SERVICE REQUEST OF DNA SEQUENCING
|
|
|
- Jocelyn Cooper
- 9 years ago
- Views:
Transcription
1 SERVICE REQUEST OF DNA SEQUENCING To submit samples for DNA sequencing please read carefully the following instructions (Operational Procedure) where the steps to follow are detailed. *Important Note: Secugen assumes that when a customer request a service from Secugen, he/she has previously read the operational procedure and agrees with the terms and conditions of the service that are detailed in our website. If you have any question, please do not hesitate to contact us, we will be pleased to attend you. OPERATIONAL PROCEDURE In order to simplify and speed up the DNA sequencing service offered by Secugen, there is an application available to all customers in our website that facilitates the traceability of samples and allows the on-line access to the results.. Next, there are the steps our customers should follow to use the on-line application correctly. It is important to read all the instructions that the application is showing, because they will guide you to use the web application properly. 1. Customer registration 2. Centers registration 3. Material request 4. Service request 5. Samples shipment 6. Results delivery 7. Sequence file visualization 1. CUSTOMER REGISTRATION The first step to get into the web application is to register as a new client. To do so, you click in the below link. Then, you must complete the registration form following the instructions. Once all the information has been introduced, you can access the system through the Customer Area panel typing your and Password. *Important Note: Remember to write down your and password because you will need any time you want to enter our system to request a service or consult any information of your orderings. Secugen S.L. 08/05/2014 Sanger DNA Sequencing: Service Request 1/8
2 2. CENTERS REGISTRATION The next step will be to register your list of centers. To work with us it is necessary you supply a Work Center, a Material Shipment Center and at least one Billing Center. The Billing Centers are denominated 'Accounts' and you can create all billing centers that you need it. These Accounts can represent projects, personal, laboratories, etc... For each generated Account you have associated a Results Folder, we will send to these folders the results requested by each Account. 3. MATERIAL REQUEST The samples must be submitted to Secugen using special tubes and sticky labels with personalized barcodes that Secugen will previously provide to the customer by standard mail. These personalized barcodes identify the customer samples and allow tracking them through the entire sequencing process. By clicking on the option Material Orders, you can order the materials you may need and those will immediately be sent to your postal address. Samples sent to Secugen using other tubes or labels will not be accepted, because the tube colors and labels with barcodes are necessary to identify the customers and samples through the sequencing process. Available material: 1 - Colored Eppendorf tubes 2-96-well plates (Recommended for 48 or 96 samples): 2.1 TUBES White Eppendorf Tubes: These are used for sequencing reactions that use primers from the list provided by Secugen. Purple Eppendorf Tubes: These are used for sequencing reactions that use primers provided by the customer. Every package of materials (tubes) includes 50 Eppendorf tubes and 50 triplicate bar-coded labels. 2.2 PLATES If the number of samples to be submitted to Secugen is large, we recommend to use a 96-well plate format that will also be identified with bar code labels (see figure). *Important Note: Plates should have 48 or 96 samples, if there were more than 48 or less that 96, the samples that exceeded the 48 samples must be submitted in tubes. If less than 48 samples are submitted in half plate they will be charged as 48 samples. (See paragraph use of Eppendorf tubes or plates) Every package of material (plates) includes 10 (ten) 96-well plates, 10 sealing sheets and 10 triplicated plate barcoded labels. Secugen S.L. 08/05/2014 Sanger DNA Sequencing: Service Request 2/8
3 4. SERVICE REQUEST Once you have received the material provided by Secugen, you should fill in the service request form. Clicking on Request Form you will be able to select a service request form that corresponds with the service you are requesting. You must download, print and fill in the service request form to submit samples to Secugen because the Request Form contains a barcode that identify the customer, billing data and the characteristics of the samples. If you are submitting an analysis that need special conditions, it is very important that you clearly state that in the Request Form, because it is the only way we can attend your specific request. The analysis of samples that are incorrectly processed by using our standard conditions due to lack of specific instructions in the request form will be charged to the customer. Please, be sure that the Request Form you are sending contains all the necessary information to process your samples the way you want. 5. SAMPLES SHIPMENT 5.1. SAMPLES PREPARATION Use of Eppendorf tubes or plates As it was mentioned in the paragraph 3. Material Request, for sample submission to Secugen you can send your sequencing samples to Secugen in Eppendorf tubes or 96-well plates, previously supplied by Secugen. 96 Well plates should be used to send 48 or 96 samples (half plate or whole plate). In case of sending only half plate (48 samples), these should be plated only in even or odd columns, as it is shown in the following picture. Secugen S.L. 08/05/2014 Sanger DNA Sequencing: Service Request 3/8
4 We cannot process in a half plate a number of samples below 48. Therefore, if you have less than 48 samples and you do not want to be charged for a completed half plate (48 samples), please sent the samples of the incomplete plate in Eppendorf tubes. If fewer than 48 samples are sent in a half plate, 48 samples will be charged. The same applies in the case of 96 samples DNA concentrations and volumes required for a correct sequencing For correct sequencing, it is required than samples have a suitable DNA volume and minimum concentration prepared in bidistilled water (see attached tables). DNA type Concentration Plasmids (3-20 kb) 100 ng/ µl Plasmids (>20 kb) and cosmids 200 ng/ µl PCR products up to 500 pb 10 ng/ µl PCR products between pb 20 ng/ µl PCR products between pb 30 ng/ µl PCR products between pb 40 ng/ µl PCR products between pb 50 ng/ µl PCR products > 4000 pb 100 ng/ µl * For different DNA type, please contact us. Type of samples Final Volume Tube Plate Plasmids and PCR Fragments 15 µl 10 µl/well Phages 20 µl Cosmids 15 µl BACs 20 µl Direct sequencing of plasmids from colonies 15 µl 15 µl/well Loads 20 µl 20 µl/well Fragments 15 µl 15 µl/well *Important Note: If this is the first time you are sending samples in 96-well plates or samples that require to be processed under special conditions (BACs, fragments phages ), please, contact our lab sequencing staff for technical support Type of primer Preparation of samples to be sequenced using Secugen s primers. The DNA sample at the suitable concentration will be dispensed in a white Eppendorf tube or 96-well plate, marking the code (table below) of the primer needed for sequencing in the Request Form: Secugen S.L. 08/05/2014 Sanger DNA Sequencing: Service Request 4/8
5 Code F17 R19 F24 R24 T3 T7p T7pCI-neo T7t SP6 Seq T Primers availables in Secugen service M13 forward (-20): 5 d(gtaaaacgacggccagt)3 17mer M13 reverse (-24): 5 d(ggaaacagctatgaccatg)3 19mer M13 forward (-47): 5 d(cgccagggttttcccagtcacgac)3 24mer M13 reverse (-48): 5 d(agcggataacaatttcacacagga)3 24mer T3 promoter (-20): 5 d(attaaccctcactaaaggga)3 20mer T7 promoter: 5 d(taatacgactcactataggg)3 20mer T7 pci-neo: 5 d(taatacgactcactatagg)3 19 mer T7 terminator: 5 d(gctagttattgctcagcgg)3 19 mer SP6 promoter: 5 d(atttaggtgacactatag)3 18mer SeqT : 5 d(ttttttttttttttttttttttttv)3 25 mer *Important Note: The Promega pci-neo plasmid cannot be sequenced with the T7 primer due to a base pair of difference at the 3 -end. For sequencing this vector, primer T7 (pci-neo) should be used. Preparation of samples to be sequenced using primers provided by the customer. In a single purple tube or 96-well plate, you must dispense both the DNA at the concentration indicated above and your own specific primer at 5 µm, both in bidistilled water as follows. Required volumes: Samples in tube: 15 ul of DNA + 1,5 ul primer at 5 µm. Samples in plate: 5 ul od DNA + 0,5 ul primer at 5 µm Preparation of special samples If you expect any difficulties in sequencing your samples, it is important that you contact us in advance. Our laboratory staff will give you advice and technical support to solve these difficulties USING THE LABELS WITH BARCODES Together with the tubes (white or purple) or the plates that you request prior to sequence with us, you will receive a set of barcoded labels. For each sample you will get a set of three identical labels. 1. Attach the first label to the sample tube as indicated below picture. 2. Place a second label in the space available for it in the Request Form. At the same time please indicate the annealing temperature of the primer and any other remarks about your sample, using the blank space available at the label side. 3. The third label is for the customer. We recommend that you stick it to your lab notebook or registration book together with a description of your sample. You will need this label to later on be able to identify the DNA sequence corresponding to that sample. Secugen S.L. 08/05/2014 Sanger DNA Sequencing: Service Request 5/8
6 5.3. SHIPPING SAMPLES TO SECUGEN Samples (tubes or plates), together with the Request Forms should be sent to Secugen by standard mail or courier at room temperature. Secugen S.L. Ramiro de Maeztu, Madrid Tlf: ext RESULTS DELIVERY Secugen will inform you when your results are ready by and deposit the sequences in your Personal Folder for each Account (Billing Center). You can access to this folder via internet, entering Secugen web page with your user and password. A Statistical Report with us is also available and can be accessed by clicking on them. Upon receiving your sample at Secugen: 1. An will immediately be sent to you indicating the beginning of the sequencing process. 2. Once sequencing is finished, you will receive a new indicating that the analysis has been completed and the name of the Folder deposited in your Personal Folder that contains your results in a ZIP format. This folder should be copy and saved in your own computer. Secugen S.L. 08/05/2014 Sanger DNA Sequencing: Service Request 6/8
7 *Important Note: The longest sequence may be obtained up to 1000 nucleotides. *Important Note: The personal folders has not be used to storage the sequences. We recommend you delete your result when these samples have been downloaded to free up storage in your folders. With time the customer will generate a history profile with Secugen. Clicking on the button User Statistics, you will have access to your sequencing statistics. 7. SEQUENCE FILE VISUALIZATION Sequence files can be visualized using different software depending on your computer. Some freeware programs can be found in the following links: 1. Chromas (Free to PCs) 2. BioEdit (Free to PCs) 3. 4peaks (Free to MacOS) 4. FinchTV (Free to Linux, PCs, y MACs) 5. Sequence Scanner Software v1.0 (Free to PCs) PRICES Registration as a Secugen customer is free and will allow you to request a package of tubes and labels for the sequencing of three samples without any charge. You will be able to verify the simplicity and quality of our DNA sequence services and test our procedures for future orders. - Price of sequencing a plasmid or PCR product: 6,5. - Price of running a ready-to-load samples and fragments: 2,25 (minimum samples required: 48) *For other samples, special samples or sequencing difficulties must first consult with Technical Services to consult its price. - Price of package of tubes: 50 tubes + 50 triplicated barcoded labels: 3,50. - Price of package of plates: well plates + 10 triplicated barcoded labels + 10 sealing sheets: 25 *Prices do not include VAT. Secugen offers special prices, prior consulting, for large numbers of samples or when contracting multiple sequencing analyses on account. *Important Note: Samples that failed to be sequenced for reasons beyond our control will be charged in the invoice. For this reason, if the customer anticipates sequencing difficulties of any sample we recommend contacting in advance our Customer Service to receive technical support. Secugen S.L. 08/05/2014 Sanger DNA Sequencing: Service Request 7/8
8 CUSTOMER SUPPORT Customer satisfaction is the priority. Contact us for technical support, quotation or any other information that you need. We have a long and solid experience sequencing difficult samples. Our staff will help you to find the best strategy to fulfill your particular needs. In addition, feel free to contact our Customer Service for any question related to sequencing troubleshooting. If you are not fully satisfied with your sequencing results, please contact the Laboratory Manager, in a period of 10 days, to evaluate whether the process could be repeated without any additional charge. Secugen guaranties the confidentiality of customer information and data. Upon request Secugen can provide a confidentiality agreement where it will be detailed that none of the information concerning your DNA samples will reach third parties. Secugen S.L. 08/05/2014 Sanger DNA Sequencing: Service Request 8/8
Introduction. Preparation of Template DNA
Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;
Procedures For DNA Sequencing
Procedures For DNA Sequencing Plant-Microbe Genomics Facility (PMGF) Ohio State University 420 Biological Sciences Building 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204 FAX: 614/292-6337
SEQUENCING SERVICES. McGill University and Génome Québec Innovation Centre JANUARY 21, 2016. Version 3.4
JANUARY 21, 2016 SEQUENCING SERVICES McGill University and Génome Québec Innovation Centre Sanger Sequencing User Guide Version 3.4 Copyright 2010 McGill University and Génome Québec Innovation Centre
DNA Sample preparation and Submission Guidelines
DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send
DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE
DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE We recommend for the sequence visualization the use of software that allows the examination of raw data in order to determine quantitatively how good has
User Guide for the Genetic Analysis Lab Information Management System (dnalims)
UNIVERSITY CORE DNA SERVICES University Core Genetic Analysis Laboratory Faculty of Medicine Health Sciences Centre, Rm. B104A Tel: (403) 220-4503, Fax: (403) 283-4907, Email: [email protected] www.ucalgary.ca/dnalab
DNA Sequencing Handbook
Genomics Core 147 Biotechnology Building Ithaca, New York 14853-2703 Phone: (607) 254-4857; Fax (607) 254-4847 Web: http://cores.lifesciences.cornell.edu/brcinfo/ Email: [email protected] DNA Sequencing
For information regarding shipping specifications, please refer to the following link: http://dna.macrogen.com/eng/help/orderg.jsp
Macrogen Sample Submission Guide Macrogen has served over 10 years in sequencing field using the cutting edge technology and delivering fast and reliable results. We use high throughput Applied Biosystems
Cloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems
Promega Notes Number 71, 1999, p. 10 Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems By Kimberly Knoche, Ph.D., and Dan Kephart, Ph.D. Promega Corporation Corresponding
Microsoft Expression Web
Microsoft Expression Web Microsoft Expression Web is the new program from Microsoft to replace Frontpage as a website editing program. While the layout has changed, it still functions much the same as
Troubleshooting for PCR and multiplex PCR
Page 1 of 5 Page designed and maintained by Octavian Henegariu (Email: Tavi's Yale email or Tavi's Yahoo email). As I am currently pursuing a new junior faculty position, the Yale URL and email may change
The RNAi Consortium (TRC) Broad Institute
TRC Laboratory Protocols Protocol Title: One Step PCR Preparation of Samples for Illumina Sequencing Current Revision Date: 11/10/2012 RNAi Platform,, [email protected] Brief Description: This
GENEWIZ, Inc. DNA Sequencing Service Details for USC Norris Comprehensive Cancer Center DNA Core
DNA Sequencing Services Pre-Mixed o Provide template and primer, mixed into the same tube* Pre-Defined o Provide template and primer in separate tubes* Custom o Full-service for samples with unknown concentration
Analyzing A DNA Sequence Chromatogram
LESSON 9 HANDOUT Analyzing A DNA Sequence Chromatogram Student Researcher Background: DNA Analysis and FinchTV DNA sequence data can be used to answer many types of questions. Because DNA sequences differ
LABORATORY ORDERING INFORMATION (valid June 2011)
LABORATORY ORDERING INFORMATION (valid June 2011) GENERAL You can search past orders in the orders ( pinks ) database - search by supplier, item description, catalog number, even name of person who did
CUSTOM DNA SEQUENCING SERVICES
CUSTOM DNA SEQUENCING SERVICES Satisfied Customers are our Driving Force We never stop exceeding your Expectations Value Read Service Single read sequencing of plasmid inserts or PCR products in tube and
AAFCO Check Sample Program New Data Reporting Website Manual Date of Issue: March 1 st 2014
Victoria S. Siegel, Ph.D., Chair Collaborative Check Sample Program Committee AAFCO Check Sample Program New Data Reporting Website Manual Date of Issue: March 1 st 2014 1. Registered participants in any
Wakefield Council Secure email and file transfer User guide for customers, partners and agencies
Wakefield Council Secure email and file transfer User guide for customers, partners and agencies The nature of the work the council carries out means that we often deal with information that is sensitive
Sanger Sequencing and Quality Assurance. Zbigniew Rudzki Department of Pathology University of Melbourne
Sanger Sequencing and Quality Assurance Zbigniew Rudzki Department of Pathology University of Melbourne Sanger DNA sequencing The era of DNA sequencing essentially started with the publication of the enzymatic
Accounts. Step by Step Data Setup Wizard and How to Guide. online
online Accounts Step by Step Data Setup Wizard and How to Guide Main Tel. 0845 450 7304 Support Tel. 0844 484 9412 Email [email protected] Free 30day trial www.liquidaccounts.com Page 1 Online Accounts
Launching and Logging in: First Class initial set-up
T1 - Setting up Mail Access Using First Class Goals: To provide Staff with the necessary tools to utilize the First Class system for Mail and Messaging, Essential Question: How can First Class mail and
Install Guide for Windows Office Professional Plus 2010
Install Guide for Windows Office Professional Plus 2010 The purpose of this guide is to assist you in obtaining a copy of Windows Office Professional Plus 2010 for your Windows PC. This document will walk
****Also, if you have done previous promotions and have multiple mailing lists, make sure you select the most recent one.
Instructions for Using the Integrated Direct Mail (IDM) System for BERNINA Direct Mail Pieces Getting Started Creating Your Mailer Checking Out Uploading Your Customer Lists Updating your Customer Lists
To create User who have already been registered with OCR and have received Registration Number can follow the following steps.
3 Post Registration 3.1 Create User To create User who have already been registered with OCR and have received Registration Number can follow the following steps. Figure 50: Link for new User Registration
Link Crew & WEB Database User Guide. Database 2006
i Link Crew & WEB Database User Guide Database 2006 1 ii 1 Contents 1 CONTENTS...II 2 THE LINK CREW AND WEB DATABASE... 3 3 DOWNLOADING THE DATABASE... 4 Step 1: Login to the Boomerang Project Website...4
TITRATION OF raav (VG) USING QUANTITATIVE REAL TIME PCR
Page 1 of 5 Materials DNase digestion buffer [13 mm Tris-Cl, ph7,5 / 5 mm MgCl2 / 0,12 mm CaCl2] RSS plasmid ptr-uf11 SV40pA Forward primer (10µM) AGC AAT AGC ATC ACA AAT TTC ACA A SV40pA Reverse Primer
DNA Core Facility: DNA Sequencing Guide
DNA Core Facility: DNA Sequencing Guide University of Missouri-Columbia 216 Life Sciences Center Columbia, MO 65211 http://biotech.missouri.edu/dnacore/ Table of Contents 1. Evaluating Sequencing Data..
Contents. Biocides Closed Circuit 28/10/2015
2 Contents 1. Definition and goals... 3 2. Logging in... 4 2.1. Creating a personal account... 4 2.2. Linking your personal account to an enterprise... 7 2.3. Approval of the 'Local Admin' account by the
Troubleshooting Account Lockouts/Password Resets
Troubleshooting Account Lockouts/Password Resets Contents Your mobile phone is using your old password... 1 Your computer password has not been changed... 2 Citrix has cached your old password... 2 Your
ACS EPF Download Manager Technical Guide. Table of Contents
Table of Contents Introduction... 3 Administration... 3 Disclaimer... 3 System Requirements... 3 Software Download... 3 Software Installation... 4 Preparing for the Installation... 4 Unzip the Software
Illumina TruSeq DNA Adapters De-Mystified James Schiemer
1 of 5 Illumina TruSeq DNA Adapters De-Mystified James Schiemer The key to sequencing random fragments of DNA is by the addition of short nucleotide sequences which allow any DNA fragment to: 1) Bind to
Computer Department. User Guide for Iscar E-Commerce site (TOOLSHOP) 1. Introducing. 2. Registration/login. 3. Start purchasing. 4.
User Guide for Iscar E-Commerce site (TOOLSHOP) Title 1. Introducing 2. Registration/login 3. Start purchasing 4. Purchasing steps 5. Submitting the order 6. Order confirmation 7. Order status 8. Distributors
BacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
DNA Sequencing Overview
DNA Sequencing Overview DNA sequencing involves the determination of the sequence of nucleotides in a sample of DNA. It is presently conducted using a modified PCR reaction where both normal and labeled
Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website
Biomolecular Core Facility AI Dupont Hospital for Children, Rockland Center One, Room 214 Core: (302) 651-6712, Office: (302) 651-6707, [email protected] Katia Sol-Church, Ph.D., Director Jennifer Frenck
TIANquick Mini Purification Kit
TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer
Excel 2003 PivotTables Summarizing, Analyzing, and Presenting Your Data
The Company Rocks Excel 2003 PivotTables Summarizing, Analyzing, and Presenting Step-by-step instructions to accompany video lessons Danny Rocks 5/19/2011 Creating PivotTables in Excel 2003 PivotTables
Star System Salon Management Software. Powerful Effective Easy to Use
Star System Salon Management Software Powerful Effective Easy to Use Comprehensive Solution Client Management Point of Sale Inventory Control Purchasing Sales History Client Marketing Appointment Scheduling
How To Write A Health Care Plan
USER GUIDE STEP UP PERFORMANCE MANAGEMENT SYSTEM Oklahoma State Department of Health Table of Contents Chapter 1 Getting Started... 2 Chapter 2 Overview and Public Health System Alignment... 5 Chapter
FOR REFERENCE PURPOSES
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
State of Michigan Data Exchange Gateway. Web-Interface Users Guide 12-07-2009
State of Michigan Data Exchange Gateway Web-Interface Users Guide 12-07-2009 Page 1 of 21 Revision History: Revision # Date Author Change: 1 8-14-2009 Mattingly Original Release 1.1 8-31-2009 MM Pgs 4,
October 2012. Easy Steps to use ESCIMS At Point of Sale
October 2012 Easy Steps to use ESCIMS At Point of Sale Point of Sale Process List # POS Processes 1 Log In 2 Receive Supplies 3 Issue Stock to Counter 4 Sale Case/ Bottle 5 Inventory Lookup 6 Return Bottle/
restriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
VIRTUAL SOFTWARE LIBRARY REFERENCE GUIDE
VIRTUAL SOFTWARE LIBRARY REFERENCE GUIDE INTRODUCTION The Virtual Software Library (VSL) provides remote and on-campus access to lab/course software. This approach is intended to simplify access for all
Studio Designer 80 Guide
Table Of Contents Introduction... 1 Installation... 3 Installation... 3 Getting started... 5 Enter your company information... 5 Enter employees... 6 Enter clients... 7 Enter vendors... 8 Customize the
Integrated Invoicing and Debt Management System for Mac OS X
Integrated Invoicing and Debt Management System for Mac OS X Program version: 6.3 110401 2011 HansaWorld Ireland Limited, Dublin, Ireland Preface Standard Invoicing is a powerful invoicing and debt management
AP Studio Art AP Studio Art Drawing and 2-D Design Portfolios
AP Studio Art AP Studio Art Drawing and 2-D Design Portfolios Friday, May 6, 2016 Last Day for AP Studio Art Portfolio Assembly for Drawing and 2-D Design The directions below apply only to the Section
aramex.com User Guide
aramex.com User Guide Contents About aramex.com... 3 Registering on aramex.com... 6 Managing My Profile... 9 The Address Book... 11 Customer Support... 12 Tracking My Shipments... 18 Schedule a Pickup...
Asellertool Amazon Shipment Tutorial
Asellertool Amazon Shipment Tutorial Chapter 1: Setup...1 Chapter 2: Work Flow...3 Chapter 3: Other Features...5 The Asellertool Amazon Shipment Software allows Amazon sellers to download orders, print
10.3.1.5 Lab - Data Backup and Recovery in Windows Vista
5.0 10.3.1.5 Lab - Data Backup and Recovery in Windows Vista Introduction Print and complete this lab. In this lab, you will back up data. You will also perform a recovery of the data. Recommended Equipment
HADS 2.1.0e Installation and migration
Ageing, Disability and Home Care, Department of Family and Community Services MDS fact sheet - February 2012 HADS 2.1.0e Installation and migration Caution! If at any stage during this process you receive
Agencourt AMPure XP. Xtra Performance Post-PCR clean UP
Agencourt AMPure XP Xtra Performance Post-PCR clean UP Applications o PCR o Genotyping, SNP detection o Fragment analysis o Sequencing (Sanger and Next generation) o Cloning o Primer walking Agencourt
MICB ABI PRISM 310 SEQUENCING GUIDE SEQUENCING OF PLASMID DNA
Plasmid DNA Preparation MICB ABI PRISM 310 SEQUENCING GUIDE SEQUENCING OF PLASMID DNA Introduction: I have always used the classic Alkaline Lysis miniprep method to isolate plasmid DNA. (See below) If
Inside Blackboard Collaborate for Moderators
Inside Blackboard Collaborate for Moderators Entering a Blackboard Collaborate Web Conference 1. The first time you click on the name of the web conference you wish to enter, you will need to download
Accounts Receivable Reference Guide
Create a New Customer A customer is a company or an individual who has already purchased goods or services from you. 1 Before entering in new data always perform a Global Search to search for any existing
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
MANUAL USER GUIDE FOR EMR PRIMARY HEALTH CARE SYSTEM
MANUAL USER GUIDE FOR EMR PRIMARY HEALTH CARE SYSTEM By Faustin GASHAYIJA Version 1.0 1 Table of contents Contents Table of contents... 2 Browser... 4 Log in openmrs website... 4 OpenMRS welcome page...
User Manual Statutory Forms Request 1 EXCISE AND TAXATION DEPARTMENT CHANDIGARH ADMINISTRATION
User Manual Statutory Forms Request 1 EXCISE AND TAXATION DEPARTMENT CHANDIGARH ADMINISTRATION User Manual Statutory Forms Request 2 In order to have better monitoring of tax administration and to facilitate
ADP Workforce Now V3.0
ADP Workforce Now V3.0 Manual What s New Checks in and Custom ADP Reporting Grids V12 Instructor Handout Manual Guide V10171180230WFN3 V09171280269ADPR12 2011 2012 ADP, Inc. ADP s Trademarks The ADP Logo
Sanger Sequencing. Troubleshooting Guide. Failed sequence
Sanger Sequencing Troubleshooting Guide Below are examples of the main problems experienced in ABI Sanger sequencing. Possible causes for failure and their solutions are listed below each example. The
1/12 Dideoxy DNA Sequencing
1/12 Dideoxy DNA Sequencing Dideoxy DNA sequencing utilizes two steps: PCR (polymerase chain reaction) amplification of DNA using dideoxy nucleoside triphosphates (Figures 1 and 2)and denaturing polyacrylamide
The SGS Online Admissions Application: A Guide for Graduate Administrators
The SGS Online Admissions Application: A Guide for Graduate Administrators v.2.2 October 2012 P a g e 2 Table of Contents 1. Introduction and Login... 4 2. Home Page, Menus and Navigation... 6 3. Program
SSD Firmware Update Utility Guide
SSD Firmware Update Utility Guide Crucial m4 2.5 SSD Firmware Revision 070H Firmware Update Guide for Windows 8 (Update from Rev 0001, 0002, 0009, 0309, 000F, 010G, 040H to Rev 070H) Introduction This
FedEx Electronic Trade Documents Guide. FedEx Ship Manager Software
FedEx Electronic Trade Documents Guide FedEx Ship Manager Software Overview Welcome to the world of FedEx Electronic Trade Documents. FedEx Ship Manager Software provides this new, international shipping
EBSCO MEDIA FILE TRANSFER SOFTWARE INSTALLATION INSTRUCTIONS
EBSCO MEDIA FILE TRANSFER SOFTWARE INSTALLATION INSTRUCTIONS CLICK HERE FOR Instructions For MACINTOSH Instructions For WINDOWS EBSCO MEDIA FILE TRANSFER WINDOWS INSTALLATION Metagraphix FTP 3.5 Software
Creating an Excel Database for a Mail Merge on a PC. Excel Spreadsheet Mail Merge. 0 of 8 Mail merge (PC)
Creating an Excel Database for a Mail Merge on a PC Excel Spreadsheet Mail Merge 0 of 8 Creating an Excel Database for a Mail Merge on a PC 1. To create a database for a mail merge you will first need
Retail POS User s Guide. Microsoft Dynamics AX for Retail
Retail POS User s Guide Microsoft Dynamics AX for Retail January 2011 Microsoft Dynamics is a line of integrated, adaptable business management solutions that enables you and your people to make business
Activating and Deactivating SnapGene Licenses
Activating and Deactivating SnapGene Licenses Activating and Deactivating SnapGene Licenses 1 Activating SnapGene Licenses 1.1 1.2 Download and Register SnapGene After Purchase 4 Generate an Email with
Plexor Systems Instrument Setup and Data Analysis for the Roche LightCycler 2.0 and LightCycler 1.5 Systems using LightCycler Software Version 4.
TECHNICAL MANUAL Plexor Systems Instrument Setup and Data Analysis for the Roche LightCycler 2.0 and LightCycler 1.5 Systems using LightCycler Software Version 4.0 Instruc ons for use of Products A4011,
ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing.
User manual imegen Anchovies II ID kit Anchovies species (E. encrasicolus and E. japonicus) DNA detection by sequencing Reference: Made in Spain The information in this guide is subject to change without
Mobility Tool Guide for Beneficiaries
EUROPEAN COMMISSION Directorate-General for Education and Culture Lifelong Learning: policies and programme Coordination of the "Lifelong learning" programme Mobility Tool Guide for Beneficiaries Version:
ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.
A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT
User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube
User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally
Genomic Services and Development Unit User Manual
Public Health England National Infection Service Genomic Services and Development Unit User Manual BW0056.10 Authorised by: C. Arnold Effective Date: 28/01/16 About Public Health England Public Health
Bitrix Site Manager ASP.NET. Installation Guide
Bitrix Site Manager ASP.NET Installation Guide Contents Introduction... 4 Chapter 1. Checking for IIS Installation... 5 Chapter 2. Using An Archive File to Install Bitrix Site Manager ASP.NET... 7 Preliminary
Deposit Direct. Getting Started Guide
Deposit Direct Getting Started Guide Table of Contents Before You Start... 3 Installing the Deposit Direct application for use with Microsoft Windows Vista... 4 Running Programs in Microsoft Windows Vista...
How To Use Standard Pos On A Pc Or Macbook Powerbook 2.5.2.2 (Powerbook 2)
Integrated Point of Sales System for Mac OS X Program version: 6.3.22 110401 2012 HansaWorld Ireland Limited, Dublin, Ireland Preface Standard POS is a powerful point of sales system for small shops and
Xerox Supplies Recycling Program Instructions
Xerox Supplies Recycling Program Instructions This document outlines the instructions on how to create a return shipment on Xerox.ca Step 1 - Login to www.xerox.ca/about-xerox/recycling/enca.html Go to
RP Pocket PC Scanner Reference Manual For PPT8800
RP Pocket PC Scanner Reference Manual For PPT8800 Table of Contents Overview...2 Installation...2 Setting up your Pocket PC...3 Terminal Services Client...6 Scanning Barcodes...8 Loading Scanner Sessions
Windows 10 Upgrade Guide
Windows 10 Upgrade Guide Affected Model: Models in Windows 10 upgrade list Notification: Windows 10 Upgrade Offer is valid for qualified and genuine Windows 7 and Windows 8.1 notebooks. Some hardware/software
Application and Registration process description
Master of Science Application and Registration process description ISAE Masters website: http://masters.isae.fr/en ISAE Advanced Masters website: http://masteres-specialises.isae.fr/en/ 1. Check the admission
1. Open Thunderbird. If the Import Wizard window opens, select Don t import anything and click Next and go to step 3.
Thunderbird The changes that need to be made in the email programs will be the following: Incoming mail server: newmail.one-eleven.net Outgoing mail server (SMTP): newmail.one-eleven.net You will also
Apple Juice Concentrate (AJC) Manual
Apple Juice Concentrate (AJC) Manual Minneapolis Grain Exchange, Inc. 400 South 4 th Street Minneapolis, MN 55415 www.mgex.com AJC Manual Table of Contents The below table of contents is being supplied
Sync Guide. Sync Overview. Before the Event. During the Event. After the Event. Greater Giving Event Software
Sync Guide Sync Overview Timeline Equipment Terms + This guide will instruct you on how to transfer data between Greater Giving Event Software and Auctionpay Master terminal Before, During and After your
OUTLOOK ANYWHERE CONNECTION GUIDE FOR USERS OF OUTLOOK 2010
OUTLOOK ANYWHERE CONNECTION GUIDE FOR USERS OF OUTLOOK 2010 CONTENTS What is Outlook Anywhere? Before you begin How do I configure Outlook Anywhere with Outlook 2010? How do I use Outlook Anywhere? I already
WELCOME TO VERIZON HIGH SPEED INTERNET FOR BUSINESS
WELCOME TO VERIZON HIGH SPEED INTERNET FOR BUSINESS For a better online experience, start here today. YOUR GUIDE TO INSTALLING AND USING VERIZON HIGH SPEED INTERNET. Congratulations on choosing Verizon
Sanger Sequencing: Sample Preparation Guide
Sanger Sequencing: Sample Preparation Guide Use this as a guide to prepare your samples for Sanger sequencing at AGRF CONTENTS 1 Overview... 2 1.1 Capillary Separation (CS) or electrophoretic separation
A. I do not have my own personal certificate I am a new client or want to download a new certificate
This user guide will help you to create your personal certificate in file/browser or smart card certificate. If you already own a personal certificate in file that you have saved on your computer, you
Universal Health Record Patient Access v2.2.4 User Guide
Allscripts FollowMyHealth Universal Health Record Patient Access v2.2.4 User Guide Copyright 2015 Allscripts Healthcare, LLC and/or its affiliates. All Rights Reserved. www.allscripts.com Published Date:
Cloud Services. Lync. IM/ Web Conferencing Admin Quick Start Guide
Cloud Services Lync IM/ Web Conferencing Admin Quick Start Guide 10/14/2014 ACTIVATION LETTER An activation letter will be sent to the email account of your administrator contact. Please look for the following
Stewart Secure Email User Guide. March 13, 2015
Stewart Secure Email User Guide March 13, 2015 Table of Contents Introduction... 1 What is secure email?... 1 Why secure email?... 1 What is personal, non-public information?... 1 How is my data protected?...
MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C
microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr
Reverse Transcription System
TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/
DESKTOP CLIENT CONFIGURATION GUIDE BUSINESS EMAIL
DESKTOP CLIENT CONFIGURATION GUIDE BUSINESS EMAIL Version 2.0 Updated: March 2011 Contents 1. Mac Email Clients... 3 1.1 Configuring Microsoft Outlook 2011... 3 1.2 Configuring Entourage 2008... 4 1.3.
CAL Store Quick Reference Guide
CAL Store Quick Reference Guide CAL has partnered with a company that specializes in providing support services with the goal of enhancing online security and our order management and fulfillment services
Institutional Partnership Program
GENEWIZ Outsourcing Services Institutional Partnership Program Solid Science. Superior Service. DNA Sequencing Partners to Fuel Your Success Institutions whose success depends on significant life science
