Standard DNA Sequencing Services Standard DNA Sequencing Services Standard DNA Sequencing Services BIO BASIC INC.



Similar documents
SEQUENCING SERVICES. McGill University and Génome Québec Innovation Centre JANUARY 21, Version 3.4

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website

Introduction. Preparation of Template DNA

For information regarding shipping specifications, please refer to the following link:

First Strand cdna Synthesis

DNA Core Facility: DNA Sequencing Guide

DNA Sequencing Handbook

Procedures For DNA Sequencing

DNA Sample preparation and Submission Guidelines

DNA Sequencing Troubleshooting Guide

Description: Molecular Biology Services and DNA Sequencing

DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE

Troubleshooting Sequencing Data

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

SYBR Green Realtime PCR Master Mix -Plus-

A Brief Guide to Interpreting the DNA Sequencing Electropherogram Version 3.0

Taq98 Hot Start 2X Master Mix

ZR DNA Sequencing Clean-up Kit

CUSTOM DNA SEQUENCING SERVICES

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053

PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200

Sanger Sequencing. Troubleshooting Guide. Failed sequence

qstar mirna qpcr Detection System

Gene Expression Assays

Cloning GFP into Mammalian cells

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

BacReady TM Multiplex PCR System

PicoMaxx High Fidelity PCR System

MICB ABI PRISM 310 SEQUENCING GUIDE SEQUENCING OF PLASMID DNA

Forensic DNA Testing Terminology

HiPer RT-PCR Teaching Kit

RevertAid Premium First Strand cdna Synthesis Kit

Genomic DNA Extraction Kit INSTRUCTION MANUAL

CCR Biology - Chapter 9 Practice Test - Summer 2012

HCS Exercise 1 Dr. Jones Spring Recombinant DNA (Molecular Cloning) exercise:

TIANquick Mini Purification Kit

PrimeSTAR HS DNA Polymerase

50 g 650 L. *Average yields will vary depending upon a number of factors including type of phage, growth conditions used and developmental stage.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna

Guide to using the Bio Rad CFX96 Real Time PCR Machine

DNA and Forensic Science

ab Hi-Fi cdna Synthesis Kit

Crime Scenes and Genes

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011

HighPure Maxi Plasmid Kit

PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide

Bio-Reagents Gene synthesis Peptide Synthesis Protein Expression Antibody Production. Life Science Products and Services

Mir-X mirna First-Strand Synthesis Kit User Manual

CompleteⅡ 1st strand cdna Synthesis Kit

Integrated Protein Services

RT-PCR: Two-Step Protocol

restriction enzymes 350 Home R. Ward: Spring 2001

SERVICE REQUEST OF DNA SEQUENCING

DNA Sequence Analysis

Essentials of Real Time PCR. About Sequence Detection Chemistries

Table of Contents. I. Description II. Kit Components III. Storage IV. 1st Strand cdna Synthesis Reaction... 3

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

UltraClean PCR Clean-Up Kit

Beginner s Guide to Real-Time PCR

Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform

TransformAid Bacterial Transformation Kit

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

Real-Time PCR Vs. Traditional PCR

Classic Immunoprecipitation

Mitochondrial DNA Analysis

Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.

PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)

Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.

IMBB Genomic DNA purifica8on

Real-time quantitative RT -PCR (Taqman)

All-in-One mirna qrt-pcr Detection System Handbook

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation.

360 Master Mix. , and a supplementary 360 GC Enhancer.

Data Analysis for Ion Torrent Sequencing

DNA Sequencing Overview

Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280.

Easy Collection and Extraction of BioSamples Ahlstrom GenCollect Ahlstrom GenCollect Color

How To Use An Enzymatics Spark Dna Sample Prep Kit For Ion Torrent

ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing.

Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit

Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual

Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform

PCR Instruments and Consumables

Use of the Agilent 2100 Bioanalyzer and the DNA 500 LabChip in the Analysis of PCR Amplified Mitochondrial DNA Application

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476

Amazing DNA facts. Hands-on DNA: A Question of Taste Amazing facts and quiz questions

IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)

Illumina TruSeq DNA Adapters De-Mystified James Schiemer

Automation in Genomics High-throughput purification of nucleic acids from biological samples. Valentina Gualdi Operational Scientist PGP

Validating Microarray Data Using RT 2 Real-Time PCR Products

UltraClean Soil DNA Isolation Kit

User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube

Reverse Transcription System

AffinityScript QPCR cdna Synthesis Kit

Hepatitis B Virus Genemer Mix

ABSTRACT. Promega Corporation, Updated September Campbell-Staton, S.

How To Get Rid Of Small Dna Fragments

Transcription:

1 344 BIO BASIC INC. www.biobasic.com

BBI 2015-2017 STANDARD DNA SEQUENCING SERVICES Catalogue With over 10 years of experience, Bio Basic Inc. is a leader in offering single and high-throughput DNA sequencing services. All DNA sequencing is performed within our own facility using state-of-the-art technologies and informatics. Key Features Incoming sample QC Fluorescent dye-terminator sequencing ABI Prism 3730xl DNA sequencers >650bp Q20 read lengths typical Universal primers provided at no additional charge (complete list below) Template preparation and primer synthesis available Services & Prices Samples Quantity Price USD Additional charge (USD) Purified Plasmids Purified PCR Products Bacterial Stabs Culture Crude PCR Products Primer synthesis 1-9 reactions 10-99 100-500 >500 1-9 reactions 10-99 100-500 >500 1-9 reactions 10-99 100-500 > 500 $ 5.00 $ 4.80 $ 4.50 Inquire $ 5.00 $ 4.80 $ 4.50 Inquire $ 5.00 $ 4.80 $ 4.50 Inquire $ 0.19/base Purification: $0.60 Purification: $0.60 Purification: $0.60 Purification: $0.60 Purification: $1.00 Purification: $1.00 Purification: $1.00 Purification: $1.00 For long term or bulk project, please inquire about our bulk pricing. Purified plasmid DNA: Purified plasmid DNA: Plasmids should be purified usinga qualified Plasmid DNA Purification Kit. Quantity:The sample volume should be at least 20 μl in dd-water, at a desired concentration of 100 ng/μl to 200 ng/μl. TE is not recommended to dissolve the DNA samples. Bacterial: (1) LB stabs (2) 1 ml of overnight culture containing 15% glycerol te: A. Low copy bacteria stabs or culture are not acceptable. Please send 10 μg of purified plasmid DNA. B. Please provide all necessary information including insert size, antibiotic resistance. Purified PCR products: PCR products should be purified by qualified PCR Products Purification Kits. Purity: one band should appear on agarose gel. Sample volume should be around 10-20 μl in dd-water at a desired concentration of 30 ng/μl or higher. Crude PCR products: at least 50 μl of non-purified PCR product must be provided for purification at a desired concentration of 30 ng/μl or higher. Primers: We provide many universal primers at no additional charge (see list as below). If the primers for your sequencing reactions are not included in the list, you will need to provide the primer. Alternatively, Bio Basic Inc. can synthesize the primer for you at an additional cost. Concentration of primers: >5 pmole/μl (20-50 μl). Chain length of the primer should be more than 15 bases, but no longer than 50 bases. Random primers are not accepted as sequencing primers. DNA sequence and annealing temperature should be provided by the customer for primer. Results: Sequence chromatogram files will be sent to customer electronically as well as the.txt file of the DNA sequence. We also provide PDF alignment file upon request. Turnaround: ~24 hr to 48 hr. For bulk orders, please inquire. 345

Placing Your Order ONLINE: You may order Bio Basic Inc's DNA Sequencing Service online through our website, www.biobasic.com, by filling out the Online Order Form. Options are available for submitting one to hundreds of samples. DOWNLOAD and EMAIL: You may download an excel Sequencing Order Form from www.biobasic.com and email it to sequencing@biobasic.com and order@biobasic.com. We offer easy payments options via purchase order number and/or credit card (Visa and MasterCard only). After your order is approved, please send samples to Bio Basic Inc. or our distributor in your country. Bio Basic Inc. offers FREE pick ups for > 100 samples within Canada/USA. If there is no distributor in your country, you may contact a distributor near your country or Bio Basic Inc. directly. 1Contact Us Phone 905-474-4493 or 1-800-313-7224 Fax 905-474-5794 Email Web Mail Samples Universal Primers Universal Primer M13 Forward sequencing@biobasic.com order@biobasic.com www.biobasic.com 20 Konrad Crescent, Markham, ON, L3R 8T4 Canada Free Shipping if >100 Samples (Canada/USA only) Sequence GTAAAACGACGGCCAGT M13 Reverse pgex 3' pgex 5' SP6 T3 T7 (short) T7 (long) T7 terminator CAGGAAACAGCTATGAC CCGGGAGCTGCATGTGTCAGAGG GGGCTGGCAAGCCACGTTTGGTG ATTTAGGTGACACTATA ATTAACCCTCACTAAAG AATACGACTCACTATAG AATACGACTCACTATAGgg GCTAGTTATTGCTCAGCGGT 346 BIO BASIC INC.

Sequencing Reports BBI 2015-2017 Catalogue 1.Sequencing report Format (1) Original ABI format of ~700 bp sequencing chromatogram (2) Text file of the DNA Sequence (3) Summary of Report (4) All results are sent electronically 2. View results (1) Download Chromas from www.biobasic.com (2) Double click Chromas and open ABI file from Chromas (3) Export text file from Chromas (4) Sequences between 60 bp to 500 bp are most reliable region. To obtain reliable reads, it is highly recommended to perform double stranded sequencing using reverse primers as a good laboratory practice. 3. report (1) Samples fail to pass incoming QC (2) Sample with no readable signal 4.Charges on sequences with structures Standard charge applies even if sequences are not clear due to known structures including Poly N,GC,inverted repeats direct repeats etc. 5.Charges on mixed peaks Most mixed peaks are results from mixed templates (see below Q&A). Standard charge applies. 6.Sample Storage All samples are kept at Bio Basic Inc. for 2 months. During this period, customer may request additional sequencing service. After 2 months, the samples are automatically destroyed without further notification. 347

Check List Before Sending Samples Template Requirements Crude PCR Products 1. PCR product > 200 bp 2. Concentration of PCR product should be >30 ng/μl and volume 1 μg-2 μg. 3. Take 2-3 μl samples, a single band of final PCR product should be detected on gel. 4. Specific primers are to be provided by customer. 5. To avoid cross contaminations during shipment, please make sure you use a tight-fit lid when shipping samples in 96-well format. Alternatively, samples can be delivered in 8-strip PCR tubes. 1 Purified PCR Product Purified Plasmid DNA Bacteria 1. Dissolve final PCR product in ddh 2 O ( Please do not use TE). 2. Concentration of PCR product should be >30 ng/μl and volume >10 μl. For PCR product >2 kb, more DNA may be required for sequencing. 3. A single distinct band of final PCR product should be detected on gel. If smearing or multiple bands are seen, you may receive poor or no readable sequencing data. 4. Specific primers are to be provided by customer. 5. To avoid cross contaminations during shipment, please make sure you use a tight-fit lid when shipping samples in 96-well format. Alternatively, samples can be delivered in 8-strip PCR tubes. 1. Dissolve purified plasmid DNA in 30~50 μl ddh 2 O (Please do not use TE). 2. Concentration of plasmid should be >100-200 ng/μl; 3. It is recommended to use molecular biology kit to purify plasmid DNA rather than ethanol precipitation. 4. Specific primers are to be provided by customer. 5. To avoid cross contaminations during shipment, please make sure you use a tight-fit lid when shipping samples in 96-well format. Alternatively, samples can be delivered in 8-strip PCR tubes. 1. Please indicate antibiotic resistance for desired bacteria strain. Bio Basic Inc. offers services of DNA extraction from Amp, Kan, Tet and Chl. All other antibiotics are to be provided by customer with instruction manuals. 2. Bio Basic Inc offers DNA extraction from high copy plasmid. For low copy plasmid bacteria, please send ~10 μg purified DNA. 3. Please provide 1 ml overnight culture or 15% glycerol stock. Please send bacterial samples in individual Eppendorft tubes with openings securely sealed. 4. For large sample size, we recommend Ecoli stab in 96-well plate. This is to avoid cross contamination between samples during shipment. Specific Primers 1. Concentration of primers should be >5 pmol/μl( or 5 μmol/l) and volume > 20-50 μl. Please mark primer concentration clearly. 2. Random primers and/or primers <15 bases cannot be used for sequencing. 3. Please provide sequences of primers so that Tm could be known for condition optimization. Universal Primers M13 Forward, M13 Reverse, pgex 3, pgex 5, T7promoter, T7 terminator, SP6, T3 are primers provided at FREE of charge. If your primers are not in the above list, please ship primers along with your sample(s). Alternatively, Bio Basic Inc. can synthesize the oligos for you at $0.19 per base. Please refer to Oligo Synthesis. 348 BIO BASIC INC.

What is DNA Sequencing BBI 2015-2017 Catalogue The term DNA sequencing encompasses biochemical methods for determining the order of the nucleotide bases, adenine, guanine, cytosine, and thymine, in a DNA oligonucleotide. The sequence of DNA constitutes the heritable genetic information in nuclei, plasmids, mitochondria, and chloroplasts that forms the basis for the developmental programs of all living organisms. Determining the DNA sequence is therefore useful in basic research for studying fundamental biological processes, as well as in applied fields such as diagnostic or forensic research. The advent of DNA sequencing has significantly accelerated biological research and discovery. The rapid speed of sequencing attained with modern DNA sequencing technology has been instrumental in the large-scale sequencing of the human genome, in the Human Genome Project. Related projects, often by scientific collaboration across continents, have generated the complete DNA sequences of many animal, plant, and microbial genomes. Frequent Questions and Answers A:We would need you to first clearly tell us at which position is unclear to you and then we would go case by case. If it is from Bio Basic Inc. s processing Q:In one of the region, the sequencing was not clear. Could I request Bio Basic Inc. to sequence again? problem, we will initiate a no-charge repeat immediately. Q:I lost all data, could you send me another copy? A:Yes. However, please note, all sequencing results are kept for a period of 6 months. Samples are kept at Bio Basic Inc. for 1-2months. Q:I have a 4kb PCR fragments, can Bio Basic Inc. sequence through the full length? A:For PCR >2 kb, we recommend to first sub-clone it into a vector. The insert is more stable in a vector and sequencing results will be easier to achieve. Q:I have a mixed base pair in a position, how come I do not see the mixed base in the report? A:When preparing the report, Bio Basic Inc. assumes sequencing sample is from a pure single population rather than mixed. Based on this assumption, the higher/stronger peak is being reported and lower/weaker peak being treated as background. If your sample contains a mixed population, please kindly notify us. Q:The bands are present and strong, but irregularly spaced, or with mixed colors. The technician may have reported "superimposed sequences" or used the phrase "peaks on peaks"? A: If you see this, you usually have two sequences superimposed on other. There are several common causes: The sequencing primer binds to two (or more) sites on the template. There are two (or more) templates present. This was a PCR reaction, and you didn't remove the original primers. This was a PCR reaction, and one primer generated *both* ends. This was a PCR reaction, and there is more than one amplified species present. Here's an example of 'mixed peaks' such as might arise from two or more unrelated templates: 349

Another example, this time with templates that might be related. te the alignment of the peaks: 1Q:Your sequence proceeds normally, then the bands abruptly become much smaller Secondary structure in the template is the most likely cause of this problem. The polymerase is presumably unable to progress through some stem-loop form. A couple possible solutions: (i) try re-sequencing by selecting 'sirna construct' as your DNA type, (ii) try to sequence from another primer at a different position (closer or further); (iii) sequence the other strand. We maybe able to use special cycling conditions and/or special reagents that help the polymerase to push through this region. We cannot do this routinely, as it involves extensive optimizations. Here's an example of a secondary structure effect: Q: Your sequence proceeds normally, then the bands abruptly vanish. This usually happens when the template DNA has simply stopped, for example if it was restricted at a downstream site or if the template was a PCR product. This may also be caused by an extremely stable secondary structure. Q: The sequence looks great until it hits a polya (or polyt), and then the bands rise and fall in waves. This is called "polymerase slip". It happens when the growing strand temporarily dissociates from the template, then re-associates at a different spot - say, one nucleotide forward or back from where it started. If this happens often enough (as it will on polya or polyt templates), every individual band becomes a family of closely-spaced peaks giving a 'roller coaster' look to the chromatogram. Try sequencing in the other direction from the opposite strand, or try another primer either closer or further from the homopolymer region. The following is an excellent example of 'polymerase slip' on a homopolymeric tract: Q:You offer 24hr to 48hr service, but it has been 2 days and I still have not received data? A:24 hr to 48 hr is AFTER we receive the samples at Bio Basic Inc. If you have more than 5 plates, longer turnaround is expected. 350 BIO BASIC INC.

BBI 2015-2017 Catalogue Terms and Conditions Terms Bio Basic Inc. will send electronically DNA sequencing results to customers. All results will be kept in Bio Basic Inc. s data base for 6 months. During this period, customer may request sequencing results. After 6 months, DNA sequencing results are automatically destroyed without further notification. DNA sequencing tests are not considered confirmed without the customer providing a P.O. number or credit card number. Bio Basic Inc. accepts credit card (Visa or MasterCard), cheque or wire for payment. Turnaround Bio Basic Inc. will make its best effort to send DNA sequencing results within 48 hours. For Larger projects, time will vary depending on the size of the project. We try our best to accommodate special time constraints whenever possible, and projects of more than one hundred reactions may still get 24-48 hours turn around. Mail-in samples need to be received before 12.00 noon time to catch the same day run (results available the next day). If you are using FedEX, priority overnight arrives here day at around :00 am. Cancellations Buyer may not cancel any order or return any samples without Bio Basic Inc. s consent. Cancellation and return charges may be charged. Buyer must contact Bio Basic Inc. to obtain a return material authorization number. Warranty Bio Basic Inc. guarantees > 650 bp Q20 read length and more than 90%successful rate. Bio Basic Inc. does not guarantee any downstream application(s) or usage of the DNA sequencing results. Any claims or dispute must be submitted within 2 weeks of the results being sent. At the time of shipment, Bio Basic Inc. keeps a database for unexpected incidents and/or disputes. Bio Basic Inc. reserves the right to refuse handling disputes after a period of 3 months. Prices Bio Basic Inc. unit prices for DNA sequencing tests apply only to the specific quantity, sample purification and primer synthesis. All prices are subject to correction of errors; Bio Basic Inc. reserves the right to adjust prices on orders during production due to changes in cost of materials, transportation or wages. Any tax, customs, surcharge or duty, howsoever denominated, imposed upon the sale, importation, delivery or use of products shall be the responsibility of the Buyer. 351