MicroRNA formation mirna s are processed from several precursor stages Mammalian genomes seem to have 100 s of mirna s Nucleotides in positions 2-8 of an mirna are considered the mirna seed 5 Methyl-G cap mrna target 3 UACGCGAGCCGACCCUACCUCC! 3 UGAUAUGUUGGAUGAUGGAGU 5 mirna Let-7a polya tail 3 Antagomir=backbone modified antisense complementary to mirnabinds and blocks function. X Functional inhibition of mirna loaded RISC. Alliance for Contraception in Cats & Dogs acc-d.org 1
Nat. Cell Biol. 2005 sirna Binding of sirna in Piwi domain of Argonautes 5 A. fulgidus Piwi protein 3 5 Small interfering RNAs or sirnas bind to their targets by full complementarity and direct RISC to cleave target mrna at a precise position. Cleavage Takes Place at Center of sirna-target Duplex First demonstration of RNAi in Mammalian Cells NAAGCCUGUGCCUCUUCAGCUACC UUCGGACACGGAGAAGUCGAUGp5 Hutvagner G, Zamore PD. Science. 2002;297:2056-60. Figure 4 Elbashir, SM et al 2001 Nature 411:494 Alliance for Contraception in Cats & Dogs acc-d.org 2
shrna = short hairpin RNA; sirna = short interfering RNA; RISC = RNAinduced silencing complex Scherer LJ, Rossi JJ. Nat Biotechnol. 2003;21:1457-65. Alliance for Contraception in Cats & Dogs acc-d.org 3
Systemic delivery of sirnas Getting RNAs to target cells. Example of Ewings Sarcoma target transcript. mrna derives from fusion of two genes to create novel target Hu-Lieskovan, S, et al., Cancer Research, 65:2005 EWS-FLI1 gene fusion in Ewing s Sarcoma Cyclodextrin LD 50 i.v. rat β-cd ~0.5 g/kg Methylated β -CD: no toxicity at 1 g/kg each week for 4 doses i.v.hydroxypropyl- β -CD in monkeys of 10 g/kg is not lethal Alliance for Contraception in Cats & Dogs acc-d.org 4
Experimental Design Xenogen Camera Lentivirus Luciferase Construct 5x10 6 Cells per mouse TfR-positive TC71 Formulated sirna NOD/SCID 6-8wk GROUPS D5W --- solution Naked EFBP2 sirna in D5W Fully formulated sicon1 in D5W Targeted EFBP2 sirna in D5W -- transferrin ligand Non-targeted EFBP2 sirna in D5W -- no transferrin MOUSE IMAGES FOR ALL TREATMENT GROUPS mg/kg Twice Weekly Injections for Four Weeks 2.5 Alliance for Contraception in Cats & Dogs acc-d.org 5
Summary Fully formulated CD with transferrin ligand and anti-ews-fli1 sirna effectively block tumor formation in vivo in a murine system. Potential Carrier for other sirnas and other applications. Random RNA library SELEX Aptamers Library (DNA oligos) Fixed Random Fixed 1: PCR 2: In vitro transcription Anti HIV gp120 Envelope aptamers gp41 HIV virion gp120 New RNA library 2-n SELEX round Random RNA library (2 -F modified RNAs) Individual Aptamers 1: RT-PCR 2: In vitro transcription Binding with target protein A-1 B-68 After 10-15 Cycles Clone and sequence SELEX: Systematic Evolution of Ligands by EXponential enrichment Preparation of Random RNA library Selection partitioning Amplification of functional RNA Isolation of Aptamer Target protein Removal of unbound RNAs Elution and Recovery of Bound RNAs Selection partitioning Bound RNAs Methods: Membrane filters, affinity columns, beads, cells K D (nm) 52.83 ±7.02 nm K D (nm) 97.76 ±18.77 nm Cell type-specific delivery system: Aptamer-stick-siRNA system Delivery application of anti-gp120 aptamer Amy Yan and Andrew Ellington, A Hitchhiker s Guide to HIV, vol. 16, 1356-1358. (2008) Zhou,. Li,. Li, J. Zara, Rossi, Molecular Ther. (2008) Zhou,et al: Nuc. Acids Research 2009 Alliance for Contraception in Cats & Dogs acc-d.org 6
Real-time live cells confocal microscopy Internalization in CHO-gp160 cells of Cy3-gp120 aptamer Humanized RAG-hu mouse test of anti-gp120 aptamer-sirna chimeras Movie (10 min to 6 h) Chimeras A-1 Rag2-/-gamma c-/- mouse HIV NL4-3 infection 3 weeks 4 infection th week Naked sirna injection injection 5 th week 6 th week 7 th week 8 th week 1 th week infection Untreated 10 min CHO-EE control + Cy3-labled Chimeras A-1 2 h 3 h 4 h 5 h The humanized Rag2-/-gc-/- mice (RAG-hu) engrafted with CD34 hematopoietic progenitor cells were infected with HIV-1 NL4.3 virus intraperitonially. One injection of 10 µg experimental RNA per week. 5 th week sample for sirna and Tat/rev detection 1-9 weeks samples for viral loading test monitored by real-time PCR. : Treatment start-stop Identify specific receptor on target cells/ tissue of interest Select aptamer using purified receptor or cell based selection. Use aptamer to deliver sirna(cocktail) to trigger apoptosis of target cells/tissues. Alliance for Contraception in Cats & Dogs acc-d.org 7