Quatitative PCR PCR Quatitative e temps réel Aspects méthodologiques al itesity) Log (Siga Sample 1 Sample 2 Sample 3 Sample 4 0 5 10 15 20 25 30 35 40 45 50 Cycle umber Quatitative PCR Quatitative PCR al itesity) Log (Siga Sample 1 Sample 2 Sample 3 Sample 4 al itesity) Log (Siga Sample 1 Sample 2 Sample 3 Sample 4 0 5 10 15 20 25 30 35 40 45 50 Cycle umber 0 5 10 15 20 25 30 35 40 45 50 Cycle umber Fluorescece Mesure de fluorescece e format capillaires Roche 1
Mesure de fluorescece e format 96 Puits Mesure de fluorescece e format 96 Puits Stratagee Biorad Rotor gee The techology i the machies Illumiatio: Laser Haloge lamps, LED Detectio: PMT CCD camera Temperature cyclig: Block-Peltier Air: capillaries Advatages More sesitive Multiplexig. Idividual sample aalysis Cheaper. Higher throughput Faster, more sesitive, temperature more uiform Les évolutios: Roche 480 SYBR Gree Sample umbers: Blocks for either 96 or 384 samples, easily exchageable by user Reactio volumes: 3 µl - 20 µl (384 well), 20 µl -100 µl (96 well) Temperature cotrol: Peltier-based heatig/coolig from 40 C - 95 C Heated lid, PCR without ay overlay (e.g., wax or oil) Passive post-ru coolig to < 40 C Maximum ramp rates: Heatig: 6.3 C/s (average values for Coolig: 3.5 C/s stadard ru coditios Meltig: 0.01-0.5 C/s Excitatio: 5 excitatio filters, high-itesity broad-spectrum xeo lamp Detectio: 6 detectio filters, sigals detected olie by CCD camera Ru time: < 60 miutes (96-well plate), < 40 miutes (384-well plate) 2
The problem with SYBRGree: primer dimers Properties of primers Pos. 287 Upper Primer: the most stable 3'-dimer: 2 bp, -3.6 kcal/mol Stadard Curve Upper Primer [287]: Td = 71.7 [earest eighbor method] Tm = 74.4 [%GC method] Tm = 66 [2 *(A+T) + 4 *(G+C) method] Mr = 6.3 k (oe strad) Mr = 12.4 k (two strads) µg/od = 45.6 (dsdna) Base Number ad % A 1 [5.0] C 4 [20.0] G 9 [45.0] T 6 [30.0] 5' CACTGGTGTGCGTGTGTGCG 3' :: 3' GCGTGTGTGCGTGTGGTCAC 5' Upper Primer: the most stable dimer: 2 bp, -3.6 kcal/mol 5' CACTGGTGTGCGTGTGTGCG 3' : : 3' GCGTGTGTGCGTGTGGTCAC 5' Hairpi: ²G = 0.9 kcal/mol, Loop = 8 t 5' CACTGGT G 3' GCGTGTGTGCGTG Pos. 454 Lower Primer: o 3'-termial dimer formatio No template cotrol (dimers) No template cotrol (dimers) A + T 7 [35.0] G + C 13 [65.0] Lower Primer: the most stable dimer: 4 bp, -9.8 kcal/mol 5' CTGCGGTCCGCTCTACACTAA 3' :::: 3' AATCACATCTCGCCTGGCGTC 5' Hairpi: ²G = -1.5 kcal/mol, Loop = 3 t, Tm = 48 5' CTGCGG T 3' AATCACATCTCGCC Error: 0,0115 Efficiecy: 1,996 Stadard Curve ²G -13.0-11.0-9.0 Positio 287 Legth 20 t. ²G -13.0-11.0-9.0 Positio 454 Legth 21 t. -7.0-7.0-5.0 CACTGGTGTGCGTGTGTGCG (5'-> 3') -5.0 CTGCGGTCCGCTCTACACTAA (5'-> 3') FRET Fluorescece Resoace Eergy Trasfer FRET Fluorescece Resoace Eergy Trasfer Distace-depedet iteractio betwee the electroic excited states of two dye molecules i which excitatio is trasferred from a door molecule to a acceptor molecule without emissio of a photo. The absorptio spectrum of the acceptor must overlap the fluorescece emissio spectrum of the door The efficiecy of FRET is depedet o the iverse sixth power of the itermolecular separatio: Door ad acceptor molecules must be i close proximity (typically 10 100 Å) FRET Fluorescece Resoace Eergy Trasfer Quechers Dabcyl et Black Hole Quechers 3
Fluorophores utilisables Taqma probe Sodes d hybridatio Probe that hybridizes to the specific product Probe 1 Probe 2 3'ed door fluorophore 5'ed acceptor fluorophore Labels ad modificatios Fluorescei LightCycler Red 610, 640, 670 or 705 Sodes TaqMa, Beaco, Scorpio 5'ed reporter 6-FAM, HEX, TET, JOE, TAMRA, ROX, Fluorescei, Cy 3, Cy5, Cy5.5, Texas Red, Rhodamie, Rhodamie Red, Rhodamie Gree, 6-CarboxyRhodamie 6G, Orego Gree 488, Orego Gree 500 or Orego Gree 514 3'ed quecher TAMRA, DABCYL, BHQ -1 or BHQ-2 Molecular beacos Hybridizatio probe Probe that hybridizes to the specific product Scorpio probes Labelled primer cotais the probe that hybridizes to the specific product Scorpio probes Labeled primer cotais the probe that hybridizes to the specific product 4
Scorpio probes Labeled primer cotais the probe that hybridizes to the specific product Avec des sodes spécifiques: Possibilité d utiliser différets fluorophores pour différetes séqueces. Mais: Multiplexig très délicat à cause des iterféreces etre amorces LNA: locked ucleic acids LNA: locked ucleic acids Reduced coformatioal flexibility of the sugar icreases stability of the base pair A 2'-O, 4'-C methylee bridge locks the ribose moiety ito a C3'-edo coformatio. Bz-A-LNA 5-Me-Bz-C-LNA dmf-g-lna T-LNA The reduced coformatioal flexibility of the sugar icreases the stability of the base pair 8 to 9 ucleotide log base pair hybrid are stable at 60 C Most of the mrna sequeces of a higher orgaism ca be detected with a 90 probe Taqma set: Exiqo Uiversal probe library (Roche) Geotypage Sodes d hybridatio Aalyse de variatios alléliques avec la PCR quatitative Détectio de SNP (homozygote A/A, a/a et hétérozygote A/a) www.roche-applied-sciece.com 5
Courbe de fusio Desig des sodes pour la détectio de mutatio perfect match Fluorescece (F1) mismatch Sode d acrage Sode de mutatio Le T m de la sode de mutatio est eviro 5 C plus bas que le T m de la sode d acrage Applicatio: détectio de mutatio Courbe de fusio Perfect match Mismatch ece (F1) Fluoresce ce -d (F1) / dt Fluorescec Température C Température basse moyee élevée Géotypage Applicatio: détectio de mutatio de l Apolipoproteie E M F V L H H Hétérozygote muté 6
Géotypage par courbe de fusio Sodes d Hydrolyses. Taqma LC- Apo B Mutatio Detectio Kit (codo 3500) Géotypage avec les sodes Taqma Géotypage avec les sodes Taqma www.appliedsystems.com www.appliedsystems.com Quatificatio Quatificatio umber Cycle 40 35 30 25 20 Stadard curve Stadard 15-0,5 0 0,5 1 1,5 Log Cocetratio Cp= Slope x LogC + Itercept 7
The Maths behid MethylQuat Ct 1 = S. LogC 1 + I Ct 2 = S. LogC 2 + I If C 2 =(1+E). C 1 the Ct 2 =Ct 1-1 LogC 2 =Log (1+E) + Log C 1 S [Log (1+E) +Log C 1 ] + I = S. LogC 1 + I -1 Log (1+E) = -1/S 1+E = 10-1/S 100% S=-3.321 90% S=-3.587 80% S=-3.917 sesitivity Proportio of aalysed species MethylQuat A sigle LNA at the 3 -ed of the primer provides superior discrimiatig ability ΔCt MIS-MAT Regular LNA U2 Umet 7.2 12 A:C U3 Umet 8.8 13.3 A:C L2 + Umet 6.8 14.4 A:C L2 + Met N/A 11.7 G:T L3 Umet 4.5 14 T:G L3 Met (56 C) 2.6 9.5 C:A L3 Met (58 C) 4.3 10.3 C:A MethylQuat A sigle LNA at the 3 -ed of the primer provides superior discrimiatig ability 8