Biomedical Big Data and Precision Medicine



Similar documents
School of Nursing. Presented by Yvette Conley, PhD

GENETIC DATA ANALYSIS

A Primer of Genome Science THIRD

Core Facility Genomics

NGS and complex genetics

14.3 Studying the Human Genome

Biological Sciences Initiative. Human Genome

Genomes and SNPs in Malaria and Sickle Cell Anemia

Human Genome Organization: An Update. Genome Organization: An Update

Factors for success in big data science

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center

Mathematical Models of Supervised Learning and their Application to Medical Diagnosis

Sequencing and microarrays for genome analysis: complementary rather than competing?

Comparison of Non-linear Dimensionality Reduction Techniques for Classification with Gene Expression Microarray Data

Next Generation Sequencing: Adjusting to Big Data. Daniel Nicorici, Dr.Tech. Statistikot Suomen Lääketeollisuudessa

How many of you have checked out the web site on protein-dna interactions?

SAP HANA Enabling Genome Analysis

Gene mutation and molecular medicine Chapter 15

Human Genome and Human Genome Project. Louxin Zhang

SNP Essentials The same SNP story

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)

Genetic diagnostics the gateway to personalized medicine

G E N OM I C S S E RV I C ES

IMPLEMENTING BIG DATA IN TODAY S HEALTH CARE PRAXIS: A CONUNDRUM TO PATIENTS, CAREGIVERS AND OTHER STAKEHOLDERS - WHAT IS THE VALUE AND WHO PAYS

CCR Biology - Chapter 9 Practice Test - Summer 2012

An example of bioinformatics application on plant breeding projects in Rijk Zwaan

Molecular Genetics: Challenges for Statistical Practice. J.K. Lindsey

Cystic Fibrosis Webquest Sarah Follenweider, The English High School 2009 Summer Research Internship Program

Genetic Testing in Research & Healthcare

Targeted. sequencing solutions. Accurate, scalable, fast TARGETED

Speaker First Plenary Session THE USE OF "BIG DATA" - WHERE ARE WE AND WHAT DOES THE FUTURE HOLD? William H. Crown, PhD

Towards Integrating the Detection of Genetic Variants into an In-Memory Database

Electronic Medical Records and Genomics: Possibilities, Realities, Ethical Issues to Consider

Data Integration. Lectures 16 & 17. ECS289A, WQ03, Filkov

SHAHID AZIZ DO, FACOI.

Data Mining On Diabetics

The Human Genome Project

Presentation by: Ahmad Alsahaf. Research collaborator at the Hydroinformatics lab - Politecnico di Milano MSc in Automation and Control Engineering

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology

Exploratory data analysis for microarray data

European Genome-phenome Archive database of human data consented for use in biomedical research at the European Bioinformatics Institute

Single Nucleotide Polymorphisms (SNPs)

12.1 The Role of DNA in Heredity

The Future of the Electronic Health Record. Gerry Higgins, Ph.D., Johns Hopkins

Analysis of gene expression data. Ulf Leser and Philippe Thomas

TOWARD BIG DATA ANALYSIS WORKSHOP

Overview of Genetic Testing and Screening

Gene Expression Analysis

Data Analysis for Ion Torrent Sequencing

Next Generation Sequencing: Technology, Mapping, and Analysis

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Information leaflet. Centrum voor Medische Genetica. Version 1/ Design by Ben Caljon, UZ Brussel. Universitair Ziekenhuis Brussel

SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE

BIOINF 585 Fall 2015 Machine Learning for Systems Biology & Clinical Informatics

Genomic CDS: an example of a complex ontology for pharmacogenetics and clinical decision support

Overview of Next Generation Sequencing platform technologies

Focusing on results not data comprehensive data analysis for targeted next generation sequencing

FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem

The Human Genome Project. From genome to health From human genome to other genomes and to gene function Structural Genomics initiative

Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe

Information for patients and the public and patient information about DNA / Biobanking across Europe

Cloud-Based Big Data Analytics in Bioinformatics

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

Validation and Replication

Leading Genomics. Diagnostic. Discove. Collab. harma. Shanghai Cambridge, MA Reykjavik

Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the

Differential privacy in health care analytics and medical research An interactive tutorial

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Genetic Testing: Scientific Background for Policymakers

A leader in the development and application of information technology to prevent and treat disease.

Statistical issues in the analysis of microarray data

Survey of clinical data mining applications on big data in health informatics

MUTATION, DNA REPAIR AND CANCER

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

This fact sheet describes how genes affect our health when they follow a well understood pattern of genetic inheritance known as autosomal recessive.

Cancer Genomics: What Does It Mean for You?

Genetic Mutations. Indicator 4.8: Compare the consequences of mutations in body cells with those in gametes.

Final Project Report

Machine Learning CS Lecture 01. Razvan C. Bunescu School of Electrical Engineering and Computer Science

Big Data for Population Health and Personalised Medicine through EMR Linkages

Recombinant DNA and Biotechnology

Technical Issues in Aggregating and Analyzing Data from Heterogeneous EHR Systems

Incorporating Research Into Sight (IRIS) Essentia Rural Health Institute Marshfield Clinic Penn State University

The Data Mining Process

Introduction to genetic testing and pharmacogenomics

Validation parameters: An introduction to measures of

TRACKS GENETIC EPIDEMIOLOGY

Online Supplement to Polygenic Influence on Educational Attainment. Genotyping was conducted with the Illumina HumanOmni1-Quad v1 platform using

Appendix G STATISTICAL METHODS INFECTIOUS METHODS STATISTICAL ROADMAP. Prepared in Support of: CDC/NCEH Cross Sectional Assessment Study.

Big Data Healthcare. Fei Wang Associate Professor Department of Computer Science and Engineering School of Engineering University of Connecticut

Gene Therapy. The use of DNA as a drug. Edited by Gavin Brooks. BPharm, PhD, MRPharmS (PP) Pharmaceutical Press

Introduction To Epigenetic Regulation: How Can The Epigenomics Core Services Help Your Research? Maria (Ken) Figueroa, M.D. Core Scientific Director

Next generation DNA sequencing technologies. theory & prac-ce

Bioinformatics: course introduction

Transcription:

Biomedical Big Data and Precision Medicine Jie Yang Department of Mathematics, Statistics, and Computer Science University of Illinois at Chicago October 8, 2015

1 Explosion of Biomedical Data 2 Types and Sources of Biomedical Data Electronic clinical data DNA sequencing data DNA variation: SNP data Gene expression data: DNA microarray and RNA-Seq CNV and DNA methylation data 3 Precision Medicine Precision medicine vs. personalized medicine Precision medicine in genetic disease Precision medicine: prevention Biobanking and data sharing 4 Permanental Classification Approach

Explosion of Biomedical Data: Electronic Medical Records Hospitals and medical centers are collecting and maintaining comprehensive medical records electronically. For example, a comprehensive dataset extracted from the Advocate Health and Hospitals Corporation database contains the electronic medical records of 109,421 adult inpatients (162,466 encounters) discharged between March 1, 2011 and July 31, 2012. Electronic medical data may facilitate health study researchers to identify important traits associated with complex disease and evaluate the corresponding treatments or therapies.

Explosion of Biomedical Data: Genomic Data Genomic data of a large cohort of individuals are assembled and become available for health study researches. The emerge consortium funded by the National Human Genome Research Institute combines electronic medical records and genomic data from almost 200,000 individuals (Ashley, 2015). The combined data are extremely high-dimensional and also becoming bigger and bigger, especially the genomic part. The first-generation genomic data from genotyping chips targets genetic variants of about 20,000 genes, while the gnome sequencing technique (about 10-fold more expensive than chips) can provide 1000-fold more data (Ashley, 2015).

Electronic Clinical Data: Advocate Database Collected from eight Advocate Health Care hospitals. It includes 109,421 adult inpatients (162,466 index admissions) discharged from March 1, 2011 to July 31, 2012. There are 298 independent variables, including: (1) administration variables: age, gender, race, quarter of index admission, insurance, medical service group, language, employment status, marriage status, discharge disposition, against medical advice (AMA) at discharge, AMA history, Braden score, Charlson comorbidity index, number of emergency room, number of observation and number of inpatient in the last year and the last 6 months; (2) current and history condition, procedure and medication variables; (3) lab test results during the index admission.

Request Data from Database: An SQL Example drop table IF EXISTS de ; select distinct population_id, empi_id into local temp table de ON COMMIT PRESERVE ROWS from(---2779543---union:2810596 select distinct empi_id,population_id from APP_IL_2014.PH_F_Claim_detail where service_from_date>= 2014-01-01 and service_to_date< 2015-04-01 union select distinct empi_id,population_id from APP_IL_2014.PH_F_Claim where stmt_from_date>= 2014-01-01 and stmt_to_date< 2015-04-01 )a where population_id= 2feb2cb1-be55-4827-a21f-4e2ef1a40340 ;

Genomic Data: DNA Sequencing Data A genome is the sum of all the DNA in an organism. There are four types of chemical bases in a genome: A, T, C, and G. The human genome consists of 23 chromosome pairs and has 3 billion pairs of bases (3.235 10 9 nucleotides). Shotgun sequencing: Developed in 1977. Break longer DNA sequences into random small segments and sequence them to obtain reads, then assemble short reads into a continuous sequence. High-throughput (or next-generation) sequencing: First developed in 2004. Parallelize the sequencing process and producing thousands or millions of sequences at once.

DNA Sequencing Data: An Example >gi 568815597 ref NC_000001.11 Homo sapiens chromosome 1, GRCh38.p2 Primary Assembly... CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTA ACCCTAACCCTAACCCTAACCCTAACCCAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCC TAACCCTAACCCTAACCCTAACCCTAACCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACC CTAACCCTAACCCCTAACCCTAACCCTAAACCCTAAACCCTAACCCTAACCCTAACCCTAACCCTAACCC CAACCCCAACCCCAACCCCAACCCCAACCCCAACCCTAACCCCTAACCCTAACCCTAACCCTACCCTAAC CCTAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCCTAACCCTAACCCTAACCCTAACCCTAACCC TAACCCTAACCCCTAACCCTAACCCTAACCCTAACCCTCGCGGTACCCTCAGCCGGCCCGCCCGCCCGGG TCTGACCTGAGGAGAACTGTGCTCCGCCTTCAGAGTACCACCGAAATCTGTGCAGAGGACAACGCAGCTC CGCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGGAGAACGCAACTCCGCCGTTGCAAAGGCGCGCCGCGC CGGCGCAGGCGCAGAGAGGCGCGCCGCGCCGGCGCAGGCGCAGAGAGGCGCGCCGCGCCGGCGCAGGCGC AGAGAGGCGCGCCGCGCCGGCGCAGGCGCAGAGAGGCGCGCCGCGCCGGCGCAGGCGCAGAGAGGCGCGC CGCGCCGGCGCAGGCGCAGACACATGCTAGCGCGTCGGGGTGGAGGCGTGGCGCAGGCGCAGAGAGGCGC GCCGCGCCGGCGCAGGCGCAGAGACACATGCTACCGCGTCCAGGGGTGGAGGCGTGGCGCAGGCGCAGAG AGGCGCACCGCGCCGGCGCAGGCGCAGAGACACATGCTAGCGCGTCCAGGGGTGGAGGCGTGGCGCAGGC GCAGAGACGCAAGCCTACGGGCGGGGGTTGGGGGGGCGTGTGTTGCAGGAGCAAAGTCGCACGGCGCCGG GCTGGGGCGGGGGGAGGGTGGCGCCGTGCACGCGCAGAAACTCACGTCACGGTGGCGCGGCGCAGAGACG...

Single Nucleotide Polymorphism (SNP) A single nucleotide polymorphism (SNP, pronounced snip) is a DNA sequence variation occurring commonly within a population (e.g. 1%). For example, two sequenced DNA fragments from different individuals, AAGCCTA to AAGCTTA, contain a difference in a single nucleotide. SNPs occur in non-coding regions more frequently than in coding regions. As of June 8, 2015, dbsnp listed 149,735,377 SNPs in humans (http://www.ncbi.nlm.nih.gov/snp/). A single SNP may cause a Mendelian disease. Examples include sickle-cell anemia, cystic fibrosis. For complex diseases, SNPs do not usually function individually.

DNA Microarray Data A DNA microarray (also known as DNA chip) measures the expression levels of large numbers of genes simultaneously. For example, Arrayit s H25K (http://www.arrayit.com) contains 25,509 fully annotated human genes.

Alternative Technology: RNA-Seq RNA-seq (RNA sequencing) uses next-generation sequencing to reveal a snapshot of RNA presence, which can detect previously unidentified genes or transcripts.

Other Types of Genomic Data Copy number variation (CNV): a structural variation, more than one copies of sections of DNA. DNA methylation: Methyl groups are added to DNA (see http://www.ks.uiuc.edu/research/methylation/).

Precision Medicine Initiative Precision medicine refers to precisely classifying individuals into subpopulations according to a particular disease and precisely tailoring of medical treatments to subcategories of the disease (Committee on a Framework for Developing a New Taxonomy of Disease, 2011; Collins and Varmus, 2015; Ashley, 2015). Most medical treatments have been designed for the average patient. Treatments can be very successful for some patients but not for others. Precision medicine takes into account individual differences in peoples genes, environments, and lifestyles for disease prevention and treatment. Launched with a $215 million investment in the President s 2016 Budget, the Precision Medicine Initiative will pioneer a new model of patient-powered research.

Precision Medicine vs. Personalized Medicine Precision Medicine classifies individuals into subpopulations. Personalized Medicine literally means the creation of drugs or medical devices that are unique to a patient.

Precision Medicine in Genetic Disease: An Example An example of precision medicine is the treatment of cystic fibrosis (inherited life-threatening disorder that damages the lungs and digestive system) with ivacaftor (Ramsey et al., 2011). The disease can be divided according to whether the defective channel reaches the cell surface or not. Ivacaftor (a potential treatment) increases the opening probability of the channel so that it is only effective in the subset of patients in whom the channel reaches the surface. The Cystic Fibrosis Foundation co-invested $150 million in the development of a particular drug targeting a precise subclass of patients. That initial investment increased in value to $3.3 billion by the time of the sale of the royalty rights in 2014 (Ashley, 2015).

Precision Medicine: Prevention A more sophisticated understanding of disease will almost certainly lead to more targeted and cost effective screening. One example is familial hypercholesterolemia (a genetic disorder characterized by high cholesterol levels), which carries a tier 1 recommendation for family screening from the Centers for Disease Control and Prevention. This genetic condition, which may be as common as 1:250 in the population, is associated with early myocardial infarction (heart attack). Cascade family screening with lipid panels and genetic testing has been shown to be highly cost-effective in identifying cases for potentially life-saving cholesterol-lowering therapy.

Biobanking and Data Sharing (Ashley, 2015) One major focus of the precision medicine initiative is the assembly of a large cohort of individuals willing to share their electronic medical record data and genomic data. In the first generation, genotyping chips targets the sequence of the approximately 20,000 genes. The next-generation sequencing technology is about 10-fold more expensive than chips, albeit for 1000-fold more data. The Million Veteran Program reports recruitment currently at more than 300,000 individuals, with thousands having been sequenced and hundreds of thousands having been genotyped. The emerge consortium combines electronic medical record data and genomic data from almost 200,000 individuals.

High-dimensional Classification and Clustering Achieving the goals of precision medicine requires sophisticated statistical and computational methods for high-dimensional classification and clustering. For a good review on commonly used classification and clustering methods, see, for example, Hastie et al. (2009). The medical records and genomic data of some patients may be collected under the same class label, say, lung cancer. How do we cluster the lung cancer patients into homogeneous subgroups so that the patients belonging to the same subgroup could be treated by a same therapy successfully? This is a clustering problem. If the clustering is successful, the next step would be classifying a new patient into one of the identified subgroups so that the patient could be treated by the most suitable therapy. This is a classification problem.

Permanental Classification Approach (Yang, Miescke, and McCullagh, 2012) Permanental classification approach assumes that the observations of each cluster follow a permanental process (a Cox process with a special random intensity). Given the observations x = {x 1,..., x n } with or without class labels y = {y 1,..., y n }, the conditional distribution of the labels is p n (y x) = per α 1 ( K[x (1) ] ) per αk ( K[x (k) ] ) per α1 + +α k (K[x]) Given a new unit u with feature value x, p n+1 (y(u ) = r data) per α r ( K[x (r) {x }] ) per αr ( K[x (r) ] )

Leukemia Data (Golub et al., 1999)

Two-Dimensional Display of Training Data Training data: 38 samples (27 ALL, 11 AML) Testing data: 34 samples (20 ALL, 14 AML) Uncertain testing units (Golub et al., 1999): No. 54, 57, 60, 66, 67 Two Dim Display Based on Training Data 1st PCA 60000 50000 40000 30000 20000 ALL AML Testing Unit 60 57 54 66 67 80000 60000 40000 20000 0 mean difference

Number of Test Errors on Average (Dudoit et al. 2002) number of errors on average 0.5 1.0 1.5 2.0 2.5 3.0 DLDA k NN SVM K2 K1 40 100 200 500 1000 2000 3000 4000 5000 6000 7129 number of genes used

Predicting Hypertension (Huang, Xu, and Yang, 2014) Genome-wide association study (GWAS) data of 1043 individuals, three measurements for most participants, four time intervals (1981 to 1996, 1997 to 2000, 1998 to 2006 and 2009 to 2011), 65519 single-nucleotide polymorphisms (SNPs) Prediction Errors of SVM and PC Using Common Variants Number of SNPs n=0 n=5 n=10 n=20 n=50 n=100 n=200 SVM (training) 0.230 0.029 0.018 0.013 0.018 0.005 0.001 SVM (testing) 0.242 0.146 0.135 0.127 0.126 0.121 0.125 PC (training) 0.223 0.103 0.097 0.040 0.033 0.034 0.032 PC (testing) 0.264 0.152 0.143 0.135 0.135 0.123 0.123 The best prediction error rates of SVM and PC are both close to 12%, which is much better than the error rate 22% based on logistic regression model.

Reference Ashley, E. (2015). The precision medicine initiative: A new national effort. JAMA, 313(21), 2119 2120. Wang, Gerstein, and Snyder (2009). RNA-Seq: a revolutionary tool for transcriptomics, Nature Reviews Genetics, 10, 57 63. Collins, F. and H. Varmus (2015). A new initiative on precision medicine. New England Journal of Medicine, 372(9), 793 795. Hastie, T., R. Tibshirani, and J. Friedman (2009). The Elements of Statistical Learning: Data Mining, Inference, and Prediction. Springer, 2nd ed. Huang, HH, Xu, T., and Yang, J. (2014). Comparing Logistic Regression, Support Vector Machines and Permanental Classification Methods in Predicting Hypertension, BMC Proceedings, 8, Suppl.1:S96. Ramsey BW, Davies J, McElvaney NG, et al; VX08-770-102 Study Group (2011). A CFTR potentiator in patients with cystic fibrosis and the G551D mutation. New England Journal of Medicine, 365(18), 1663 1672. Yang, J., Miescke, K., and McCullagh, P. (2012). Classification based on a permanental process with cyclic approximation. Biometrika, 99, 775-786.