14/12/2012. HLA typing - problem #1. Applications for NGS. HLA typing - problem #1 HLA typing - problem #2



Similar documents
The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

SEQUENCING. From Sample to Sequence-Ready

HISTO SPOT SSO System. The most convenient automated HLA typing system. BAG Health Care the experts for HLA and blood group diagnostics

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?

How is genome sequencing done?

HISTO SPOT SSO System. The most convenient automated HLA typing system. BAG Health Care the experts for HLA and blood group diagnostics

July 7th 2009 DNA sequencing

empcr Amplification Method Manual - Lib-A

Genome Sequencer System. Amplicon Sequencing. Application Note No. 5 / February

Illumina TruSight HLA Sequencing Panel Automated on the Biomek FX P HLA SP Liquid Handler

Next generation DNA sequencing technologies. theory & prac-ce

Data Analysis for Ion Torrent Sequencing

Introduction to next-generation sequencing data

Next Generation Sequencing

History of DNA Sequencing & Current Applications

FOR REFERENCE PURPOSES

Genomics GENterprise

HISTO SPOT SSO System

Overview of Next Generation Sequencing platform technologies

Multiplex your most important

How To Use An Enzymatics Spark Dna Sample Prep Kit For Ion Torrent

Agencourt AMPure XP. Xtra Performance Post-PCR clean UP

PreciseTM Whitepaper

Universidade Estadual de Maringá

Automated DNA sequencing 20/12/2009. Next Generation Sequencing

Cluster Generation. Module 2: Overview

Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office

TruSeq Custom Amplicon v1.5

Next Generation Sequencing

SUPPLEMENTARY METHODS

Genomic DNA detection assay

TruSeq DNA Methylation Library Preparation Guide

Human Leukocyte Antigens - HLA

BIOO LIFE SCIENCE PRODUCTS

DNA Sequence Analysis

Single-Cell DNA Sequencing with the C 1. Single-Cell Auto Prep System. Reveal hidden populations and genetic diversity within complex samples

Introduction Bioo Scientific

BacReady TM Multiplex PCR System

NGS data analysis. Bernardo J. Clavijo

HISTOCOMPATIBILITY. and IMMUNOGENETICS. Prospectus

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing

Introduction To Real Time Quantitative PCR (qpcr)

GenScript BloodReady TM Multiplex PCR System

Description: Molecular Biology Services and DNA Sequencing

The RNAi Consortium (TRC) Broad Institute

Concepts and methods in sequencing and genome assembly

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED

HiPer RT-PCR Teaching Kit

Handling next generation sequence data

Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: Office: 764 Brown

AxyPrep TM Mag PCR Clean-up Protocol

Real-time quantitative RT -PCR (Taqman)

NimbleGen SeqCap EZ Library SR User s Guide Version 3.0

4. GS Reporter Application 65

Rapid DNA Analysis DNA: the Ultimate Biometric? Advances in Molecular Processing and Analysis

Illumina Sequencing Technology

HISTO TYPE SSP Immunogenetic Diagnostics. Robust and fast - validated Taq Polymerase included

SOLID PHASE REVERSIBLE IMMOBILIZATION HIGH PERFORMANCE NUCLEIC ACID ISOLATION AND PURIFICATION

Application Note. Single Cell PCR Preparation

EFI ACCREDITATION PROGRAM. INSTRUCTIONS TO APPLICANT - PACKET A and C: APPLICATION FOR ACCREDITATION AND RENEWAL OF ACCREDITATION

Automated Nucleic Acid Extraction WorkStation Faster, cleaner,

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

510K Summary. This summary of 510(k) safety and effectiveness information is being submitted in accordance with the requirements of 21 CFR

Single Nucleotide Polymorphisms (SNPs)

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation.

GeneXpert Technology. Indira Soundiram 2012

Application Guide... 2

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit

Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage

ChIP TROUBLESHOOTING TIPS

Development of a Workflow to Detect Sequence Variants in the BRCA1 and BRCA2 Genes

How To Get Rid Of Small Dna Fragments

Next Generation Sequencing for DUMMIES

ab Hi-Fi cdna Synthesis Kit

Enhancing PCR & STR Experiments. Sharron Ohgi Senior Research Associate sohgi@biomatrica.com

LightCycler 480 Real-Time PCR System

Services. Updated 05/31/2016

USER GUIDE. Encore PART NOS and SP Rapid Library Systems

BR-10150B. Bringing power and flexibility down to size. BIOMEK NX LABORATORY AUTOMATION WORKSTATION

Analysis of mixtures using next generation sequencing of mitochondrial DNA hypervariable regions

Reliable PCR Components for Molecular Diagnostic Assays

Next Generation Sequencing: Technology, Mapping, and Analysis

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011

TCRG TCRA/D IGH IGK/L

The Danish Bone Marrow Donor Registry DBMDR

NGS Technologies for Genomics and Transcriptomics

Idaho Technology Food Security Systems. System Components. Idaho Technology. Food Security and Pathogen Detection

Easy Collection and Extraction of BioSamples Ahlstrom GenCollect Ahlstrom GenCollect Color

Algorithms for Next Generation Sequencing Data Analysis

Bioanalyzer Applications for

HBV Quantitative Real Time PCR Kit

Transcription:

www.medical-genetics.de Routine HLA typing by Next Generation Sequencing Kaimo Hirv Center for Human Genetics and Laboratory Medicine Dr. Klein & Dr. Rost Lochhamer Str. 9 D-8 Martinsried Tel: 0800-GENETIK or 089-8978-0 info@medical-genetics.de www.medical-genetics.de Applications for NGS HLA typing - problem # HLA Chimerism Analysis Registry Donor Search MRD Cord Blood Molecular Oncology HLA typing - problem # HLA typing - problem # - work-intensive - time-consuming - cost-intensive

HLA typing - problem # NGS Technologies Advantages of the NGS technology - clonal amplification less ambiguities - multiplexing high throughput - reduced sequencing costs per base Requirements - high number of samples - not time critical analysis - identical requests MiSeq Roche GS FLX Ion Torrent Read length 0 bp 700-800 bp 00 bp Output/run GB 0,8 GB GB (8) Indexing > 00 0 > 00 Accuracy high-moderate high-moderate moderate Cost/run.000.000.00 Tissue Antigens 009, 7, 9-0 of - 7 HLA Loci (A, B, C, DRB, DQB, DQA, DPB) - up to 8 DNA samples in one sequencing run Applications for NGS Registry HLA Chimerism Analysis Registry Donor Search MRD Cord Blood Molecular Oncology

GS FLX Titanium Chemistry Process Steps - Overview TS-Primer = Target-Specific Primer Library Preparation ACACTGACGACATGGTTCTACACSGCCTCTGYGGGGAGAAGCA. Rapid Library Construction * gdna. h. empcr h hands on h amplification. Sequencing h prep 9 h run Data output Tag Seq MID-Primer = Barcode Primer TS-Primer DNA Library Preparation Prepare double-stranded DNA library with adapters Emulsion Titrations** empcr dstdna with adaptors attached to bead Clonally amplified sstdna in emulsion Sequencing Prepare sequencing run Quality filtered bases Forward CGTATCGCCTCCCTCGCGCCATCAGACGAGTGCGTACACTGACGACATGGTTCTACA Adaptor-Sequence Key Seq MID Seq Tag Seq sstdna ready to sequence ACACTGACGACATGGTTCTACACSGCCTCTGYGGGGAGAAGCA... TGTGACTGCTGTACCAAGATGTGSCGGAGACYCCCCTCTTCGT... CGTATCGCCTCCCTCGCGCCATCAGACGAGTGCGTACACTGACGACATGGTTCTACACSGCCTCTGYGGGGAGAAGCA... * One library provides enough DNA for thousands of sequencing runs. ** Only one titration is required for each sample. Pos., Matrix Mastermix 80µl 8 Tubes in Spalte Pos., Matrix Forward MID 0µl 9 Tubes PCR Setup Pos., PCR 9 Forward Primer 0µl B-8 in 8 Spalten Pos., PCR 9 Reverse Primer 0µl C-8 in 8 Spalten 9 DNA samples + neg-control PCR-Plates x 8 Pos., Matrix Reverse MID 0µl 9 Tubes Pos. & leere PCR 8 Platten Pos., Matrix DNA 0µl 9 Tubes - workstation with 9 Probe Head - 8-well Thermocycler Pooling PCR Purification PCR-Platte x 8 7 7 7 8 8 8 - second workstation with 8 channels - third workstation with 8 channels - Agencourt AmPure XP system

PCR Purification Process Steps. Emulsion PCR gdna. DNA Library Construction *. h. empcr h hands on. Sequencing h prep Data output h amp 9 h run Mix denatured dstdna library with DNA Capture beads Emulsify DNA Capture beads and PCR reagents in waterin-oil microreactors Clonal amplification occurs inside microreactors Break microreactors and enrich for DNA- positive beads sstdna library Clonally-amplified sstdna attached to bead 0 Bead Enrichment Process Steps a. Bead Deposition into PicoTiterPlate gdna. DNA Library Construction *. h. empcr h hands on. Sequencing h prep Data output h amp 9 h run Well diameter average for PicoTiterPlate is 9 µm A single clonally amplified sstdna bead (0 µm diameter) is deposited per well. Layers of packing, enzyme and PPiase Beads are deposited Plate is loaded into instrument for sequencing - second workstation with integrated REMe system - enrichment rate ~ -0% Amplified sstdna library beads PTP ready for sequencing GS FLX Titanium Bead Deposition Loading Beads into PicoTiterPlate Each region can be loaded separately Several gaskets can be used (,, 8 and regions) for the same PTP type

Ambiguities Ambiguities - Results, n=7 Unambiguous Resultswith G Ambiguous HLA-A 0 0,0% 7 00% 0 0% HLA-B 0,% 7 98,%,% HLA-DRB 77,% 98 8,8% 0 0% B*:0 B*:0 B*:0 Exon Exon Exon Exon Exon Exon Unambiguous: e. g. DRB*0:0:0 B*: Exon Exon Ambiguities outside of exon and : B*:0:0G Ambiguities outside of exon : DRB*:0:0G cis-trans Ambiguities inside of exon and : B*:0:0G, *:0:0G / B*:0, *::0G B*07:0, *:0 / B*0:, *:0 B*:0, *0:0 / B*:, *0: Ambiguities Summary - HLA - HLA typing by Next Generation Sequencing is feasible in a routine usage - 80 samples can be typed for HLA-A, -B and -DRB / run - high resolution can be achieved - most of the results can be reported with suffix G - by high number of samples, the costs are at least comparable with Sanger sequencing - lab automation is needed for high throughput (high costs) - standards must be defined by HLA community Ehrlich et al. BMC Genomics 0

Center for Human Genetics and Laboratory Medicine, Dr. Klein & Dr. Rost Lochhamer Street 9 D-8 Martinsried Germany Tel: +9-800-GENETIK or +9-89-8978-0 info@medical-genetics.de www.medical-genetics.de Ehrlich et al. BMC Genomics 0