-miRNA H1-Bsd anti mirna (H1) with Blasticidin A-miRNA H1-GB anti mirna (H1) with GFP-Blasticidin A-miRNA

More information

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d. 13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both

More information

RNA Interference. - Localization - Labeling - Expression Profiling - In Vivo Delivery - Transfection

RNA Interference. - Localization - Labeling - Expression Profiling - In Vivo Delivery - Transfection RNA Interference - Localization - Labeling - Expression Profiling - In Vivo Delivery - Transfection Rna interference x RNAi Pathways RNA interference x Tools and Multiplexing RNAi Tools pri-mirna Application

More information

The New Standard for Specific Silencing

The New Standard for Specific Silencing sirna Specific Functional Up to 90% reduction of off-target effects with premium sirna Achieve guaranteed silencing with highly potent sirna The New Standard for Specific Silencing Efficient Save time

More information

PRODUCT INFORMATION...

PRODUCT INFORMATION... VIROMER RED In vitro plasmid DNA and mrna Standard Transfection PRODUCT INFORMATION... 2 GENERAL... 2 RED OR YELLOW?... 3 PROTOCOL GUIDELINES... 4 GENERAL REMARKS... 4 CELL CULTURE AND PLATING... 4 FORWARD/REVERSE

More information

QIAGEN Transfection Technologies

QIAGEN Transfection Technologies QIAGEN Transfection Technologies Efficient and robust transfection for all your applications Sample & Assay Technologies Table of contents QIAGEN solutions for efficient transfection Transfection is a

More information

Lezioni Dipartimento di Oncologia Farmacologia Molecolare. RNA interference. Giovanna Damia 29 maggio 2006

Lezioni Dipartimento di Oncologia Farmacologia Molecolare. RNA interference. Giovanna Damia 29 maggio 2006 Lezioni Dipartimento di Oncologia Farmacologia Molecolare RNA interference Giovanna Damia 29 maggio 2006 RNA INTERFERENCE Sequence-specific gene suppression by dsrnas Gene silencing by dsrna: C. elegans

More information

RNAi in suspension cells using amaxa s Nucleofector technology together with QIAGEN s HPP Grade sirna duplexes

RNAi in suspension cells using amaxa s Nucleofector technology together with QIAGEN s HPP Grade sirna duplexes oct. 23 application note page 1 of 6 RNAi in suspension cells using amaxa s Nucleofector technology together with QIAGEN s HPP Grade sirna duplexes Elke Lorbach*, Dietmar Lenz*, Andrea Klaes*, Katharina

More information

SmartFlare RNA Detection Probes: Principles, protocols and troubleshooting

SmartFlare RNA Detection Probes: Principles, protocols and troubleshooting Technical Guide SmartFlare RNA Detection Probes: Principles, protocols and troubleshooting Principles of SmartFlare technology RNA detection traditionally requires transfection, laborious sample prep,

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. (A) MicroRNA 212 enhances IS from pancreatic β-cells. INS-1 832/3 β-cells were transfected with precursors for mirnas 212, 375, or negative control oligonucleotides. 48 hrs after

More information

Transfection reagent for visualizing lipofection with DNA. For ordering information, MSDS, publications and application notes see www.biontex.

Transfection reagent for visualizing lipofection with DNA. For ordering information, MSDS, publications and application notes see www.biontex. METAFECTENE FluoR Transfection reagent for visualizing lipofection with DNA For ordering information, MSDS, publications and application notes see www.biontex.com Description Cat. No. Size METAFECTENE

More information

CHAPTER 9 BIOTECHNOLOGY AND RECOMBINANT DNA

CHAPTER 9 BIOTECHNOLOGY AND RECOMBINANT DNA CHAPTER 9 BIOTECHNOLOGY AND RECOMBINANT DNA Introduction to Biotechnology Biotechnology is the use of microorganisms, cells, or cell components to make a product. a. Recombinant DNA technology aka genetic

More information

EXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES

EXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES C GUGAAG EXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES MicroRNA-adapted shrna (shrna mir ) for increased, specific and consistent knockdown. MicroRNA PROCESSING PATHWAY UTILIZED FOR shrna mir Developed

More information

The world of non-coding RNA. Espen Enerly

The world of non-coding RNA. Espen Enerly The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often

More information

Thermo Scientific Dharmacon miridian microrna Mimics & Hairpin Inhibitors

Thermo Scientific Dharmacon miridian microrna Mimics & Hairpin Inhibitors Thermo Scientific Dharmacon miridian microrna s & Hairpin Inhibitors Highly potent oligonucleotides for modulating mirna function Reliable reagents for reproducible studies of mirnas Advanced design for

More information

The RNAi Consortium (TRC) Broad Institute

The RNAi Consortium (TRC) Broad Institute TRC Laboratory Protocols Protocol Title: Lentiviral Infection Current Revision Date: 09/01/2009 RNAi Platform,, trc_info@broadinstitute.org Brief Description: This protocol describes large scale (6 cm

More information

MEF Starter Nucleofector Kit

MEF Starter Nucleofector Kit page 1 of 7 MEF Starter Nucleofector Kit for Mouse Embryonic Fibroblasts (MEF) MEF display significant phenotypic variations which depend on the strain, the genetic background of the mice they are isolated

More information

STRATEGIES FOR RISK ASSESSMENT AND INSTITUTIONAL OVERSIGHT OF EMERGING

STRATEGIES FOR RISK ASSESSMENT AND INSTITUTIONAL OVERSIGHT OF EMERGING STRATEGIES FOR RISK ASSESSMENT AND INSTITUTIONAL OVERSIGHT OF EMERGING RNAi TECHNOLOGIES Angela Birnbaum Director of Biosafety Tulane University Rebecca Caruso Director of COMS Harvard Medical School RNAi

More information

Designing an RNAi Experiment Using Nucleofection Technical Reference Guide

Designing an RNAi Experiment Using Nucleofection Technical Reference Guide Designing an RNAi Experiment Using Nucleofection The Nucleofector Technology is well suited for the transfection of sirna duplexes or shrna vectors into both primary cells and difficult-to-transfect cell

More information

Gaussia Luciferase Cellular Assay

Gaussia Luciferase Cellular Assay Product Guide Gaussia Luciferase Cellular Assay Gaussia Luciferase Assay Kits Cat # 31001 1,000 assays Cat # 31002 10,000 assays Table of Contents: Contents of GLum.1, Gaussia Luciferase Assay Kit:...

More information

LightSwitch Luciferase Assay System

LightSwitch Luciferase Assay System Constructs, Assays & Services Assay System Promoter GoClones Synthetic Response Elements Pathway Cell Lines 3 UTR GoClones mirna Mimics & Inhibitors Synthetic mirna Targets Transfection Reagents Assay

More information

Thermo Scientific Dharmacon sirna Libraries

Thermo Scientific Dharmacon sirna Libraries Thermo Scientific Dharmacon sirna Libraries Scientific innovation in sirna potency, specificity and delivery Superior sirna in comprehensive collections for reliable screens Market leading products for

More information

Proto col. GoClone Repor ter Construc ts: Sample Protocol for Adherent Cells. Tech support: 877-994-8240. Luciferase Assay System

Proto col. GoClone Repor ter Construc ts: Sample Protocol for Adherent Cells. Tech support: 877-994-8240. Luciferase Assay System Luciferase Assay System Proto col GoClone Repor ter Construc ts: Sample Protocol for Adherent Cells LightSwitch Luciferase Assay System GoClone Reporter Assay Workflow Step 1: Seed cells in plate format.

More information

HOST DEFENSE AGAINST VIRUS INFECTION OF PLANTS Post transcriptional gene silencing (PTGS) or RNA interference (RNAi) represents a sequence specific

HOST DEFENSE AGAINST VIRUS INFECTION OF PLANTS Post transcriptional gene silencing (PTGS) or RNA interference (RNAi) represents a sequence specific HOST DEFENSE AGAINST VIRUS INFECTION OF PLANTS Post transcriptional gene silencing (PTGS) or RNA interference (RNAi) represents a sequence specific antiviral defense mechanism in plants. has parallels

More information

NOVEL GENE SILECING TECHNOLOGY ANTISENSE-NUCLEASE CONJUGATES

NOVEL GENE SILECING TECHNOLOGY ANTISENSE-NUCLEASE CONJUGATES Antisense technology NOVEL GENE SILECING TECHNOLOGY ANTISENSE-NUCLEASE CONJUGATES Antisense technology is one of the most straightforward approaches for suppressing unwanted gene expression. Antisense

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

Dicer-Substrate sirna Technology

Dicer-Substrate sirna Technology As featured in BioRadiations 120 Dicer-Substrate sirna Technology Advances in sirna Designs Improve Gene-Specific Silencing Steve Kulisch, Teresa Esch, Christina Whitman-Guliaev, and Teresa Rubio, Bio-Rad

More information

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...

More information

MEF Nucleofector Kit 1 and 2

MEF Nucleofector Kit 1 and 2 page 1 of 7 MEF Nucleofector Kit 1 and 2 for Mouse Embryonic Fibroblasts (MEF) MEF display significant phenotypic variations which depend on the strain, the genetic background of the they are isolated

More information

Small Molecules with Big Impact: Functional Studies of mirna

Small Molecules with Big Impact: Functional Studies of mirna Isolation Quantification Functionalization Small Molecules with Big Impact: Functional Studies of mirna Martin Kreutz Scientist, R&D Martin.Kreutzi@qiagen.com Third in a series of QIAGEN webinars on mirna

More information

Title: Mapping T cell epitopes in PCV2 capsid protein - NPB #08-159. Date Submitted: 12-11-09

Title: Mapping T cell epitopes in PCV2 capsid protein - NPB #08-159. Date Submitted: 12-11-09 Title: Mapping T cell epitopes in PCV2 capsid protein - NPB #08-159 Investigator: Institution: Carol Wyatt Kansas State University Date Submitted: 12-11-09 Industry summary: Effective circovirus vaccines

More information

RNA-based therapeutics hold significant potential as promising

RNA-based therapeutics hold significant potential as promising Supplement to the May 2011 Issue of pharmtech.com 2011 The Industry s Authoritative Source MicroRNA Therapeutics Perspectives in MicroRNA Therapeutics Kevin Steffy, Charles Allerson, and Balkrishen Bhat

More information

ArC Amine Reactive Compensation Bead Kit

ArC Amine Reactive Compensation Bead Kit ArC Amine Reactive Compensation Bead Kit Catalog no. A1346 Table 1. Contents and storage information. Material Amount Composition Storage Stability ArC reactive beads (Component A) ArC negative beads (Component

More information

Real-time PCR: Advancing RNA Interference and MicroRNA Studies

Real-time PCR: Advancing RNA Interference and MicroRNA Studies Real-time PCR: Advancing RNA Interference and MicroRNA Studies May 1, 2005 By: Caifu Chen, Kelly McDonald, Ada H. Wong, Olga V. Petrauskene, Manohar R. Furtado MicroRNAs The endogenous small RNAs known

More information

Name: Birth date: Points:1st part 2nd part Total Grade. Write your name on all pages even if the question is not answered!!!!

Name: Birth date: Points:1st part 2nd part Total Grade. Write your name on all pages even if the question is not answered!!!! STOCKHOLMS UNIVERSITET Institutionen för biologisk grundutbildning Re-exam in Molecular Biology and Genome Analysis, 2009-02-14 Name: Birth date: Points:1st part 2nd part Total Grade Time for the exam

More information

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells. Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,

More information

Transvascular delivery of small interfering RNA to the central nervous system. P. Kumar et al. (2007) Nature Vol. 448

Transvascular delivery of small interfering RNA to the central nervous system. P. Kumar et al. (2007) Nature Vol. 448 Transvascular delivery of small interfering RNA to the central nervous system P. Kumar et al. (2007) Nature Vol. 448 1 Outline 1. Introduction 2. Objective 3. Results 4. Summary 5. Take-Home-Lesson 6.

More information

FROM FUNCTION TO GENES. Reverse Genetics - investigating the function of known genes by targeted disruption FROM GENES TO FUNCTION

FROM FUNCTION TO GENES. Reverse Genetics - investigating the function of known genes by targeted disruption FROM GENES TO FUNCTION Up until this point we have focused on Classical Genetics : Starting with a biochemical, developmental, or other process, identify the genes involved and figure out how they work together... FROM FUNCTION

More information

GenScript sirna Cassette Protocol

GenScript sirna Cassette Protocol GenScript sirna Cassette Protocol Technical Manual No. 0168 Version 20040510 I Introduction.... 1 II sirna Cassette.... 1 III Product Description. 2 IV Transfecting Mammalian Cells. 3 V References... 5

More information

Suppl. Figure 1. Cells cultured in oxldl take up Oil Red O in a time-dependent

Suppl. Figure 1. Cells cultured in oxldl take up Oil Red O in a time-dependent Suppl. Figure 1. Cells cultured in oxldl take up Oil Red O in a time-dependent manner. Uptake of Oil Red O was performed as detailed in Materials and Methods and absorbance of samples was expressed as

More information

hsa-mir-92a Real-time RT-PCR Detection and U6 Calibration Kit User Manual

hsa-mir-92a Real-time RT-PCR Detection and U6 Calibration Kit User Manual hsa-mir-92a Real-time RT-PCR Detection and U6 Calibration Kit User Manual Catalog # CPK2059 For the detection and quantification of mirnas hsa-mir-92a normalized by U6 snrna using Real-time RT-PCR detection

More information

RNAi Explorer. Product Guide

RNAi Explorer. Product Guide Product Guide RNA Interference, sirna, shrna, Dicer, RISC, sirna Design & Search, shrna Design, Chemical Synthesis of sirna, shrna DNA Oligos RNAi Explorer Kit, sirna Explorer, shrna Explorer RNAi Explorer

More information

Silencer sirna Transfection II Kit

Silencer sirna Transfection II Kit Silencer sirna Transfection II Kit (Part Number AM1631) Protocol I. Introduction....................................................... 1 A. Background B. Product Description C. Silencer sirna Transfection

More information

GenEZ TM ORF clone. User manual. Table of Contents. For research use only. Page 1 of 8. Version: Nov, General information

GenEZ TM ORF clone. User manual. Table of Contents. For research use only. Page 1 of 8. Version: Nov, General information GenEZ TM ORF clone User manual Version: Nov, 2015 Table of Contents 1. General information 2. User instructions 3. Experimental protocol Protocol for transient transfection Detection of overexpressed protein

More information

TITLE: Inhibition of Th17 Cell Differentiation as a Treatment for Multiple Sclerosis

TITLE: Inhibition of Th17 Cell Differentiation as a Treatment for Multiple Sclerosis AD Award Number: W81XWH-11-1-0736 TITLE: Inhibition of Th17 Cell Differentiation as a Treatment for Multiple Sclerosis PRINCIPAL INVESTIGATOR: Annalisa D Andrea, Ph.D. CONTRACTING ORGANIZATION: SRI International

More information

RNA. Chapter 2. Transcription is the first stage in gene expression, and the principal step at which it is controlled.

RNA. Chapter 2. Transcription is the first stage in gene expression, and the principal step at which it is controlled. RNA Chapter 2 Transcription is the first stage in gene expression, and the principal step at which it is controlled. Regulatory proteins determine whether a particular gene is available to be transcribed

More information

Nanotechnology in Gene and Drug Delivery

Nanotechnology in Gene and Drug Delivery Nanotechnology in Gene and Drug Delivery Gene Therapy Gene therapy is a technique for correcting defective genes responsible for disease development. Researchers may use one of several approaches for correcting

More information

TriFECTa Dicer-Substrate RNAi Manual

TriFECTa Dicer-Substrate RNAi Manual TriFECTa Dicer-Substrate RNAi Manual Contents Introduction... 1 Receiving a TriFECTa Dicer-Substrate RNAi Kit... 2 The TriFECTa Library... 3 Outline of an RNAi Experiment... 4 Choice of Transfection Method...

More information

Gene expression is regulated by the cell, and mutations can affect this expression.

Gene expression is regulated by the cell, and mutations can affect this expression. Section 4: Gene expression is regulated by the cell, and mutations can affect this expression. K What I Know W What I Want to Find Out L What I Learned Vocabulary Review prokaryote New gene regulation

More information

Nitric Oxide Colorimetric Detection Kit

Nitric Oxide Colorimetric Detection Kit B-Bridge International, Inc. Nitric Oxide Colorimetric Detection Kit User Manual Catalog# K3023-1 1 TABLE OF CONTENTS Intended Use 3 Background 3 Assay Principle 3 Kit Components 4 Materials Required 4

More information

Micro RNAs: potentielle Biomarker für das. Blutspenderscreening

Micro RNAs: potentielle Biomarker für das. Blutspenderscreening Micro RNAs: potentielle Biomarker für das Blutspenderscreening micrornas - Background Types of RNA -Coding: messenger RNA (mrna) -Non-coding (examples): Ribosomal RNA (rrna) Transfer RNA (trna) Small nuclear

More information

Virus resistance and gene silencing in plants can be induced by simultaneous expression of sense and anti-sense RNA

Virus resistance and gene silencing in plants can be induced by simultaneous expression of sense and anti-sense RNA Virus resistance and gene silencing in plants can be induced by simultaneous expression of sense and anti-sense RNA Waterhouse et al. 1998 Presented by Sean Montgomery and Jeff Chen How are these things

More information

Outline. interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work?

Outline. interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work? Outline Outline interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work? What is RNA interference? Recently discovered regulatory level. Genome immune system.

More information

Understanding the immune response to bacterial infections

Understanding the immune response to bacterial infections Understanding the immune response to bacterial infections A Ph.D. (SCIENCE) DISSERTATION SUBMITTED TO JADAVPUR UNIVERSITY SUSHIL KUMAR PATHAK DEPARTMENT OF CHEMISTRY BOSE INSTITUTE 2008 CONTENTS Page SUMMARY

More information

Protocol. Co-transfection of 3 UTR GoClones with LightSwitch mirna Mimics or Inhibitors. Tech support: Luciferase Assay System

Protocol. Co-transfection of 3 UTR GoClones with LightSwitch mirna Mimics or Inhibitors. Tech support: Luciferase Assay System Luciferase Assay System Protocol Co-transfection of 3 UTR GoClones with LightSwitch mirna Mimics or Inhibitors LightSwitch Luciferase Assay System Workflow: 3 UTR Reporter GoClones Step 1: Seed cells in

More information

Lab 6: Biotechnology Multiple Choice Questions

Lab 6: Biotechnology Multiple Choice Questions Lab 6: Biotechnology Multiple Choice Questions 1. The enzyme that is found in retroviruses and that is required for the synthesis of DNA from RNA is DNA polymerase III RNA polymerase restriction endonuclease

More information

Cell Cycle Phase Determination Kit

Cell Cycle Phase Determination Kit Cell Cycle Phase Determination Kit Item No. 10009349 Customer Service 800.364.9897 * Technical Support 888.526.5351 www.caymanchem.com TABLE OF CONTENTS GENERAL INFORMATION 3 Materials Supplied 3 Safety

More information

Chapter 18 Regulation of Gene Expression

Chapter 18 Regulation of Gene Expression Chapter 18 Regulation of Gene Expression I. Prokaryotic Regulation of Gene Expression - Natural selection has favored bacteria that produce only the products needed by that cell. - A cell can regulate

More information

Gene Silencing Oligos (GSOs) Third Generation Antisense

Gene Silencing Oligos (GSOs) Third Generation Antisense Gene Silencing Oligos (GSOs) Third Generation Antisense Walter R. Strapps, Ph.D. Executive Director, RNA Therapeutics Idera Pharmaceuticals Cambridge, MA NASDAQ: IDRA www.iderapharma.com Idera is a leader

More information

si3d-fect INSTRUCTION MANUAL 3D Transfection Reagent dedicated to sirna delivery for Scaffolds www.ozbiosciences.com

si3d-fect INSTRUCTION MANUAL 3D Transfection Reagent dedicated to sirna delivery for Scaffolds www.ozbiosciences.com si3d-fect INSTRUCTION MANUAL 3D Transfection Reagent dedicated to sirna delivery for Scaffolds www.ozbiosciences.com si3d-fect Instruction Manual si3d-fect transfection reagent 3D Transfection: a new outlook

More information

RAPAd mirna Adenoviral Expression System Catalog #: VPK-253

RAPAd mirna Adenoviral Expression System Catalog #: VPK-253 DATENBLATT RAPAd mirna Adenoviral Expression System Catalog #: VPK-253 FOR RESEARCH USE ONLY Not for use in diagnostic procedures Introduction MicroRNAs (mirnas) are 18 24 nucleotide RNA molecules that

More information

Analysis of protein targeting in living cells by transfection, fluorescent fusion protein expression, and vital staining

Analysis of protein targeting in living cells by transfection, fluorescent fusion protein expression, and vital staining Professor Abby Dernburg page 1 of 7 Fluorescent proteins have only been harnessed as an experimental tool for the last dozen years or so - in 1994, the green fluorescent protein (GFP) from the jellyfish

More information

GeneArt CRISPR Nuclease mrna System

GeneArt CRISPR Nuclease mrna System PRODUCT BULLETIN GeneArt CRISPR System GeneArt CRISPR System High-efficiency, multiplex-compatible genome editing tool for a broad range of cell types Introduction Clustered regularly interspaced short

More information

Fast, easy and effective transfection reagent for mammalian cells

Fast, easy and effective transfection reagent for mammalian cells METAFECTENE EASY + Fast, easy and effective transfection reagent for mammalian cells For ordering information, MSDS, publications and application notes see www.biontex.com Description Cat. No. Size METAFECTENE

More information

CHAPTER 7 From DNA to Protein

CHAPTER 7 From DNA to Protein CHAPTER 7 From DNA to Protein DNA doesn t direct protein synthesis itself, but acts rather like manger, delegating the various tasks required to a team of workers. When a particular proteins is needed

More information

Inducing RNAi in Mammalian Cells

Inducing RNAi in Mammalian Cells Inducing RNAi in Mammalian Cells Ambion, Inc. www.ambion.com techserv@ambion.com sirna localized to the perinuclear space View at: www.ambion.com/techlib/presentations Important Applications of RNAi Ascertain

More information