Bioinformatica Dr. Marco Fondi Lezione # 6 Corso di Laurea in Scienze Biologiche, AA 2012-2013 martedì 30 ottobre 2012 1
Sequenziamento ed analisi di genomi: la genomica 2 martedì 30 ottobre 2012
martedì 30 ottobre 2012 3
martedì 30 ottobre 2012 4
martedì 30 ottobre 2012
martedì 30 ottobre 2012 6
Next Generation Sequencing 454, Roche ABI's SOLiD Method. Solexa, Illumina PACIFIC BIOSCIENCES Desktop Ion torrent 454 GS junior Illumina miseq martedì 30 ottobre 2012
martedì 30 ottobre 2012
http://commons.wikimedia.org/wiki/
http://www.nature.com/
3 Main Technologies Solid
http://www.dkfz.de/gpcf/850.html
Credit: Illumina
http://www.dkfz.de/gpcf/850.html
http://www.illumina.com/technology/
http://www.dkfz.de/gpcf/849.html
http://www.flickr.com/photos/doe_jgi/
The development and impact of 454 sequencing Jonathan M Rothberg & John H Leamon Nature Biotechnology 26, 1117-1124 (2008) Published online: 9 October 2008 doi:10.1038/nbt1485
Genome Biol. 2009; 10(3): R32. Published online 2009 March 27. doi: 10.1186/ gb-2009-10-3-r32. Evaluation of next generation sequencing platforms for population targeted sequencing studies
Sequencing technologies the next generation Michael L. Metzker Nature Reviews Genetics 11, 31-46 (January 2010) doi:10.1038/nrg2626
Storage
http://blogs.forbes.com/sciencebiz/2010/06/03/your-genome-is-
Genome Biol. 2010;11(5):207. Epub 2010 May 5. The case for cloud computing in genome informatics.
http://www.flickr.com/photos/esquimo_2ooo/
http://www.flickr.com/photos/jpf/152611490/
http://www.cloudera.com/what-is-hadoop/hadoop-overview/
FASTQ
@IL31_4368:1:1:996:8507/2 TCCCTTACCCCCAAGCTCCATACCCTCCTAATGCCCACACCTCTTACCTTAGGA + FFCEFFFEEFFFFFFFEFFEFFFEFCFC<EEFEFFFCEFF<;EEFF=FEE?FCE @IL31_4368:1:1:996:21421/2 CAAAAACTTTCACTTTACCTGCCGGGTTTCCCAGTTTACATTCCACTGTTTGAC + >DBDDB,B9BAA4AAB7BB?7BBB=91;+*@;5<87+*=/*@@?9=73=.7)7* @IL31_4368:1:1:997:10572/2 GATCTTCTGTGACTGGAAGAAAATGTGTTACATATTACATTTCTGTCCCCATTG + E?=EECE<EEEE98EEEEAEEBD??BE@AEAB><EEABCEEDEC<<EBDA=DEE @IL31_4368:1:1:997:15684/2 CAGCCTCAGATTCAGCATTCTCAAATTCAGCTGCGGCTGAAACAGCAGCAGGAC + EEEEDEEE9EAEEDEEEEEEEEEECEEAAEEDEE<CD=D=*BCAC?;CB,<D@, @IL31_4368:1:1:997:15249/2 AATGTTCTGAAACCTCTGAGAAAGCAAATATTTATTTTAATGAAAAATCCTTAT + EDEEC;EEE;EEE?EECE;7AEEEEEE07EECEA;D6D>+EE4E7EEE4;E=EA @IL31_4368:1:1:997:6273/2 ACATTTACCAAGACCAAAGGAAACTTACCTTGCAAGAATTAGACAGTTCATTTG + EEAAFFFEEFEFCFAFFAFCCFFEFEF>EFFFFB?ABA@ECEE=<F@DE@DDF; @IL31_4368:1:1:997:1657/2 CCCACCTCTCTCAATGTTTTCCATATGGCAGGGACTCAGCACAGGTGGATTAAT (...)
Solexa/Illumina Read Format The syntax of Solexa/Illumina read format is almost identical to the FASTQ format, but the qualities are scaled differently. Given a character $sq, the following Perl code gives the Phred quality $Q: $Q = 10 * log(1 + 10 ** (ord($sq) - 64) / 10.0)) / log(10); http://maq.sourceforge.net/fastq.shtml
martedì 30 ottobre 2012 454 strategy
Genomica: le 4 A Genomica: le 4 fasi 1. Assemblaggio 2. Assegnazione 3. Annotazione 4. Analisi (genomica comparativa) venerdì 17 dicembre 2010
Genomica: le 4 A Genomica: le 4 fasi 1. Assemblaggio 2. Assegnazione 3. Annotazione 4. Analisi (genomica comparativa) venerdì 17 dicembre 2010
genoma 454, Roche ABI's SOLiD Method. Solexa, Illumina venerdì 17 dicembre 2010
genoma 454, Roche ABI's SOLiD Method. Solexa, Illumina venerdì 17 dicembre 2010
genoma 454, Roche ABI's SOLiD Method. Solexa, Illumina campione venerdì 17 dicembre 2010
genoma 454, Roche ABI's SOLiD Method. Solexa, Illumina campione venerdì 17 dicembre 2010
454, Roche ABI's SOLiD Method. Solexa, Illumina sequenza genoma venerdì 17 dicembre 2010
454, Roche ABI's SOLiD Method. Solexa, Illumina sequenza genoma venerdì 17 dicembre 2010
454, Roche ABI's SOLiD Method. Solexa, Illumina reads sequenza genoma venerdì 17 dicembre 2010
genome venerdì 17 dicembre 2010
genome reads venerdì 17 dicembre 2010
genome reads reads assembly contigs A B C venerdì 17 dicembre 2010
contigs A B C GAP GAP venerdì 17 dicembre 2010
contigs A B C oppure GAP GAP contigs B A C GAP GAP venerdì 17 dicembre 2010
contigs A B C oppure GAP GAP contigs B A C GAP GAP oppure... venerdì 17 dicembre 2010
GAP closure 1 A B reads venerdì 17 dicembre 2010
GAP closure 1 A B reads no overlap? sì A B contig esteso venerdì 17 dicembre 2010
GAP closure 2 1. reference genome A B venerdì 17 dicembre 2010
GAP closure 2 1. reference genome A B 2. reference genome reads venerdì 17 dicembre 2010
GAP closure 2 1. reference genome A B 2. reference genome reads 3. reference genome A contig esteso B venerdì 17 dicembre 2010
1 2 3 4 5 6 giovedì 3 novembre 2011
1 2 3 4 5 6 draft genome giovedì 3 novembre 2011
complete genome 1 2 3 4 5 6 draft genome giovedì 3 novembre 2011
giovedì 3 novembre 2011
giovedì 3 novembre 2011
giovedì 3 novembre 2011 Genoma completamente sequenziato