Next Generation Sequencing



Similar documents
( TUTORIAL. (July 2006)

GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core

(A) Microarray analysis was performed on ATM and MDM isolated from 4 obese donors.

Table S1. Related to Figure 4

DNA Sample preparation and Submission Guidelines

10 µg lyophilized plasmid DNA (store lyophilized plasmid at 20 C)

Molecular analyses of EGFR: mutation and amplification detection

Inverse PCR & Cycle Sequencing of P Element Insertions for STS Generation

The p53 MUTATION HANDBOOK

Introduction to Perl Programming Input/Output, Regular Expressions, String Manipulation. Beginning Perl, Chap 4 6. Example 1

UNIVERSITETET I OSLO Det matematisk-naturvitenskapelige fakultet

Mutations and Genetic Variability. 1. What is occurring in the diagram below?

SERVICES CATALOGUE WITH SUBMISSION GUIDELINES

Supplementary Information. Binding region and interaction properties of sulfoquinovosylacylglycerol (SQAG) with human

Hands on Simulation of Mutation

Gene Synthesis 191. Mutagenesis 194. Gene Cloning 196. AccuGeneBlock Service 198. Gene Synthesis FAQs 201. User Protocol 204

Gene Finding CMSC 423

Inverse PCR and Sequencing of P-element, piggybac and Minos Insertion Sites in the Drosophila Gene Disruption Project

pcas-guide System Validation in Genome Editing

Introduction to next-generation sequencing data

Part ONE. a. Assuming each of the four bases occurs with equal probability, how many bits of information does a nucleotide contain?

Y-chromosome haplotype distribution in Han Chinese populations and modern human origin in East Asians

NimbleGen SeqCap EZ Library SR User s Guide Version 3.0

ANALYSIS OF A CIRCULAR CODE MODEL

Module 6: Digital DNA

Chapter 9. Applications of probability. 9.1 The genetic code

Association of IGF1 and IGFBP3 polymorphisms with colorectal polyps and colorectal cancer risk

pcmv6-neo Vector Application Guide Contents

14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2

DNA Bracelets

TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR

The making of The Genoma Music

Marine Biology DEC 2004; 146(1) : Copyright 2004 Springer

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects

The DNA-"Wave Biocomputer"

Insulin Receptor Gene Mutations in Iranian Patients with Type II Diabetes Mellitus

July 7th 2009 DNA sequencing

APOT - Assay. Protocol for HPV16 and 18. Amplification of Papilloma Virus Oncogene Transcripts HPV. E6 E7 E1 Zelluläre DNA poly(a)

Transmembrane Signaling in Chimeras of the E. coli Chemotaxis Receptors and Bacterial Class III Adenylyl Cyclases

Event-specific Method for the Quantification of Maize MIR162 Using Real-time PCR. Protocol

Problem Set 3 KEY

Five-minute cloning of Taq polymerase-amplified PCR products

Drosophila NK-homeobox genes

Biopython Tutorial and Cookbook

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

Characterization of cdna clones of the family of trypsin/a-amylase inhibitors (CM-proteins) in barley {Hordeum vulgare L.)

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage

Next Generation Sequencing

All commonly-used expression vectors used in the Jia Lab contain the following multiple cloning site: BamHI EcoRI SmaI SalI XhoI_ NotI

Archimer

Data Analysis for Ion Torrent Sequencing

Six Homeoproteins and a Iinc-RNA at the Fast MYH Locus Lock Fast Myofiber Terminal Phenotype

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office

Heraeus Sepatech, Kendro Laboratory Products GmbH, Berlin. Becton Dickinson,Heidelberg. Biozym, Hessisch Oldendorf. Eppendorf, Hamburg

Taqman TCID50 for AAV Vector Infectious Titer Determination

inhibition of mitosis

Protein Synthesis Simulation

History of DNA Sequencing & Current Applications

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

Chlamydomonas adapted Green Fluorescent Protein (CrGFP)

Next generation DNA sequencing technologies. theory & prac-ce

Immortalized epithelial cells from human autosomal dominant polycystic kidney cysts

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità

The nucleotide sequence of the gene for human protein C

TA Cloning Kit. Version V 7 April Catalog nos. K , K , K , K , K K , K , K

RT-PCR: Two-Step Protocol

BD BaculoGold Baculovirus Expression System Innovative Solutions for Proteomics

Automated DNA sequencing 20/12/2009. Next Generation Sequencing

Molecular Facts and Figures

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

4 th DVFA Life Science Conference. Going East / Going West. Life Science Asia/Europe getting insight in mutual growth opportunities

Thermo Scientific Phusion Site-Directed Mutagenesis Kit #F-541

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?

Directed-Mutagenesis and Deletion Generated through an Improved Overlapping-Extension PCR Based Procedure

Transcription:

Next Generation Sequencing 38. Informationsgespräch der Blutspendezentralefür Wien, Niederösterreich und Burgenland Österreichisches Rotes Kreuz 22. November 2014, Parkhotel Schönbrunn

Die Zukunft hat begonnen.

Generationen 1 Sanger 2 Roche454/Illumina/IonTorrent 3 Pacific Biosystems 4 Oxford Nanopore

Emulsion PCR

DirectsequencingofUnseparated Alleles CCRCCCCGAMCGATCTACTCACTACTCACTWC

CloningandSequencing CCRCCCCGAMCGATCTACTCACTACTCACTWC CCACCCCGACCGATCTACTCACTACTCACTAC CCGCCCCGAACGATCTACTCACTACTCACTTC

NGS CCRCCCCGAMCGATCTACTCACTACTCACTWC CCACCCC ACCCCGACCGA CCGAACGAT AACGATCTACT CTCACTACTCACTAC TACTCACTTC

Sequencing Errors InsertionsandDeletionsmainlyon homopolymer stretches: Ref: CCCCG #1: CCCCCG #2: CCCG #3: CTCCG

2 nd Generation, Library Prep PCR Emulsion PCR Polony Amplification Semiconductor Sequencing Pyro Sequencing Reversible Terminator Sequencing

Sanger vsngs (2 nd Generation) Workflow PCR (Exons2, 3) Sequenzierreaktion Capillarelektophorese Amplifikation einzelner Moleküle Run, Erfassung der Rxn in Echtzeit @YSEVQ:4:21 ACCGGGAGACACAGATCTGCAAGGCCAAGGCGACAGACTG ACCGAGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAG AGCGAGGCCGGTGAGTGACCCCGGCCCGGGGCGCAGGTC ACGACCGCCCATCCACGTACGCGGCGCCCGATC + @@9>>4;;;45276649/3.307.73;592++,9:8;97<:=;AABBBB >B=@?;;4944188889399=;<8:97396>>>>?@99393929>9 430,,00&,&-0&-00&.86893332..-.'-25+6,,(+1011--,2.4047*001+

Proof of Principle Bentley et al, Tissue Antigens 2009, 74:393 Gabriel et al, Hum Immunol2009, 70:960 Lindet al, Hum Immunol2010, 71:1033 Erlichet al, BMC Genomics2011, 12:42 Holcomb et al, Tissue Antigens 2011, 77:206 Wang et al, ProcNatlAcadSci2012,109:8676 Shiina et al, Tissue Antigens 2012, 80:305

B*57:01? HIV Patient from Niederösterreich

Deletionin Exon3 gdna 720 730 740 750 760 770 780 790 800 810 B*44:138Q GGCCAG GGTC TCACA...TCCAG AGGATGTACG GCTGCGACGT GGGGCCGGAC GGGCGCCTCC TCCGCGGGTA TGACCAGGAC GCCTACGACG GCAAGGATTA B*44:02:01:01 ------ ---- -----TCA----- ---------- ---------- ---------- ---------- ---------- ---------- ---------- ----------

Sanger-Primer Designation Sequence (5 ->3 ) Purpose B*44--18fwd GCA CCC ACC CGG ACT CAG AA Amplification & Sequencing B*44-3347rev GGG GTC ACG GTG GAC ACG G Amplification & Sequencing B*44-559 rev TCG TCC ACG TAG CCC ACG GT Sequencing B*44-1034fwd GGG TCT CAC ATC ATC CAG AGG Sequencing B*44-1830fwd GTC CTA GGG TGT CCC ATG AG Sequencing B*44-2155rev GAA GAG ATA TGA CCC CTC ATC Sequencing B*44-2182fwd CTG GAG CCC TTC AGC AGG Sequencing B*44-2346fwd TGT GAT GTG TAG GAG GAA GAG C Sequencing B*44-2797fwd TCC CAG TCC CCT CAC AGG G Sequencing B*44-3041rev CCC ACC CAC CCC CAG ACC T Sequencing

NGS-Primer Designation Sequence (5 ->3 ) Purpose B_F1 CCC GGT TGC AAT AGA CAG TAA CAA A NGS Amplification (Shiinaetal.) B_R1 GGG TCC AAT TTC ACA GAC AAA TGT NGS Amplification (Shiina et al.)

Gene Conversion& Mutations B*44:138Q -281 726 1613 2898 III I B*44:02:01:01 B*46:01:01

Propositi Patient SN: Father SG: Sister SGr: Brother SA: HLA Typing A*02:01/09,*03:01 B*07:02,*44:138Q C*07:02,*07:04 A*23:01,*03:01 B*44:03,* 44:138Q C*04:01,*07:04 A*02:01/09,*23:01 B*07:02,*44:03 C*07:02,*04:01 A*02:01/09,*03:01 B*40:01,* 44:138Q C*03:04,*07:04

Super high resolution for single molecule-sequence-based typing of classical HLA loci at the 8-digit level using next generation sequencers, T. Shiina, et al. Tissue Antigens, 2012, 80, 305 316

HLA Typingon a 314 Chip

HLA TypeStreamT Analysis Software

Coverage

Advantages Whole gene sequencing possible Clonal sequences Automation Chip size Low to High throughput Costs

Flaws, Outlook HLA/IMGT database currently incomplete->? Urgent samples? Emulsion PCR? Length of reads GC rich regions Coverage Phase Amplification bias -> Third Generation Sequencing?

Sanger vsngs (3 rd Generation) Workflow PCR (Exons2, 3) Sequenzierreaktion Capillarelektophorese Amplifikation einzelner Moleküle Run, Erfassung der Rxn in Echtzeit @YSEVQ:4:21 ACCGGGAGACACAGATCTGCAAGGCCAAGGCGACAGACTG ACCGAGAGAACCTGCGGATCGCGCTCCGCTACTACAACCAG AGCGAGGCCGGTGAGTGACCCCGGCCCGGGGCGCAGGTC ACGACCGCCCATCCACGTACGCGGCGCCCGATC + @@9>>4;;;45276649/3.307.73;592++,9:8;97<:=;AABBBB >B=@?;;4944188889399=;<8:97396>>>>?@99393929>9 430,,00&,&-0&-00&.86893332..-.'-25+6,,(+1011--,2.4047*001+

Generation 4 -NanoporeSequencing Single molecule sequencing incorporating nanopore technology Protein pore->solid state channel(dna-transistor) USB size portable DNA sequencer Wholegenomescan15 min Very low cost

Schematic of the nanopore device. Schreiber J et al. PNAS 2013;110:18910-18915 2013 by National Academy of Sciences

Strategy for reading epigenetic modifications on a target CG dinucleotide. Schreiber J et al. PNAS 2013;110:18910-18915 2013 by National Academy of Sciences

Die Zukunft hat begonnen... und ist noch jung