PCR Quantitative en temps réel



Similar documents
Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR

Pitfalls in qpcr. Primer and probe design and synthesis. Mary Span Eurogentec S.A.

QPCR Applications using Stratagene s Mx Real-Time PCR Platform

Introduction to Quantitative PCR

LightCycler 480 Real-Time PCR System

Real-time qpcr Assay Design Software

Fluorescent dyes for use with the

Essentials of Real Time PCR. About Sequence Detection Chemistries

Technical Note. Roche Applied Science. No. LC 19/2004. Color Compensation

DNA Detection. Chapter 13

Introduction To Real Time Quantitative PCR (qpcr)

Co Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra

Bio-Plex Manager Software

qpcr Technical Guide Detection Methods Primer and Probe Design Instrumentation Applications Guide

Applications Guide. Real-Time PCR Applications Guide

Methods and Application Guide. Introduction to Quantitative PCR

RealStar HBV PCR Kit /2012

SYBR Green Realtime PCR Master Mix -Plus-

Eco TM 48 Real Time PCR System. Fastest block-based qpcr. Four colour multiplexing. Supports all chemistries. Fast cycling protocols

Quantitative PCR Systems

Non-life insurance mathematics. Nils F. Haavardsson, University of Oslo and DNB Skadeforsikring

JBS FUNDAMENT Thermofluor Screen

Factors Influencing Multiplex Real-Time PCR

P 1 2 V V V T V V. AP Chemistry A. Allan Chapter 5 - Gases

Semiconductor Devices

Quantitative Computer Architecture

Creating a Color Compensation file for Roche LightCycler 480 vers.i & vers. II

Highly specific and sensitive quantitation

CHAPTER 7: Central Limit Theorem: CLT for Averages (Means)

REAL TIME PCR USING SYBR GREEN

Using Four Types Of Notches For Comparison Between Chezy s Constant(C) And Manning s Constant (N)

RNA Interference with Guaranteed Knockdown!

RECIPROCATING COMPRESSORS

Confidence Intervals for One Mean

The AB7900Fast and Principles of Real Time PCR

Real Time PCR Kit for Human Herpes Virus Type 6 Cat No. TM-60027: Primer Set

Real-time PCR: Understanding C t

Epstein Barr Virus (Human Herpes virus 4) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere...

Bond Valuation I. What is a bond? Cash Flows of A Typical Bond. Bond Valuation. Coupon Rate and Current Yield. Cash Flows of A Typical Bond

Real time and Quantitative (RTAQ) PCR. so I have an outlier and I want to see if it really is changed

Scott Reierstad. Field Applications Scientist

Real Time PCR and the icycler iq Real Time PCR Detection System for Quantitative PCR

Human Herpes Virus 1 (Herpes simplex type 1) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere...

CS100: Introduction to Computer Science

HCL Dynamic Spiking Protocol

Nuclear Energy, Stability, Fisson & Fusion

B.E. COMPUTER SCIENCE AND ENGINEERING (PART-TIME)

Output Analysis (2, Chapters 10 &11 Law)

Speed Matters - Fast ways from template to result

Industrial Batteries Network Power Classic Solar Powerful energy storage for photovoltaic systems. Specifications

Guide to using the Bio Rad CFX96 Real Time PCR Machine

High Quality Primary Antibodies with Extensive Validation

Dengue Virus subtypes 1,2 3 and 4. genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... 3 Untranslated Region (3 UTR) 150 tests

MOLAR MASS of POLYMERS

SYSTEM INFO. MDK - Multifunctional Digital Communications System. Efficient Solutions for Information and Safety

Descriptive Statistics

Real-time PCR handbook

Fluorescence and Fluorescence Applications

(VCP-310)

Case Study. Normal and t Distributions. Density Plot. Normal Distributions

Procedures For DNA Sequencing

HPLC Solvents and mobile phases

2.500 Threshold e Threshold. Exponential phase. Cycle Number

STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY REAL-TIME POLYMERASE CHAI REACTIO (PCR)

Genomic DNA detection assay

QuantiFast Multiplex PCR Handbook

Ideate, Inc. Training Solutions to Give you the Leading Edge

CHAPTER 3 The Simple Surface Area Measurement Module

Introduction. Preparation of Template DNA

DNA Sequencing Setup and Troubleshooting

Molecular Spectroscopy

PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide

ADVANCES IN REAL TIME PCR: APPLICATION TO CLINICAL LABORATORY DIAGNOSTICS

Idaho Technology Food Security Systems. System Components. Idaho Technology. Food Security and Pathogen Detection

MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C

Gene Expression Assays

DNA Sequencing Troubleshooting Guide.

Quantification of Mycobacterium Tuberculosis. 150 tests

This document contains a collection of formulas and constants useful for SPC chart construction. It assumes you are already familiar with SPC.

Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene. genesig Advanced Kit. DNA testing

Next Generation Sequencing for DUMMIES

Baan Service Master Data Management

DNA Sequence Analysis

Chapter 12 Filters for FISH Imaging

Critical Factors for Successful Real-Time PCR

Confidence Intervals. CI for a population mean (σ is known and n > 30 or the variable is normally distributed in the.

Best of security and convenience

CONTROL CHART BASED ON A MULTIPLICATIVE-BINOMIAL DISTRIBUTION

Center, Spread, and Shape in Inference: Claims, Caveats, and Insights

The following example will help us understand The Sampling Distribution of the Mean. C1 C2 C3 C4 C5 50 miles 84 miles 38 miles 120 miles 48 miles

Automatic Tuning for FOREX Trading System Using Fuzzy Time Series

A Combined Continuous/Binary Genetic Algorithm for Microstrip Antenna Design

QuantStudio 6 and 7 Flex Real-Time PCR Systems

1. C. The formula for the confidence interval for a population mean is: x t, which was

KASP genotyping chemistry User guide and manual

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476

GenScript BloodReady TM Multiplex PCR System

SmartFlare RNA Detection Probes: Principles, protocols and troubleshooting

Transcription:

Quatitative PCR PCR Quatitative e temps réel Aspects méthodologiques al itesity) Log (Siga Sample 1 Sample 2 Sample 3 Sample 4 0 5 10 15 20 25 30 35 40 45 50 Cycle umber Quatitative PCR Quatitative PCR al itesity) Log (Siga Sample 1 Sample 2 Sample 3 Sample 4 al itesity) Log (Siga Sample 1 Sample 2 Sample 3 Sample 4 0 5 10 15 20 25 30 35 40 45 50 Cycle umber 0 5 10 15 20 25 30 35 40 45 50 Cycle umber Fluorescece Mesure de fluorescece e format capillaires Roche 1

Mesure de fluorescece e format 96 Puits Mesure de fluorescece e format 96 Puits Stratagee Biorad Rotor gee The techology i the machies Illumiatio: Laser Haloge lamps, LED Detectio: PMT CCD camera Temperature cyclig: Block-Peltier Air: capillaries Advatages More sesitive Multiplexig. Idividual sample aalysis Cheaper. Higher throughput Faster, more sesitive, temperature more uiform Les évolutios: Roche 480 SYBR Gree Sample umbers: Blocks for either 96 or 384 samples, easily exchageable by user Reactio volumes: 3 µl - 20 µl (384 well), 20 µl -100 µl (96 well) Temperature cotrol: Peltier-based heatig/coolig from 40 C - 95 C Heated lid, PCR without ay overlay (e.g., wax or oil) Passive post-ru coolig to < 40 C Maximum ramp rates: Heatig: 6.3 C/s (average values for Coolig: 3.5 C/s stadard ru coditios Meltig: 0.01-0.5 C/s Excitatio: 5 excitatio filters, high-itesity broad-spectrum xeo lamp Detectio: 6 detectio filters, sigals detected olie by CCD camera Ru time: < 60 miutes (96-well plate), < 40 miutes (384-well plate) 2

The problem with SYBRGree: primer dimers Properties of primers Pos. 287 Upper Primer: the most stable 3'-dimer: 2 bp, -3.6 kcal/mol Stadard Curve Upper Primer [287]: Td = 71.7 [earest eighbor method] Tm = 74.4 [%GC method] Tm = 66 [2 *(A+T) + 4 *(G+C) method] Mr = 6.3 k (oe strad) Mr = 12.4 k (two strads) µg/od = 45.6 (dsdna) Base Number ad % A 1 [5.0] C 4 [20.0] G 9 [45.0] T 6 [30.0] 5' CACTGGTGTGCGTGTGTGCG 3' :: 3' GCGTGTGTGCGTGTGGTCAC 5' Upper Primer: the most stable dimer: 2 bp, -3.6 kcal/mol 5' CACTGGTGTGCGTGTGTGCG 3' : : 3' GCGTGTGTGCGTGTGGTCAC 5' Hairpi: ²G = 0.9 kcal/mol, Loop = 8 t 5' CACTGGT G 3' GCGTGTGTGCGTG Pos. 454 Lower Primer: o 3'-termial dimer formatio No template cotrol (dimers) No template cotrol (dimers) A + T 7 [35.0] G + C 13 [65.0] Lower Primer: the most stable dimer: 4 bp, -9.8 kcal/mol 5' CTGCGGTCCGCTCTACACTAA 3' :::: 3' AATCACATCTCGCCTGGCGTC 5' Hairpi: ²G = -1.5 kcal/mol, Loop = 3 t, Tm = 48 5' CTGCGG T 3' AATCACATCTCGCC Error: 0,0115 Efficiecy: 1,996 Stadard Curve ²G -13.0-11.0-9.0 Positio 287 Legth 20 t. ²G -13.0-11.0-9.0 Positio 454 Legth 21 t. -7.0-7.0-5.0 CACTGGTGTGCGTGTGTGCG (5'-> 3') -5.0 CTGCGGTCCGCTCTACACTAA (5'-> 3') FRET Fluorescece Resoace Eergy Trasfer FRET Fluorescece Resoace Eergy Trasfer Distace-depedet iteractio betwee the electroic excited states of two dye molecules i which excitatio is trasferred from a door molecule to a acceptor molecule without emissio of a photo. The absorptio spectrum of the acceptor must overlap the fluorescece emissio spectrum of the door The efficiecy of FRET is depedet o the iverse sixth power of the itermolecular separatio: Door ad acceptor molecules must be i close proximity (typically 10 100 Å) FRET Fluorescece Resoace Eergy Trasfer Quechers Dabcyl et Black Hole Quechers 3

Fluorophores utilisables Taqma probe Sodes d hybridatio Probe that hybridizes to the specific product Probe 1 Probe 2 3'ed door fluorophore 5'ed acceptor fluorophore Labels ad modificatios Fluorescei LightCycler Red 610, 640, 670 or 705 Sodes TaqMa, Beaco, Scorpio 5'ed reporter 6-FAM, HEX, TET, JOE, TAMRA, ROX, Fluorescei, Cy 3, Cy5, Cy5.5, Texas Red, Rhodamie, Rhodamie Red, Rhodamie Gree, 6-CarboxyRhodamie 6G, Orego Gree 488, Orego Gree 500 or Orego Gree 514 3'ed quecher TAMRA, DABCYL, BHQ -1 or BHQ-2 Molecular beacos Hybridizatio probe Probe that hybridizes to the specific product Scorpio probes Labelled primer cotais the probe that hybridizes to the specific product Scorpio probes Labeled primer cotais the probe that hybridizes to the specific product 4

Scorpio probes Labeled primer cotais the probe that hybridizes to the specific product Avec des sodes spécifiques: Possibilité d utiliser différets fluorophores pour différetes séqueces. Mais: Multiplexig très délicat à cause des iterféreces etre amorces LNA: locked ucleic acids LNA: locked ucleic acids Reduced coformatioal flexibility of the sugar icreases stability of the base pair A 2'-O, 4'-C methylee bridge locks the ribose moiety ito a C3'-edo coformatio. Bz-A-LNA 5-Me-Bz-C-LNA dmf-g-lna T-LNA The reduced coformatioal flexibility of the sugar icreases the stability of the base pair 8 to 9 ucleotide log base pair hybrid are stable at 60 C Most of the mrna sequeces of a higher orgaism ca be detected with a 90 probe Taqma set: Exiqo Uiversal probe library (Roche) Geotypage Sodes d hybridatio Aalyse de variatios alléliques avec la PCR quatitative Détectio de SNP (homozygote A/A, a/a et hétérozygote A/a) www.roche-applied-sciece.com 5

Courbe de fusio Desig des sodes pour la détectio de mutatio perfect match Fluorescece (F1) mismatch Sode d acrage Sode de mutatio Le T m de la sode de mutatio est eviro 5 C plus bas que le T m de la sode d acrage Applicatio: détectio de mutatio Courbe de fusio Perfect match Mismatch ece (F1) Fluoresce ce -d (F1) / dt Fluorescec Température C Température basse moyee élevée Géotypage Applicatio: détectio de mutatio de l Apolipoproteie E M F V L H H Hétérozygote muté 6

Géotypage par courbe de fusio Sodes d Hydrolyses. Taqma LC- Apo B Mutatio Detectio Kit (codo 3500) Géotypage avec les sodes Taqma Géotypage avec les sodes Taqma www.appliedsystems.com www.appliedsystems.com Quatificatio Quatificatio umber Cycle 40 35 30 25 20 Stadard curve Stadard 15-0,5 0 0,5 1 1,5 Log Cocetratio Cp= Slope x LogC + Itercept 7

The Maths behid MethylQuat Ct 1 = S. LogC 1 + I Ct 2 = S. LogC 2 + I If C 2 =(1+E). C 1 the Ct 2 =Ct 1-1 LogC 2 =Log (1+E) + Log C 1 S [Log (1+E) +Log C 1 ] + I = S. LogC 1 + I -1 Log (1+E) = -1/S 1+E = 10-1/S 100% S=-3.321 90% S=-3.587 80% S=-3.917 sesitivity Proportio of aalysed species MethylQuat A sigle LNA at the 3 -ed of the primer provides superior discrimiatig ability ΔCt MIS-MAT Regular LNA U2 Umet 7.2 12 A:C U3 Umet 8.8 13.3 A:C L2 + Umet 6.8 14.4 A:C L2 + Met N/A 11.7 G:T L3 Umet 4.5 14 T:G L3 Met (56 C) 2.6 9.5 C:A L3 Met (58 C) 4.3 10.3 C:A MethylQuat A sigle LNA at the 3 -ed of the primer provides superior discrimiatig ability 8