Supplementary Figure 1.



Similar documents
OriGene Technologies, Inc. MicroRNA analysis: Detection, Perturbation, and Target Validation

Instructions. Torpedo sirna. Material. Important Guidelines. Specifications. Quality Control

RAPAd mirna Adenoviral Expression System Catalog #: VPK-253

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

pcas-guide System Validation in Genome Editing

mirnaselect pep-mir Cloning and Expression Vector

HiPerFect Transfection Reagent Handbook

2.1.2 Characterization of antiviral effect of cytokine expression on HBV replication in transduced mouse hepatocytes line

Micro RNAs: potentielle Biomarker für das. Blutspenderscreening

Recombinant DNA and Biotechnology

TOOLS sirna and mirna. User guide

INTERFERin in vitro sirna/mirna transfection reagent PROTOCOL. 1 Standard sirna transfection of adherent cells... 2

Integrated Protein Services

A role of microrna in the regulation of telomerase? Yuan Ming Yeh, Pei Rong Huang, and Tzu Chien V. Wang

Molecular Biology Techniques: A Classroom Laboratory Manual THIRD EDITION

Integrated Protein Services

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

MicroRNA formation. 4th International Symposium on Non-Surgical Contraceptive Methods of Pet Population Control

User Manual/Hand book. qpcr mirna Arrays ABM catalog # MA003 (human) and MA004 (mouse)

SUPPLEMENTARY DATA 1

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

岑 祥 股 份 有 限 公 司 技 術 專 員 費 軫 尹

Understanding the immune response to bacterial infections

One Step mirna Cloning Vector G0760 pfbaavmu6mcs CMVeGFP SV40pA

Biotechnology: DNA Technology & Genomics

Notch 1 -dependent regulation of cell fate in colorectal cancer

Superior TrueMAB TM monoclonal antibodies for the recognition of proteins native epitopes

SUPPLEMENTARY FIGURES

Introduction To Real Time Quantitative PCR (qpcr)

Mouse ES Cell Nucleofector Kit

Reprogramming, Screening and Validation of ipscs and Terminally Differentiated Cells using the qbiomarker PCR Array System

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

Supplemental Information. McBrayer et al. Supplemental Data

bitter is de pil Linos Vandekerckhove, MD, PhD

Lezioni Dipartimento di Oncologia Farmacologia Molecolare. RNA interference. Giovanna Damia 29 maggio 2006

Taq98 Hot Start 2X Master Mix

Mir-X mirna First-Strand Synthesis Kit User Manual

Essentials of Real Time PCR. About Sequence Detection Chemistries

hydrocortisone (5 mg/ml), EGF (10 µg/ml) and Heparin (5000 U/ml). Antibodies against the N-terminal peptide of MEK1 (MEK1-N) and against Flotillin 1

MEF Starter Nucleofector Kit

Investigating the role of a Cryptosporidium parum apyrase in infection

MEF Nucleofector Kit 1 and 2

Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products

RT-PCR: Two-Step Protocol

Validation & Assay Performance Summary

QIAGEN Transfection Technologies

Optimized Protocol sirna Test Kit for Cell Lines and Adherent Primary Cells

RNA Structure and folding

Protein Expression. A Practical Approach J. HIGGIN S

RNA & Protein Synthesis

Inhibition of MicroRNA Sensitizes 3D Breast Cancer Microtissues to Radiation Therapy

Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix

Recombinant DNA Unit Exam

restriction enzymes 350 Home R. Ward: Spring 2001

Molecular Genetics. RNA, Transcription, & Protein Synthesis

PreciseTM Whitepaper

THE His Tag Antibody, mab, Mouse

qstar mirna qpcr Detection System

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription

Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr

ALLEN Mouse Brain Atlas

The world of non-coding RNA. Espen Enerly

CD3/TCR stimulation and surface detection Determination of specificity of intracellular detection of IL-7Rα by flow cytometry

Bacterial Transformation and Plasmid Purification. Chapter 5: Background

Synaptophysin Regulates the Kinetics of Synaptic Vesicle Endocytosis in Central Neurons

PRODUCT INFORMATION...

Global MicroRNA Amplification Kit

Manual for: sirna-trans Maximo Reagent

Relative Quantification of mirna Target mrnas by Real-Time qpcr. 1 Introduction. Gene Expression Application Note No. 4

STUDIES ON SEED STORAGE PROTEINS OF SOME ECONOMICALLY MINOR PLANTS

Materials and Methods. Blocking of Globin Reverse Transcription to Enhance Human Whole Blood Gene Expression Profiling

mirnaselect pegp-mir Cloning and Expression Vector

GRS Plasmid Purification Kit Transfection Grade GK (2 MaxiPreps)

micrornas Non protein coding, endogenous RNAs of 21-22nt length Evolutionarily conserved

PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY

Expression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu

Updated: July ' End label RNA markers (18mer) and (24mer) with Kinase and 32P-gamma-ATP. Gel purify labeled markers.

EXPRESSION ARREST shrna mir GENOME- WIDE LIBRARIES

HCS Exercise 1 Dr. Jones Spring Recombinant DNA (Molecular Cloning) exercise:

Northern blot analysis for microrna. (Narry Kim s lab)

Anti-ATF6 α antibody, mouse monoclonal (1-7)

PrimePCR Assay Validation Report

RNAi Shooting the Messenger!

Head of College Scholars List Scheme. Summer Studentship. Report Form

HiPer RT-PCR Teaching Kit

RevertAid Premium First Strand cdna Synthesis Kit

Supplementary Materials for

First Strand cdna Synthesis

Name Class Date. Figure Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

ELISA BIO 110 Lab 1. Immunity and Disease

Transcription:

Supplementary Figure 1. (A) MicroRNA 212 enhances IS from pancreatic β-cells. INS-1 832/3 β-cells were transfected with precursors for mirnas 212, 375, or negative control oligonucleotides. 48 hrs after transfection, IS was measured in response to varying glucose concentrations or elevated KCl. IS into the medium is normalized to total insulin content. Data is representative of 5 independent experiments. Insulin transcript expression and protein content in INS-1 cells did not change after transfection with precursors of mirnas 132 and 212. Insulin transcript (B) and insulin protein content (C) were measured from the lysates of cells transfected with pre-mir- 132, pre-mir-212, pre-mir-375 or a Pre-miRTM negative control. Insulin content was normalized to total protein. *p < 0.05; **p < 0.01; ***p < 0.001 as compared to the negative control.

Supplementary Figure 2. Adenovirus-GFP does not affect insulin secretion. INS-1 832/3 cells were either left untreated (NT) or transfected with Ad-GFP. 48 hrs after infection, IS was measured in response to 15 mm Glucose. IS is normalized to total insulin content, and depicted as % of fractional release. Graph is an average of n = 6 experiments.

Supplementary Figure 3. CACT is the most downregulated mrna in response to mirna 132 and 212 overexpression. Differential expression (DE) of mrna resulting from mirna-132 is plotted against DE resulting from mirna-212, 10hrs following introduction of mirna oligonucleotides into INS-1 832/3 β-cells (p<0.05). Larger symbols indicate greater statistical significance for DE. ~6.7 % of the depicted mrna has a seed region. Axes show the log10 of the fold-change (mirna over negative control). Negative values indicate downregulation of expression. CACT is highlighted as the most downregulated gene in response to both mirnas.

Supplementary Figure 4. CACT (A) mrna and (B) protein abundance is downregulated in response to sirna oligonucleotides against CACT. (A) RNA was isolated and CACT expression levels were measured using qpcr methods (described in the methods section) 48 hours post transfection with sicact oligonucleotides. *p < 0.05 as compared to the negative control. (n =4) (B) sirna-cact decreases CACT protein level. Western blot analysis was used to evaluate the effect of CACT sirna on CACT protein levels in INS-1 832/3 cells. INS-1 832/13 cells were transfected with CACT sirna or negative control (Scr-siRNA) 832/13 β-cells. Cells were harvested 48 hours after transfection and 25 μg of protein was loaded per lane; Vdac protein was used to normalize loading. Blot is representative of 4 independent experiments.

Supplementary Figure 5. Steroyl-L-carnitines enhances IS. 48hrs after plating INS-1 832/3 cells, IS was measured in response to 7 mm glucose alone or in the presence of stearoyl-carnitine (50 μm) or palmitic acid (600 μm). Insulin secreted is normalized to total cellular insulin content and data is expressed relative to 7 mm glucose alone (NT) (2 hrs, n>4). *p < 0.05; **p < 0.01; ***p < 0.001.

Supplementary Figure 6. (A & B) Metabolic profile demonstrates a subtle increase in long-chain acylcarnitines in response to CACT down-regulation. INS-1 832/13 cells were transfected with CACT sirnas or control oligonucleotides (Scr-siRNA) and maintained for 48 hrs in RPMI supplemented without any exogenous L-carnitine. Two hours prior to harvesting the cells for metabolic profiling, the culture medium was refreshed without (A) or with (B) PC (50 μm) and 1.5 mm glucose. All metabolite measurements in response to CACT sirna is normalized to control measurements. All experiments were performed n = 3 times. *p < 0.05; **p < 0.01; ***p < 0.001.

Supplementary Figure 7. Palmitoyl-L-carnitine cannot activate GPR40. GPR40/CHO nuclear factor of activated T-cells β-lactamase cells were seeded into black-wall clear-bottom 384-well plates (Costar) 1 day before the assay. The cells were incubated with Hanks buffered salt solution buffer with 0.1% BSA, 2.5 mmol/l probenecid, and 8 μmol/l Fluo-4-AM at room temperature for 100 min. Fluorescence output was measured using a fluorometric imaging plate reader (FLIPR) assay. Compund A, linoleic acid, acetyl-carnitine and palmitoyl-carnitine were added to observe their effect on GPR40 activity. Experiment was repeated twice.

Supplementary Table 1. Acyl-carnitine molecules profiled by Mass spec and their correlation with IS. This table enlists all the acyl-carnitine moelcules that were surveyed by the Mass spec profilfing experiment. Column two of the table shows the coefficient of correlation of each metabolite with the IS effect depicted in Fig. 3B. Column three shows if the metabolite was significantly different between sicact and Scrambled treated cells in the absence or presence of exogenous PC (50μM). *p < 0.05; **p < 0.01; ***p < 0.001. Acyl-carnitine Correl Coeff TTEST C2 0.899825 ** C3 0.857961 * C4 0.878836 * C5:1 0.332214 * C5 0.947179 ** C4-OH 0.81364 C6 0.747288 C5-OH 0.836689 C3-DC 0.741238 * C4-DC 0.725612 C8:1 0.808295 C8 0.732469 C5-DC 0.822696 C8:1-OH/C6:1-DC 0.739477 C8-OH/C6-DC 0.830778 C10:3 0.601103 C10:2 0.78422 * C10:1 0.867477 C10 0.895005 ** C7-DC 0.892962 * C8:1-DC 0.860196 ** C8-DC 0.904018 C12:1 0.720082 C12 0.918573 ** C12-OH/C10-DC 0.961403 C14:2 0.899224 C14:1 0.901048 * C14 0.953624 *** C14:1-OH 0.984939 ** C14-OH/C12-DC 0.934851 ** C16:2 0.9788 ** C16:1 0.970214 ** C16 0.84804 ** C16:1-OH/C14:1-DC 0.95452 ** C16-OH 0.93349 ** C18:2 0.993924 ** C18:1 0.905264 *** C18 0.945182 *** C18:2-OH 0.933865 ***

C18:1-OH/C16:1-DC 0.936092 *** C18-OH/C16-DC 0.891945 ** C20:4 0.858913 ** C20 0.826204 ** C18:1-DC 0.320051 * C18-DC/C20-OH 0.463094 ** C22 0.442824 ** Supplementary Table 2. Generation of adenovirus overexpressing mirna oligonucleotides. An expression cassette of human mirnas-132, 212 or 375 contained the hairpin stem composed of 22 nt sense and antisense sequence of each mirnas, fused to a loop (19 nt) and flanking sequence that derived from human mirna-30. Expression was controlled by the human H1 promoter. To construct the H1-miRNA expression cassette, the forward and reverse oligonucleotides containing the respective mirna sense and antisense sequence, mirna30 flanking sequence and loop, BamHI and HindIII overhang were first synthesized as a pair of complementary antiparallel oligonucleotides. The forward and reverse oligonucleotides mentioned above were then annealed and ligated into a Gateway entry plasmid pentr1a (Invitrogen), containing the human H1 promoter and a GFP expression cassette driven by CMV promoter. H1-miRNACMV- GFP cassette in pentr1a plasmid was recombined into Gateway-based pad-block-it DEST vector (Invitrogen). Ad-miRNAs were produced in HEK293 cells and purified by CsCl density gradient ultracentrifugation. The purified virus was desalted by dialysis and concentrated over CentriPrepYM-50 column before use. mirna-132 forward: mirna-132 reverse: mirna-212 forward: mirna-212 reverse: mirna-375 forward: mirna-375 reverse: Primer Sequences GATCCCCGGGTATATTGCTGTTGACAGTGAGCGAGACCATGGCTG TAGACTGTTATAGTGAAGCCACAGATGTATAACAGTCTACAGCCA TGGTCGTGCCTACTGCCTCGGACTTCAAGGGTTTTTGGA AGCTTCCAAAAACCCTTGAAGTCCGAGGCAGTAGGCACGACCATG GCTGTAGACTGTTATACATCTGTGGCTTCACTATAACAGTCTACAG CCATGGTCTCGCTCACTGTCAACAGCAATATACCCGGG GATCCCCGGGTATATTGCTGTTGACAGTGAGCGCGGCCGTGACTG GAGACTGTTATAGTGAAGCCACAGATGTATAACAGTCTCCAGTCA CGGCCATGCCTACTGCCTCGGACTTCAAGGGTTTTTGGA AGCTTCCAAAAACCCTTGAAGTCCGAGGCAGTAGGCATGGCCGTG ACTGGAGACTGTTATACATCTGTGGCTTCACTATAACAGTCTCCA GTCACGGCCGCGCTCACTGTCAACAGCAATATACCCGGG GATCCCCGGGTATATTGCTGTTGACAGTGAGCGCCACGCGAGCCG AACGAACAAATAGTGAAGCCACAGATGTATTTGTTCGTTCGGCTC GCGTGATGCCTACTGCCTCGGACTTCAAGGGTTTTTGGA AGCTTCCAAAAACCCTTGAAGTCCGAGGCAGTAGGCATCACGCGA GCCGAACGAACAAATACATCTGTGGCTTCACTATTTGTTCGTTCG GCTCGCGTGGCGCTCACTGTCAACAGCAATATACCCGGG