Molecular Diagnostics in the Clinical Microbiology Laboratory

Transcription

1 Molecular Diagnostics in the Clinical Microbiology Laboratory Patrick Tang, MD, PhD, FRCPC B.C. Centre for Disease Control University of British Columbia

2 Molecular Diagnostics in the Clinical Microbiology Laboratory Introduction to molecular microbiology Overview of PCR Molecular genotyping methods

3 Traditional Microbiology Microscopy Culture Serology PCR

4 Detection of Organism Microscopy Culture Antigens Nucleic Acids

5 Detection of Host Response Serology (Host Immune Response)

6 Detection of Host Response (Future) Metabolomics Gene Expression

7 Nucleic Acid Detection Detection of organism-specific DNA or RNA Must know the sequence of the target region ATGATTTCGAGAACGGGACCTATTGCTAGTTGCGTACATGCTCTTCGAGTCACTGGCT Non-amplified Nucleic Acid Probe labelled DNA or RNA probe (enzyme, fluorescence, etc.) Signal Amplification increase concentration of labeled molecules attached to target Target Amplification enzyme-mediated synthesis of copies of the target nucleic acid Probe Amplification amplification products generated only from probes, not from target

8 Non-Amplified Nucleic Acid Probe Liquid-phase hybridization protection assay e.g., Gen-Probe Single-stranded DNA probe labeled with acridinium ester is added to sample If the probe binds to its complementary target sequence, the acridinium ester is protected from alkaline hydrolysis otherwise, acridinium ester will be hydrolyzed Acridinium ester emits light upon addition of peroxides DNA probe target sequence

9 Signal Amplification Branched DNA (Bayer) sandwich hybridization assay with multiple sets of probes bdna has 15 identical branches, each can bind 3 labeled probes bdna target sequence enzyme-labeled probes microwell with capture probes target probes capture probes Hybrid capture assay (Digene) target DNA is hybridized to RNA probe DNA:RNA hybrids are captured by immobilized antibodies soluble enzyme-conjugated antibodies then bind to the hybrids tube with capture antibodies enzyme-conjugated antibody RNA probe target DNA

10 Target Amplification Polymerase Chain Reaction (PCR) reverse transcriptase PCR (RT-PCR) nested PCR multiplex PCR real-time PCR (qpcr) Transcription-mediated amplification (TMA) / Nucleic acid sequence-based amplification (NASBA) isothermic amplification of RNA target Strand displacement amplification (SDA) isothermic amplification of DNA or RNA target

11 Polymerase Chain Reaction 95 C denaturation 72 C primer extension 50 C primer annealing 95 C 50 C 72 C exponential amplification 5 3

12 Probe Amplification Ligase Chain Reaction employs two sets of labeled probes that bind to adjacent target regions ligase enzyme joins the two contiguous probes into a linear product that can be captured and detected biotinylated probe 1 enzyme-labeled probe 2 ligase target DNA ligated probe streptavidin matrix

13 Probe Amplification Multiplex Ligation-dependent Probe Amplification employs two probes that bind to adjacent target regions one probe contains forward primer site, other probe contains reverse primer site multiple sets of probes bind to different targets each probe set has a different length linker region ligase enzyme joins the contiguous probes PCR with the forward and reverse primers is used to generate amplicons of variable length corresponding to each target probe A1 probe A2 probe B1 probe B2 target A target B

14 Polymerase Chain Reaction DNA Extraction Polymerase Chain Reaction Thermal cycling Components Primers Controls Detection of PCR amplicons Amplicon Contamination

15 DNA Extraction Sample homogenization tissues, viscous fluids, formalin-fixed tissue Mechanical lysis boiling, sonication, freeze/thaw, mortar/pestle Enzymatic lysis proteinase K Chemical lysis detergents guanidinium thiocyanate +/- phenol/chloroform DNA precipitation ethanol, isopropanol adsorption to silica matrix columns, silica beads/resin, silica-coated magnetic beads

16 Selecting a Method of Extraction Automated versus manual extraction cost per extraction, cost of equipment ease of use, hands-on time, turn-around time throughput (number of samples per run) Type of specimens being extracted Volume (mass) of specimen being extracted Efficiency of DNA recovery Quality of extracted DNA Extraction of DNA and/or RNA

17 Polymerase Chain Reaction

18 Stages of PCR Denaturation (90-95 C) separate the two strands in double stranded DNA Annealing (50-55 C) temperature depends upon primers Extension (65-72 C) depends upon enzyme and size of targeted region Final extension (65-72 C) fill in partially completed PCR products Cooling (4-10 C) keep cold to maintain DNA amplicons

19 PCR Thermal Cycling Temperature denaturation extension annealing

20 PCR Target Amplification

21 Choosing a Thermal Cycler Ramp rate rate of heating and cooling Temperature stability Block uniformity Single temperature or gradient Capacity Compatibility with PCR tubes and plates Cost Conventional or real-time PCR

22 PCR Reaction Components Master mix (typically µl) Target (DNA/RNA) typically 5-10% of total volume Polymerase Primers (~0.2 µm) Nucleotides dntps ( µm) KCl ( 50 mm) salts affect stability of dsdna stringency of reaction Mg 2+ (0.5 to 2.5 mm greater than [dntp]) binds to DNA and dntp required for activity of polymerase Buffer Water Available as commercial pre-mixes just add water, primers and sample

23 PCR Primers Proper PCR primer design is crucial in the success of the assay requires access to database of sequences sensitivity, specificity Typically 20bp and 50-60% GC content GC clamp at 3 end of primer too many G and C at 3 end may lead to mispriming Typical melting temperature (Tm) C Must pick sequences to avoid: self dimerization secondary structures (hairpins) dimerization with other primer

24 Degenerate Primers Mix of primers with variable bases at one or more sites GCATCTATATAACGTACGT GCATCTATATAACGTCCGT GCATCTATATAACGTGCGT Inosine can be used as a base instead universal base (found in trna) more expensive

25 Controls for PCR Positive control (low titer) ensure reagents were added and working properly Negative control(s) detect amplicon contamination, non-specific amplification Extraction control ensure that DNA was efficiently extracted Internal positive control ensure that amplification is occurring in each sample i.e., no PCR inhibitors are present in sample

26 Variations of PCR Reverse-transcriptase PCR (RT-PCR) use reverse transcriptase to convert RNA to cdna other steps are identical to regular PCR Nested PCR amplify a larger target region in first PCR reaction amplify a sub-region of the initial target in second PCR Multiplex PCR detect multiple targets in a single reaction multiple sets of primers Real-time PCR (rt-pcr or qpcr) real-time PCR can be quantitative

27 Detection of PCR product Agarose gel electrophoresis Polyacrylamide gel electrophoresis DNA separated by size Visualized with intercalating dye Ethidium bromide SYBR green

28 Agarose Gel Electrophoresis - larger fragments slower migration + smaller fragments faster migration

29 water PCR control weak pos PCR control strong pos PCR control water extraction control neg extraction control pos extraction control

30 PCR Contamination PCR clean room/area vs. dirty area one-way flow of samples amplicons from previous PCR reactions highly positive samples or controls laminar flow hood gloves filtered pipette tips change lab coats careful technique open one tube at a time, avoid aerosols bleach, high concentration NaOH, ultraviolet, commercial products uracil N-glycosylase use dutp instead of dttp in PCR reactions

31 Conventional PCR vs. Real-Time PCR Real-time PCR detection of amplification during exponential and linear phase measure amount of PCR product at each PCR cycle Conventional PCR detection of amplification with ethidium bromide when reaction complete results are not quantifiable because of variability of the endpoint yield of PCR product

32 Amplification Plot Fluorescence Cycle Number C t (cycle threshold)

33 Intercalating Dyes SYBR Green, SYBR Gold, Yo-Yo-1, Yo-Pro-1 Dye binds to double stranded DNA once extension is complete Only fluorescent when bound to the dsdna

34 SYBR Green PCR Standard PCR reaction with SYBR Green added to detect total DNA amplification

35 Melting Curve Analysis Different sizes of DNA molecules melt at a different temperatures Melting curves are needed to confirm amplification of desired DNA target

36 SYBR Green Disadvantages Binds to all the double stranded DNA in the reaction including non-specific amplification products and primer-dimers Melt-curve analysis is required to resolve amplification products Real-time (quantitative) PCR reactions that use non-specific dyes must be VERY well optimized to give good results

37 DNA Probes 5 exonuclease probes (TaqMan) Molecular beacons Hybridizes to specific region of PCR product Based on the principle of fluorescent resonant energy transfer (FRET)

38 Fluorescent Resonant Energy Transfer (FRET) distance-dependent interaction between the electronic excited states of two dye molecules in which excitation is transferred from a donor molecule to an acceptor molecule

39 Anatomy of a TaqMan Probe Fluorescent reporter dye (donor) R Quencher molecule (acceptor) Q Target-specific single stranded DNA (13-24 base pairs in length)

40 Polymerization Primers and probe anneal to target DNA 5 3 Forward Primer R TaqMan Probe Q 5 5 Reverse Primer 3 5

41 Displacement Taq polymerase displaces the probe strand Forward Primer R Q Reverse Primer 5 3 5

42 Cleavage 5 exonuclease activity of Taq polymerase cleaves reporter molecule R Q 5 3 5

43 Polymerization Completed R Q

44 Molecular Beacons Target specific DNA in loop Probe forms hairpin loop when not hybridized to template Reporter and quencher in proximity when loop closed Hybridized to template Hairpin loop Melted Annealing exactly to correct template favored over stemloop formation

45 Quantitative PCR There is a quantitative relationship between the amount of target nucleic acid present at the start of PCR and the amount of product amplified during its exponential (geometric) phase Exponential phase Threshold Baseline

46 Relationship Between Initial Copy Number and Cycle Number Cycle number Threshold Copy No

47 Advantages of real-time PCR Faster than conventional PCR Faster cycling and no need to run samples on agarose gels Higher analytical sensitivity Detection limit at 1-10 copies versus copies Results available during testing/thermocycling Reduced chance for PCR contamination Closed system

48 Molecular Typing Methods

49 Laboratory Methods for Epidemiological Analysis of Microorganisms Biotyping (Phenotyping) Biochemicals Assimilation of different biochemicals Can combine with antibiotic susceptibility profile Serotyping Recognition by type-specific antibodies Phage typing Susceptibility to different bacteriophage Multilocus enzyme electrophoresis (MLEE) Compare electrophoretic mobility of a set of proteins

50 Laboratory Methods for Epidemiological Analysis of Microorganisms Genotyping Restriction fragment-length polymorphism (RFLP) Pulsed-field gel electrophoresis (PFGE) Random amplification of polymorphic DNA (RAPD) Amplified fragment length polymorphism (AFLP) Variable number of tandem repeats (VNTR) Multilocus sequence typing (MLST) Single nucleotide polymorphism (SNP) typing Microarray typing Whole genome sequencing

51 RFLP 1. AMPLIFY ORGANISM 3. RUN GEL FRAGMENT GENOME 3 Restriction Endonucleases 1 2

52 IS6110-based RFLP for Genotyping of Mycobacterium tuberculosis

53 PFGE Restriction enzyme Voltage gradient Switch interval Reorientation angle Agarose content of gel Temperature Run time A- B+ B- A+

54 PFGE of Shigella flexneri (BlnI)

55 RAPD 1. AMPLIFY GENOME 3 Short Primers GENERATE PCR FRAGMENTS RUN GEL 1 2 3

56 AFLP 1. FRAGMENT GENOME 2. LIGATE ADAPTERS 3. PCR 3 Restriction Endonucleases Adapters RUN GEL 1 2 Primers 3

57 Laboratory Methods for Epidemiological Analysis of Microorganisms Restriction fragment-length polymorphism (RFLP) Amplify DNA by culturing the organism Restriction endonuclease digestion of DNA into small pieces Resolve DNA fragments on agarose gel Pulsed-field gel electrophoresis (PFGE) PFGE is a type of RFLP DNA is cut into large fragments that can only be resolved using pulsedfield gel apparatus Random amplification of polymorphic DNA (RAPD) A defined set of short primers are used to PCR amplify the genomic DNA The short primers bind at multiple locations creating a band pattern when resolved by agarose gel electrophoresis Amplified fragment-length polymorphism (AFLP) Restriction digest DNA first Amplify by PCR and resolve with gel electrophoresis

58 VNTR 1. AMPLIFY TARGET REGIONS different PCR reactions 2. GENERATE PCR FRAGMENTS 1 2 Determine number of tandem repeats 3 3. CAPILLARY ELECTROPHORESIS 5 VNTR pattern =

59 MLST 1. AMPLIFY MULTIPLE LOCI 2. GENERATE PCR FRAGMENTS different PCR reactions 3. DNA SEQUENCING ATCGTTAGGAAGCAT TTACAACCAGTAGCACCC GAGCTTACCAATCGGAC 1 2 3

60 SNP Genotyping DETERMINE MULTIPLE LOCI T G A 1. qpcr 2. PYROSEQUENCING 3. MICROARRAY A T A C G C P SNP1 = T SNP2 = G SNP3 = A G A A T C

61 Microarray Genotyping Oligonucleotide probes targeting different regions of the genome different alleles of the same gene different SNPs unique genes A1 A2 A3 A4 A5 A6 A7 B1 B2 B3 B4 B5 B6 B7 C1 C2 C3 C4 D1 D2 D3 E1 E2 E3 F G1 G2 G3 H1 H2 I J1 J2 K L

62 Microarray Genotyping Isolate No.1 A1 A2 A3 A4 A5 A6 A7 B1 B2 B3 B4 B5 B6 B7 C1 C2 C3 C4 D1 D2 D3 Isolate No.2 A1 A2 A3 A4 A5 A6 A7 B1 B2 B3 B4 B5 B6 B7 C1 C2 C3 C4 D1 D2 D3 E1 E2 E3 F G1 G2 G3 E1 E2 E3 F G1 G2 G3 H1 H2 I J1 J2 K L H1 H2 I J1 J2 K L Isolates 1 and 2 are related but not identical

63 Laboratory Methods for Epidemiological Analysis of Microorganisms Variable number of tandem repeats (VNTR) PCR amplify genetic regions containing tandem repeats Electrophoresis to resolve size of PCR products Multilocus sequence typing (MLST) Sequence a defined set of loci within the genome Single nucleotide polymorphism (SNP) typing Determine the SNP at a set of defined positions in the genome by PCR, sequencing or microarray Microarray typing Determine presence or absence of a defined set of markers within the genome

64 Laboratory Methods for Epidemiological Analysis of Microorganisms Whole genome sequencing Fragment genome into smaller overlapping pieces PCR, restriction digest, sonication, etc. Sequence fragments Assemble contigs Bioinformatics analysis Whole genome alignments Detection of mutations Genomic islands Insertions/deletions Point mutations, SNPs

65 Phylogenetics Compare the genetic relatedness between organisms Distance-based methods are used to create trees which approximate phylogenetic relationships Based on genotyping data RFLP, MLST, etc.

66 The End