2D Barcode for DNA Encoding
|
|
|
- Jacob Sutton
- 10 years ago
- Views:
Transcription
1 2D Barcode for DNA Encoding Elena Purcaru, Cristian Toma Bucharest General Medicine Faculty, Cybernetics and Economic Informatics Faculty Carol Davila University of Medicine and Pharmacy, Academy of Economic Studies Eroii Sanitari Boulevard 8, Bucharest, Romana Square 6, Bucharest ROMANIA Abstract: The paper presents a solution for endcoding/decoding DNA information in 2D barcodes. First part focuses on the existing techniques and symbologies in 2D barcodes field. The 2D barcode PDF417 is presented as starting point. The adaptations and optimizations on PDF417 and on DataMatrix lead to the solution DNA2DBC DeoxyriboNucleic Acid Two Dimensional Barcode. The second part shows the DNA2DBC encoding/decoding process step by step. In conclusions are enumerated the most important features of 2D barcode implementation for DNA. Key-Words: DNA - Deoxyribonucleic acid, 2D barcode, DNA2DBC, PDF417, code symbology. 1. Introduction A barcode [6] is an optical representation of data. Originally, barcodes represented data as parallel lines and the spacings, referred to as linear or 1D (1 dimensional) barcodes or symbologies. They also come in patterns of squares, dots, hexagons and other geometric patterns within images termed 2D (2 dimensional) matrix codes or symbologies. Although 2D systems use symbols other than bars, they are generally referred to as barcodes as well. [6] Barcodes can be read by optical scanners called barcode readers, or scanned from an image by special software. A barcode reader contains a photo-sensor that converts the barcode into an electrical signal as it moves across it. The scanner then measures the relative widths of the bars and spaces, translates the different patterns back into regular characters, and sends them to a computer or portable terminal. 2D readers are based mostly on camera with CMOS sensor picture processing technology. Barcodes were invented to label railroad cars, but they were not commercially successful until they were used to automate supermarket checkout systems, a task in which they have become almost universal. [6]. 2. Barcodes Types Each character in a barcode is represented by a pattern of wide and narrow bars. Every barcode begins with a special start character and ends with a special stop character [5-6]. These conventions help the barcode scanner to identify and read the symbol in the right position. Some barcodes may include a checksum character. A checksum is calculated when the barcode is printed using the characters in the barcode. The reader performs the same calculation in order to detect errors in the symbol. If the two checksums don't match, the reader assumes that something is wrong, throws out the data, and tries again D Numeric and Alphanumeric Barcodes A Barcode Symbology [5-6] defines the technical details of a particular type of barcode: the width of the bars, character set, method of encoding, checksum specifications, etc. Barcode users are usually interested in the general capabilities of a particular symbology (how much and what kind of data can it hold, what are its common uses, etc) and not in the technical details. 142
2 Journal of Mobile, Embedded and Distributed Systems, vol. III, no. 3, 2011 ISSN Most used 1D numeric barcodes /symbologies are: Codabar: used in library systems, sometimes in blood banks Code 11: used primarily for labeling telecommunications equipment EAN-13: European Article Numbering international retail product code EAN-8: compressed version of EAN code for use on small products Industrial 2 of 5: older code not in common use anymore Interleaved 2 of 5: widely used in industry, air cargo Plessey: older code commonly used for retail shelf marking MSI: variation of the Plessey code commonly used in USA PostNet: used by U.S. Postal Service for automated mail sorting UPC-A: Universal Product Code seen on almost all retail products in the USA and Canada Standard 2 of 5: older code not in common use UPC-E: compressed version of UPC code for use on small products. Most used 1D alphanumeric barcodes /symbologies are: Code 128: very capable code, excellent density, high reliability; in very wide use world-wide Code 39: general-purpose code, wide use world-wide Code 93: compact code similar to Code 39 LOGMARS: same as Code 39, is the U.S. Government specification D Barcodes Two dimensional 2D symbols encode data in two dimensional shapes. They fall into two general categories: Stacked barcodes, constructed like a layer of barcodes stacked on top of the other; they can be read by special 2D scanners or by many CCD (charge-coupled device) and laser scanners with the aid of special decoding software. Matrix Codes, built on a true 2D matrix; they are usually more compact than a stacked barcode, and they can be read only by 2-D scanners. The main advantage of 2D barcodes is the ability to encode a lot of information in a small space. If 1D barcodes can encode 20 to 25 characters, 2D symbols can encode from 100 to about 2,000 characters. The most used 2D barcodes / symbologies are (Classification according to [5]): PDF417: used for encoding large amounts of data DataMatrix: can hold large amounts of data, in very small codes Maxicode: fixed length, used by United Parcel Service for automated package sorting QR Code: Used for material control and order confirmation Aztec Data Code Code Barcode 2D PDF417 Analysis The PDF 417 code is part of 2 dimentional barcode family. PDF stands for "Portable Document File" because with several rows and columns, it is possible to encode up to 2700 bytes - a lot of PDF417 info is copyrighted in [4]. The encoding is done in two stages: High level encoding The datas (input bytes) are converted to "codeword". From now on CW stands for codeword. High level encoding supports multiple modes encoding such as: Byte level capacity of encoding is ASCII code 0 to 255, aprox. 1,2 byte per CW. The "Byte" mode (high level encoding) allows encoding 256 different bytes, which is the entire extended ASCII table (ISO 8859). For ASCII code values please reffer [8]. Text level capacity of encoding is ASCII code 9, 10, 13 and 32 to 127, 2 characters per CW 143
3 Numeric level capacity of encoding is only for digits 0 to 9, 2.9 digits per CW Low level encoding The codewords obtained during first stage are converted to bars and spaces patterns. Moreover an error correction system with several levels is included in order to allow reconstituting badly printed, erased, fuzzy or torn off datas. The general structure of PDF 417 is [4] CW stands for codeword: The width of the smalest/finest bar is called the module. A bar module is represented by "1" and a space module by "0". The code has 3 to 90 rows. A row has 1 to 30 datas columns and its width goes from 90 to 583 modules with the margins. Maximum number of CW in bar codes: 928 including 925 for the datas. (1 for the length descriptor and 2 at least for the error correction.) There are 929 CWs including 900 for the datas, they are numbered from 0 to 928. The errors correction levels goes from 0 to 8. The correction covers 2 (on level 0) to 512 (on level 8) CW. The row consists of: a start character, a left side CW, 1 to 30 datas CW, a right side CW and a stop character. There must be a white margin of at least 2 modules on each side. CW of padding (e.g. codeword with value "900") can be intercalated between datas and correction CW; those must be located at the end. First CW indicates CW total number of the code including: datas, CW of stuffing and itself but excluding CW correction. "Macro PDF417" mechanism allows distributing more datas on several bar codes. The CW number have special meaning, some enable to switch between modes in order to optimise the code-table1. Table 1.Special CW CW number : Function 900 : Switch to "Text" mode 901 : Switch to "Byte" mode 902 : Switch to "Numeric" mode 903 to 912 : Reserved 913 : Switch to "Octet" only for the next CW 914 to 920 : Reserved 921 : Initialization 922 : Terminator codeword for Macro PDF control block 923 : Sequence tag to identify the beginning of optional fields in the Macro PDF control block 924 : Switch to "Byte" mode (If the total number of byte is multiple of 6) 925 : Identifier for a user defined Extended Channel Interpretation (ECI) 926 : Identifier for a general purpose ECI format 927 : Identifier for an ECI of a character set or code page 928 : Macro marker CW to indicate the beginning of a Macro PDF Control Block In this section is presented the practical encoding of word Super! in high-level both in text and byte mode. This presentation is support for our 2D barcode defined for encoding DNA structure. The high-level encoding in text mode has 4 sub-modes: Uppercase Lowercase Mixed: Numeric and punctuation Punctuation 144
4 Journal of Mobile, Embedded and Distributed Systems, vol. III, no. 3, 2011 ISSN The default sub-mode is "Uppercase", in this sub-mode 2 characters are encoded in each CW, here is the characters table 2: Table 2.Characters value for high-level encoding in text mode Value Uppercase Lowercase Mixed Punctuation 0 A a 0 ; 1 B b 1 < 2 C c 2 > 3 D d 4 E e 4 [ 5 F f 5 \ 6 G g 6 ] 7 H h 7 _ 8 I I 8 ` (Quote) 9 J j 9 ~ 10 K k &! 11 L l CR CR 12 M m HT HT 13 N n,, 14 O o : : 15 P p # LF 16 Q q R r.. 18 S s $ $ 19 T t / / 20 U u + 21 V v % 22 W w * * 23 X x = ( 24 Y y ^ ) 25 Z z PUN? 26 SP SP SP { 27 LOW T_UPP LOW } 28 MIX MIX UPP ' (Apostrophe) 29 T_PUN T_PUN T_PUN UPP The 6 switchs are included in these tables, they allow to change the submode: UPP: switch to "Uppercase" LOW: switch to "Lowercase" MIX: switch to "Mixed" PUN: switch to "Punctuation" T_UPP: switch to "Uppercase" only for next character T_PUN: switch to "Punctuation" only for next character Each CW encodes 2 characters; if C 1 and C 2 are the values of the two characters, CW value is: C 1 * 30 + C 2 If it remains an alone character, we add to it a padding switch, for instance T_PUN. For sample encoding of word Super in high-level text mode please see Tabel 3. Table 3. Text Mode High-level Encoding Sample, word to encode: Super! S : 18, LOW : 27, u : 20, p : 15, e : 4, r : 17, SPACE : 26, T_PUN : 29,! : 10 that is 9 characters, it will be a T_PUN for the padding. CW0 = 18 * = 567 CW1 = 20 * = 615 CW2 = 4 * = 137 CW3 = 26 * = 809 CW4 = 10 * = 329 The sequence is consequently : 567, 615, 137, 809,
5 High-level encoding in byte mode structure is: If the byte number is a multiple of 6, it will be used the 924 CW to switch to "Byte" mode; if the byte number is not a multiple of 9, it will be used 901 CW for switching. The coding consists has to transform 6 bytes in base 256 to 5 CW in base 900. The conversion has several steps: - Take the bytes by group of 6; let X 5 to X 0 their decimal values. (X 0 is the less significant character) - Compute the sum S = X 5 * X 4 * X 3 * X 2 * X 1 * X 0 - Compute the CWs: CW0 = S MOD 900, new value of S : S = S DIV 900, CW1 = S MOD 900 and so forth to CW4 (CW0 is the less significant CW) - Bytes which remain after the conversion of the groups of 6 are taken just as they are: 1 byte = 1 CW of same value. In table 4 there is the word Super! encoded in byte mode: Table 4. Word Super! high-level encoded in byte mode Word: Super! The sequence of bytes (in ASCII) is: 83, 117, 112, 101, 114, 33 S = 83 * * * * * = S = = = CW0 = MOD 900 = 485 S = DIV 900 = CW1 = MOD 900 = 439 S = DIV 900 = CW4 = 139 MOD 900 = 139 The sequence including the switch (CW with value 924) is consequently for word Super! : 924, 139, 776, 318, 439, 485 No matter what kind of high-level engoding has been done (text/byte/numeric mode), Left Side CW and Right Side CW are computed according to the table used for the actual row. To obtain the CW value, make the following calculation (where / is DIV integers division): (Row Number / 3) * 30 + X with X taken in the following table: (Firts row is row number 0) Table 5. Tables formula used to encode Table used to encode the CWs of this row For the left side CW (Rows No -1) / 3 (Security level * 3) + (Rows No- 1) MOD 3 Data columns No - 1 For the right side CW Data columns No - 1 (Rows No -1) / 3 (Security level * 3) + (Rows No - 1) MOD 3 Low-level encoding general structure is (no matter if in high-level encoding is done in byte/text/numeric mode): Each CW is made of 17 modules, containing 4 bars and 4 spaces (Name code comes from there!) and it start by a bar. Bars and spaces width is 1 to 6 modules. (Except for start and stop characters) Sample for CW = : CW2 = MOD 900 = 318 S = DIV 900 = CW3 = MOD 900 = 776 S = DIV 900 = Start character is:
6 Journal of Mobile, Embedded and Distributed Systems, vol. III, no. 3, 2011 ISSN Stop character is: (Here there is a 5th bar, thus 18 modules.) There are 3 distinct tables for encoding the 929 codewords. Each row uses only one encoding table, this table will be used again 3 rows further. Sample: Row 1 -> table 1, row 2 -> table 2, row 3 -> table 3, row 4 -> table 1,..., etc. There is the formula: table number = ( ( row number MOD 3 ) * 3 ) The 3 tables giving the patterns for the 929 codewords start like this (all 929 codewords are distributed in unique manner into 3 tables, e.g. CW = can be found only in 3 rd table first position Table 6): Figure 1. PDF 417 for word Super! at byte level within 2 columns. 147
7 Table 8. Correction System Level Number of CWs required by the correction system, 2 of which for the detection ( 2 level + 1 ) Maximum number of data CWs The correction codes are computed based on Reed-Solomon codes. The general error correction and detection procedure is: Error detection system use 2 CWs and correction system use some between 2 and 510. The number of CWs to add depend of the correction level used, because of the limit to 928 CWs in a bar code (1 of which for the sum of CWs) the maximum level is limited by the number of data CWs. The number of CWs that the error correction algorithm 148
8 Journal of Mobile, Embedded and Distributed Systems, vol. III, no. 3, 2011 ISSN can reconstitute is equal to the number of CWs required by the correction system. The recommended correction level depends on the number of data CWs: Table 9. Recommended correction level Number of data CWs Recommended correction level 1 up to up to up to up to Reed Solomon codes are based on a polynomial equation where x power is 2 s+1 with s = error correction level used. For instance with the correction level 1 it should be used an equation like this: a + b*x + c*x 2 + d*x 3 + x 4. The numbers a, b, c and d are the factors of the polynomial equation. The factors look like: Table 10. Factors of polynomial equation Factor (coefficients) table for level Factor (coefficients) table for level Factor (coefficients) table for level Factor (coefficients) table for level Factor (coefficients) table for level Let s the correction level used, k = 2 s+1 the number of correction CWs, a is the factors/coefficients array, m the number of data CWs, d the data CWs array and c the correction CWs array. There is a temporary variable t. c and t are inited with 0. The C/C++/Java source code is: Table 11. Computing Correction CWs array for(int i = 0; < m; i++) { t = (d[i] + c[k - 1]) % 929; for(int j = k - 1; j == 0; j--) { if( j == 0 ) { c[j] = (929 - (t * a[j]) % 929) % 929; } else { c[j] = (c[j - 1] (t * a[j]) % 929) % 929; } } } for(int j = 0; j < k; j++) if( c[j]!= 0) c[j] = c[j]; After this, the one can apply the "recipe" by using the obtained codes in the reverse order (From last to first). 4. DNA2DBC DeoxyriboNucleic Acid Two Dimensional Barcode In this section we present a solution for coding DNA into 2D barcode DNA Coding Any genetic information (species, hair colour, number of limbs etc) is encoded as DNA (Deoxyribonucleic acid). DNA is represented through symbols nitrogenous bases or nucleotides. All these symbols form the genetic alphabet: A, T, G, C. Three associated symbols form code words: the codons. The sequence of several code words describes logical sentences: proteins (peptides and polypeptides). These sentences are combined to convey a message a trait. DNA therefore contains all information in a living organism. RNA (Ribonucleic Acid) is very similar to DNA. DNA's nitrogenous base timine(t) is replaced with uracil (U) Barcode DNA DNA information is nowadays obtained through sequencing process. That 149
9 determines DNA from a tissue sample (blood, hair etc). The result of a sequencing operation is a given in text format, and in graphical form, but DNA sequences is mainly stored as text files, for portability. A DNA Sequencer can read more than 2 million nucleotides in 24 hours. Although there can be read fragments of up to nucleotides, modern sequencers are able to operate with several sequences simultaneously, which significantly raises their capacity and productivity. In 2003 Paul Hebert suggested using bar coding techniques for organization of species. The barcode assigned is based on the CO1 gene.[6] The initiative was contested by various religious groups. However, the idea of representing DNA with barcodes was born and nowadays it finds justification in the latter 2D barcode representation. Being able to encode a lot of information in a small space, 2D barcodes are a great solution in bringing the hundreds/thousands DNA symbols closer to their users. It will be enough to read a 5 cm square shape from a piece of paper to have DNA data otherwise occupying half of page or registered in a Database among other million records. These shapes instead, can be placed on medical files, laboratory recipients, taking little space a giving large info in the shortest time Barcode Encoding Scheme This section presents a solution for DNA encoding/decoding as two dimensional barcode - 2D matrix. The DNA string will be translated into 3 bit code words (CW), according to proprietary simbology. The result code will then be added a checksum for error detection. Correction CWs will be further added, making possible to recover lost DNA data. Data can be lost in the printing process or by physical damaging of the printed code (scratching, staining etc.), that makes the code symbols not fully readable. Further on, the 3bits CWs will be split into rows, matrix positioning patterns will be added and the resulting matrix will be converted into one binary string. This string is printable as 2D barcode with individual drawing of each bar using a graphical interface, or with custom fonts using a text editor. The decoding process is the reverse of the one described above: a graphical symbol will be translated into binary string based on bars and spaces, and the process continues, the string developing into a DNA sequence. The following sections will refer only to the encoding process, since decoding means applying the algorithm in reverse. Figure 2. DNA to 2D barcode logical chart flow 4.4. Input and Output The algorithm will have as input a DNA string. The main purpose is to translate this sequence into a string printable as bar code symbols. A DNA string is basically a string of only four possible symbols (A, C, G, T/U). But in practice, DNA sequence rarely comes alone, but having some explaining data 150
10 Journal of Mobile, Embedded and Distributed Systems, vol. III, no. 3, 2011 ISSN (metadata) about sequence origin, method used to identify it etc. Therefore the DNA input comes in two types of data: text and real DNA, as observed in a sample of DNA FASTA file in table 12: Table 12. DNA FASTA file >AB acc=ab descr=homo sapiens mrna for prepro cortistatin like peptide, complete cds. len=368 ACAAGATGCCATTGTCCCCCGGCCTCC TGCTGCTGCTGCTCTCCGGGGCCACGG CCACCGCTGCCCTGCCCCTGGAGGGTG GCCCCACCGGCCGAGACAGCGAGCATA TGCAGGAAGCGGCAGGAATAAGGAAAA GCAGCCTCCTGACTTTCCTCGCTTGGT GGTTTGAGTGGACCTCCCAGGCCAGTG CCGGGCCCCTCATAGGAGAGGAAGCTC GGGAGGTGGCCAGGCGGCAGGAAGGC GCACCCCCCCAGCAATCCGCGCGCCGG GACAGAATGCCCTGCAGGAACTTCTTC TGGAAGACCTTCTCCTCCTGCAAATAAA ACCTCACCCATGAATGCTCACGCAAGTT TAATTACAGACCTGAA The output of the algorithm is a binary string with NxN elements, N being the dimension of the 2D barcode matrix. Using a graphical interface, the binary string can be transformed into a printable image. Each 1 value in the string will become a dot/square, while 0s will remain blank spaces. The resulting image will be squared form, with a continuous border on the left and down sides of the square and with dotted borders on the right and upper sides. The two continuous lines will be used in matrix positioning when reading the symbol Code Symbology We agreed that two types of data will be encoded with this symbology. We will refer to these two types as DNA and Text mode and we will discuss representation for each of them. One important observation is that CWs for switching between the two modes will be needed. DNA mode DNA symbols are in number of four, plus one changed symbol for RNA. That is a total of 5 symbols, easily representable on 3 bits. One extra symbol is needed for switching to text mode. For switching to DNA mode is using DEL symbol. Two CWs remain unassociated for future use: Table 13. DNA Symbols Encoding Symbol Coding RFU Reserved 000 for Future use A 001 C 010 G 011 T 100 U 101 Switch to text 110 mode RFU 111 Text mode Text characters are encoded using ASCII standard. Although the DNA metadata only uses printable characters, we will use all the 256 symbols of the ASCII code in case we need regional languages characters and for character (ASCII 179) used by some type of DNA file. The last of the 256 symbols, the one with binary representation , will act as switch to DNA mode symbol. But the 256 symbols of the ASCII code are representable on 8 bits. However, DNA metadata is reduced in length compared to the DNA data (100 text characters compared to minimum 400 DNA symbols). Therefore we will use the 3bits representation for both DNA & Text mode, with groups of 3 text characters being encoded over 8 * 3 bits. Total number of text will be filled with spaces until reaching a number multiple of 3. In conclusion, we can consider a CW being 3bits in length. A number of 400 DNA symbols will be encoded in 400 CWs on 3bits. That is 1200bits or 150Bytes. 100 text symbols will be encoded in 100 * 8 / 3 CWs, on 800 bits or 100Bytes. More important, 1bit is represended on a bar code symbol of 1,5-1,7 mm/character. 2000bits will therefore ocupy a square of 5/5 cm, far less than the size of tha DNA sample file in Table 12, AND with a lot advantages in terms in Automatic Data Capture/ Acquisitions. 151
11 Error Detection The first four CW in the matrix contain a length descriptor value, made by the number of useful information CWs. That is the number of CWs coding DNA data, added the number or correction CWs (2*k + 1, k being the correction level please see section 4.9 Reed Solomon corrections) and the number of error detecting CWs (one CW for length descriptor). The length descriptor can take a maximum value of 2^12 = 4096 data CWs Row Structure All CWs must be splitted into lines to form a matrix. In order to do this, one must know the number of rows and column in a matrix. Since we plan to obtain a square shaped symbol, we will use a square matrix structure. Therefore it is sufficed to calculate one single dimension of the matrix Ncol as the closest integer larger than square root of total number of CWs: Ncol = Round(Trunc(sqrt(CW[0]))) 4.8. Padding Datas CWs are completed with padding CWs, non-information CWs, until being ncol*ncol in number, therefore creating all the elements of a square matrix. Padding CWs will be 000 in value Corrections: Reed-Solomon The correction system is based on "Reed Solomon" codes as in PDF417 2D barcode section 3 of this paper. The number of CWs to add depend of the correction level used, because of total number of CWs in a bar code (1 of which for the sum of CWs) the maximum level is limited by the number of data CWs. The number of CWs that the error correction algorithm can reconstitute is equal to the number of CWs required by the correction system. Table 8 and 9 are used for correction mechanism. Table 11 from PDF417 is replaced with Table 14: Table 14. Computing Correction CWs array for DNA Encoding Let s the correction level used, k = 2 s+1 the number of correction CWs, a is the factors/coefficients array, m the number of data CWs, d the data CWs array and c the correction CWs array. There is a temporaryvariable t. c and t are initiated with 0. The C/C++/Java source code is: for(int i = 0; < m; i++) { t = (d[i] + c[k - 1]) % 8; for(int j = k - 1; j == 0; j--) { if( j == 0 ) { c[j] = (8 - (t * a[j]) % 8) % 8; } else { c[j] = (c[j - 1] (t * a[j]) % 8) % 8; } } } for(int j = 0; j < k; j++) if( c[j]!= 0) c[j] = 8 - c[j]; Margins and Final Transformation The final transformation of CWs consists of translating all of them into one binary string, while adding the margins that will help to position the square form. The margins are added as 1 values for continuous line and alternating 1 and 0 for dotted lines, with careful calculation of the exact position of the border values in the binary string: position 0 to ncol+1 for drawing the upper dotted line (so alternating 1 and 0 values) position i*ncol+2 for the left continuous line, where i goes from 1 to ncol ( 1 values) position (i+1)*(ncol+2)-1 for the right dotted line, where i goes from 1 to ncol position (ncol+1)*(ncol+2) to (ncol+2) 2-1 for the bottom continuous line One sample of DNA sequence generated through the presented method is shown in 152
12 Journal of Mobile, Embedded and Distributed Systems, vol. III, no. 3, 2011 ISSN Fig. 3. The symbol contains the first part of the DNA sequence coding insulin in humans: Table 15. DNA sample > insulin homo sapiens TACAAACATTTAGTTGTAAACACACCCTC AGTGGACCAACTCCGCAACATAAACCAA ACACCGCTCGCGCCGAAAAAGATATGG GGGTTTTGG 36 trillion characters depending on the type of barcode used. Save Space. 2D codes have the ability to encode a lot of information in a small space added to all the above advantages. Cut Costs. Barcodes are effective tools that can save time and reduce errors, therefore resulting in a reduction of costs. Parts of this research have been published in the Proceedings of the 3 rd International Conference on Security for Information Technology and Communications, SECITC 2010 Conference (printed version). Figure 3. DNA2DBC sample symbol 5. Conclusion There are several advantages for using 2D barcode in order to do DNA code embedded in our symbology: Improve Operational Efficiency. Since barcodes permit faster and more accurate recording of information, work in process can move quickly and be tracked precisely. Barcodes can respond more quickly to inquiries and changes. Save Time. Depending on the application, time savings can be significant. Instead of reading a code from a patient chart, type it in the computer and search it through the database, one simple symbol scan will take 2 seconds. Reduce Errors. Clerical errors can have a dramatic impact: wrong diagnostics, unhappy and untreated patients, and time spent to track down problems are just a few examples. Accuracy is vital in genetic diagnosis or blood bank applications. The typical error rate for human data entry is 1 error per 300 characters. Barcode scanners are much more accurate; the error rate can be as good as 1 error in References [1] Harry E. Burke, Automating Management Information Systems: Barcode Engineering and Implementation, Thomson Learning Publishing House, ISBN [2] Roger C. Palmer, The Bar Code Book, Helmers Publishing, ISBN [3] DataMatrix 2D barcode standard ISO/IEC 16022:2006 [4] ormatique/codbar-en/pdf417 [5] [6] [7] QR 2D barcode standard ISO/IEC 18004:2006 [8] 153
Barcodes principle. Identification systems (IDFS) Department of Control and Telematics Faculty of Transportation Sciences, CTU in Prague
Barcodes principle Identification systems (IDFS) Department of Control and Telematics Faculty of Transportation Sciences, CTU in Prague Contents How does it work? Bulls eye code PostNet 1D Bar code 2D
BAR CODE 39 ELFRING FONTS INC.
ELFRING FONTS INC. BAR CODE 39 This package includes 18 versions of a bar code 39 font in scalable TrueType and PostScript formats, a Windows utility, Bar39.exe, that helps you make bar codes, and Visual
May 2001. Prepared: Product version: Keyword: Accelio Present Central 5.4. Original value:
: Page 1 : : ANSI/AIM BC2-1995, Uniform Symbology Specification - Interleaved 2 of 5 0 2 of 5 Industrial Interleaved 2 of 5 (also called I-2/5 and ITF) is suitable for encoding general purpose all-numeric
Barcode Based Automated Parking Management System
IJSRD - International Journal for Scientific Research & Development Vol. 2, Issue 03, 2014 ISSN (online): 2321-0613 Barcode Based Automated Parking Management System Parth Rajeshbhai Zalawadia 1 Jasmin
BARCODE PRINTING SET UP BARCODE PRINTING
21 BARCODE PRINTING The Barcode Printing option can be purchased for an additional cost. You will receive a floppy disk or CD that you can use to activate this feature. SET UP BARCODE PRINTING To start,
Barcode-ABC. For further information, please visit our website at www.gbo.com/bioscience or contact us: 4/2005
For further information, please visit our website at www.gbo.com/bioscience or contact us: Germany (Main office) Greiner Bio-One GmbH Maybachstraße 2 D-72636 Frickenhausen Phone: (+49) 70 22 9 48-0 Fax:
Customer Barcoding Technical Specifications
Customer Barcoding Technical Specifications June 1998 Contents Revised 3 Aug 2012 Introduction 2 Key features of the barcoding system 2 About this document 2 Why we are introducing Customer Barcoding 3
dlsoft Barcodes By dlsoft
dlsoft Barcodes By dlsoft This manual was produced using ComponentOne Doc-To-Help. Contents Barcodes 1 Introduction...1 1D Barcodes...1 Barcode types supported...2 Barcode Types Table...3 EAN...4 ISBN...6
QR Codes and Other Symbols Seen in Mobile Commerce
QR Codes and Other Symbols Seen in Mobile Commerce This section describes bar code symbols frequently encountered in mobile commerce campaigns. and typical applications for each are listed. One symbology,
Create!form Barcodes. User Guide
Create!form Barcodes User Guide Barcodes User Guide Version 6.3 Copyright Bottomline Technologies, Inc. 2008. All Rights Reserved Printed in the United States of America Information in this document is
ELFRING FONTS UPC BAR CODES
ELFRING FONTS UPC BAR CODES This package includes five UPC-A and five UPC-E bar code fonts in both TrueType and PostScript formats, a Windows utility, BarUPC, which helps you make bar codes, and Visual
CHAPTER I INTRODUCTION
CHAPTER I INTRODUCTION 1.1 Introduction Barcodes are machine readable symbols made of patterns and bars. Barcodes are used for automatic identification and usually are used in conjunction with databases.
The Barcode Printing option may be purchased for an additional cost. You will receive a CD that you will use to activate this feature.
27 BARCODE PRINTING Barcode Printing takes your museum to the next level of inventory control and tracking. Barcoding is a proven technology that can eliminate keyboard data entry errors. There are many
Laser Scanner Programming Guide (SE923 laser engine)
Laser Scanner Programming Guide (SE923 laser engine) CONTENT Technical note... 5 How to recognise the type of the laser barcode engine... 5 How to program the laser barcode reader into default value...
Let s talk symbology. A guide to decoding barcodes
Let s talk symbology A guide to decoding barcodes Symbology in barcodes Barcode technologies provide fast reliable data collection to ensure part or product traceability, error-proof assembly processes,
Frequently Asked Questions
Advanced Function Presentation Consortium Bar Code Object Content Architecture Frequently Asked AFPC-0011-02 Questions Implementation Tips for Producing Bar Codes with the Bar Code Object Content Architecturee
How To Write A Security Code Encodetion For A Subway Ticketing System On An Html5 On A Microsoft Computer (For Free) On A Pc Or Macbook Or Macintosh (For A Free Download) On An Ipa Computer
SECURE ARCHITECTURE FOR AUTOMATIC TICKETING SYSTEMS - ONLINE ENABLED Cristian TOMA 1 Lecturer, PhD, Department of Computer Science in Economics Academy of Economic Studies, Bucharest, Romania E-mail: [email protected],
An Implementation of a High Capacity 2D Barcode
An Implementation of a High Capacity 2D Barcode Puchong Subpratatsavee 1 and Pramote Kuacharoen 2 Department of Computer Science, Graduate School of Applied Statistics National Institute of Development
OmniPage Capture SDK s enhanced barcode recognition capabilities.
OmniPage Capture SDK s enhanced barcode recognition capabilities. Judit Lánczky, Principal Software Engineer Dr. István Marosi, Senior Project Lead Nuance Document Imaging Developers Conference 2013 2002-2013
Ian Hawdon Physics Page 1 of 20 Barcodes
Barcodes Page 1 of 20 Page 2 of 20 Contents: Synopsis: What is a barcode?: More about a Laser: Digital Data: Types of Barcode: Linear: U.P.C. (Universal Product Code): CODE 128: MSI: 2D Barcodes: Data
Xi2000 Series Configuration Guide
U.S. Default Settings Sequence Reset Scanner Xi2000 Series Configuration Guide Auto-Sense Mode ON UPC-A Convert to EAN-13 OFF UPC-E Lead Zero ON Save Changes POS-X, Inc. 2130 Grant St. Bellingham, WA 98225
Programming Reference Guide HP USB Barcode Scanner
Programming Reference Guide HP USB Barcode Scanner Document Part Number: 430944-002 August 2006 Print this document before setting up the HP USB Barcode Scanner. The document provides the programming bar
The process to convert a computer message into a bar code symbol is a fourstep
Bar Code Symbologies A bar code symbology is a system for representing data in the bars and spaces of a bar code. A bar code consists of a number of printed bars and intervening spaces. The width of the
Elliott NWSM Laser Form Technical Information
Introduction Elliott NWSM Laser Form Technical Information Elliott NWSM Laser Form supports form printing on blank paper with professional output. Elliott Business Software supports user definable form
Computer Peripherals
Computer Peripherals School of Computer Engineering Nanyang Technological University Singapore These notes are part of a 3rd year undergraduate course called "Computer Peripherals", taught at Nanyang Technological
OCR and 2D DataMatrix Specification for:
OCR and 2D DataMatrix Specification for: 2D Datamatrix Label Reader OCR & 2D Datamatrix Standard (Multi-read) Camera System Auto-Multi Reading Camera System Auto-Multi Reading Camera System (Hi-Res) Contents
BAR CODE 2 OF 5 INTERLEAVED
ELFRING FONTS INC BAR CODE 2 OF 5 INTERLEAVED This package includes 25 bar code 2 of 5 interleaved fonts in TrueType and PostScript formats, a Windows utility, Bar25i.exe, to help make your bar codes,
Identification of products that require activation at the Pointof-sale. www.gs1.eu The global language of business. in Europe
in Europe Identification of products that require activation at the Pointof-sale Technical specifications for GS1 DataBar Version 1.0, November 2014 www.gs1.eu The global language of business Contents
ELFRING FONTS INC. MICR FONTS FOR WINDOWS
ELFRING FONTS INC. MICR FONTS FOR WINDOWS This package contains ten MICR fonts (also known as E-13B) used to print the magnetic encoding lines on checks, and eight Secure Fonts for use in printing check
Understanding barcodes. www.brightpearl.com/ca101
Understanding barcodes This ebook gives an overview of product codes, barcodes, scanners and describes where barcode management could fit in your business. www.brightpearl.com/ca0 to Understanding barcodes
ELFRING FONTS BAR CODES EAN 8, EAN 13, & ISBN / BOOKLAND
ELFRING FONTS BAR CODES EAN 8, EAN 13, & ISBN / BOOKLAND This package includes ten EAN bar code fonts in scalable TrueType and PostScript formats, a Windows utility (BarEAN) to help you make bar codes,
eformz Mini-Manual Barcodes
eformz Mini-Manual Barcodes Minisoft eformz Version 10.0 Minisoft, Inc. Minisoft Marketing AG 1024 First Street Papiermühleweg 1 Snohomish, WA 98290 Postfach 107 U.S.A. Ch-6048 Horw Switzerland 1-800-682-0200
Technical Reference DYMO LabelWriter SE450 Label Printer
Technical Reference DYMO LabelWriter SE450 Label Printer Copyright 2010 Sanford, L.P. All rights reserved. Revised 7/26/2010. No part of this document or the software may be reproduced or transmitted in
Back to Basics: Introduction to Industrial Barcode Reading
Back to Basics: Introduction to Industrial Barcode Reading 1 Agenda What is a barcode? History 1 D codes Types and terminology 2 D codes Types and terminology Marking Methods Laser Scanning Image Based
Bar Code Printing Guide
Bar Code Printing Guide Please read this guide before operating this equipment. After you finish reading this guide, store it in a safe place for future reference. ENG Bar Code Printing Guide How This
INTERNATIONAL STANDARD
INTERNATIONAL STANDARD ISO/IEC 18004 First edition 2000-06-15 Information technology Automatic identification and data capture techniques Bar code symbology QR Code Technologies de l'information Techniques
FLEETMATE. Overview. Barcode Scanner. CUSTOMER GUIDE: Barcode Features
Overview FLEETMATE supports a variety of linear barcode symbologies. The box to the left provides a list of barcode symbol sets that are supported within the FLEETMATE software. You do not need to use
How To Fix Out Of Focus And Blur Images With A Dynamic Template Matching Algorithm
IJSTE - International Journal of Science Technology & Engineering Volume 1 Issue 10 April 2015 ISSN (online): 2349-784X Image Estimation Algorithm for Out of Focus and Blur Images to Retrieve the Barcode
The ID Technology. Introduction to GS1 Barcodes
The ID Technology Introduction to GS1 Barcodes Contents GS1 - The Basics 2 Starting Point - GTIN 3 GTIN Labels for Cases - ITF-14 5 Adding More Data - GS1 128 6 GS1 Application Identifiers 7 Logistics
BARCODE READER V 2.1 EN USER MANUAL
BARCODE READER V 2.1 EN USER MANUAL INSTALLATION OF YOUR DEVICE PS-2 Connection RS-232 Connection (need 5Volts power supply) 1 INSTALLATION OF YOUR DEVICE USB Connection 2 USING THIS MANUAL TO SETUP YOUR
A Tutorial in Genetic Sequence Classification Tools and Techniques
A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University [email protected] www.jakemdrew.com Sequence Characters IUPAC nucleotide
A brief guide to... Barcode Printing
A brief guide to... Barcode Printing So You Need to Print Barcodes? A Brief Guide to Barcode Printing What is Barcoding? Barcoding is an automatic identification technology with many applications. The
Elfring Fonts LaserJet Bar Codes & More
Elfring Fonts LaserJet Bar Codes & More This package contains five separate types of bar code fonts, and two OCR fonts. These PCL bar code fonts can not be used unless you understand how each bar code
http://barcoderesource.com/datamatrixbarcode.shtml
2D Barcode Fonts http://barcoderesource.com/datamatrixbarcode.shtml Copyright (c) 2009-2013, ConnectCode All Rights Reserved. ConnectCode accepts no responsibility for any adverse affect that may result
A Brief History of Barcode Verification
McKechnie Firstly, What is a bar code? Firstly, What is a bar code? A Series of black bars on an item? By definition, a bar code is a machine-readable representation of information (usually in dark ink
Enhanced Bar Code Engine
Enhanced Bar Code Engine Introduction Access to the Kofax Standard bar code recognition engine is provided through ImageControls-based applications and ISIS-based applications. In addition to the standard
T GG GG P IT RO Q U Q I C I K K S T S A A T R T G U D
TAGGIT PRO Q U I C K S T A R T G U I D E Table of Contents Security Key Installation... 1 System Requirements / Installing... 2 Installing a Printer... 3 Creating Tags and Labels... 5 Opening Tag and Label
ZIMBABWE SCHOOL EXAMINATIONS COUNCIL. COMPUTER STUDIES 7014/01 PAPER 1 Multiple Choice SPECIMEN PAPER
ZIMBABWE SCHOOL EXAMINATIONS COUNCIL General Certificate of Education Ordinary Level COMPUTER STUDIES 7014/01 PAPER 1 Multiple Choice SPECIMEN PAPER Candidates answer on the question paper Additional materials:
Bar Codes. A Primer for Document Management
For Starters Part of egistics CloudDocs For Starters Series Bar Codes A Primer for Document Management Randy Davis, Vice President Sales & Marketing Operations egistics 17304 Preston Rd, Suite 550, Dallas,
How To Use A Kosso Code Solution
Samsung Barcode Solution Easy, efficient workflow for productive document environments Fast, easy tracking of movable items Streamline document workflow management with an easy, cost-effective barcode
Wasp Labeler User Manual
Copyright 2012 Wasp Barcode Technologies 1400 10 th St. Plano, TX 75074 All Rights Reserved STATEMENTS IN THIS DOCUMENT REGARDING THIRD PARTY PRODUCTS OR SERVICES ARE BASED ON INFORMATION MADE AVAILABLE
Elfring Fonts, Inc. PCL MICR Fonts
Elfring Fonts, Inc. PCL MICR Fonts This package contains five MICR fonts (also known as E-13B), to print magnetic encoding on checks, and six Secure Number fonts, to print check amounts. These fonts come
2 Advanced Scanner Configuration Guide
2 Advanced Scanner Configuration Guide Table of contents Introduction...4 Operational Parameters...4 Set Default Parameter...7 Default Parameters...7 Beeper Volume...7 Beeper Tone...8 Beeper Frequency
Data Storage. Chapter 3. Objectives. 3-1 Data Types. Data Inside the Computer. After studying this chapter, students should be able to:
Chapter 3 Data Storage Objectives After studying this chapter, students should be able to: List five different data types used in a computer. Describe how integers are stored in a computer. Describe how
All V7 registers support barcode printing, except the Sharp 410/420 1A ROM and that limitation is based upon the register.
Tools Section Barcode Printing These are basic instructions for Version 7 Polling barcode printing. Users will need to have a PLU/UPC file containing either UPC-A, UPC-E, EAN 13 or EAN 8 numbers, label
ELECTRONIC DOCUMENT IMAGING
AIIM: Association for Information and Image Management. Trade association and professional society for the micrographics, optical disk and electronic image management markets. Algorithm: Prescribed set
Laser Barcode Scanner
Laser Barcode Scanner User s Manual FCC Compliance This equipment has been tested and found to comply with the limits for a Class A digital device, pursuant to Part 15 of the FCC Rules. These limits are
About Data Matrix Symbology
About Data Matrix Symbology Developed in 1989 by I.D. Matrix (now CI Matrix) Historically read using expensive, complicated, modified vision systems (hindering its adoption) AIMI specification released
Cyber Security Workshop Encryption Reference Manual
Cyber Security Workshop Encryption Reference Manual May 2015 Basic Concepts in Encoding and Encryption Binary Encoding Examples Encryption Cipher Examples 1 P a g e Encoding Concepts Binary Encoding Basics
Contents. Bar code data transmission specifications...b-1. A-61099 October 1997 i
Contents Bar Code Made Easy 1 What is a bar code?.......................................... 1 Which bar code type should I use?............................... 2 How are bar codes read?.......................................
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
The Use and Standardization of Barcodes in Railroad Wheel and Wheelset Manufacturing. Tim Epperson
The Use and Standardization of Barcodes in Railroad Wheel and Wheelset Manufacturing Tim Epperson ARKANSAS INDUSTRIAL COMPUTING WheelShopAutomation.com 877-834-9540 Benefits of Barcoding Speed Data entry
Selecting the Correct Automatic Identification & Data Collection Technologies for your Retail Distribution Center Application
Selecting the Correct Automatic Identification & Data Collection Technologies for your Retail Distribution Center Application Have camera/image-based code readers replaced traditional laser scanners? Has
Wireless Laser Barcode Scanner ils 6300BU. User s Manual
Wireless Laser Barcode Scanner ils 6300BU User s Manual FCC Compliance This equipment has been tested and found to comply with the limits for a Class A digital device, pursuant to Part 15 of the FCC Rules.
GS1 QR Code. GS1 US Guideline
QR Code US Guideline June 2012 V1.2 9 May 2012, Issue #1 All contents copyright 2009 Page 1 of 15 Document Summary Document Item Current Value Document Title QR CODE Date Last Modified 14 May 2012 Current
plc numbers - 13.1 Encoded values; BCD and ASCII Error detection; parity, gray code and checksums
plc numbers - 3. Topics: Number bases; binary, octal, decimal, hexadecimal Binary calculations; s compliments, addition, subtraction and Boolean operations Encoded values; BCD and ASCII Error detection;
FreeForm Designer. Phone: +972-9-8309999 Fax: +972-9-8309998 POB 8792, Natanya, 42505 Israel www.autofont.com. Document2
FreeForm Designer FreeForm Designer enables designing smart forms based on industry-standard MS Word editing features. FreeForm Designer does not require any knowledge of or training in programming languages
white paper JANUARY 2011 The Next- Warehouse Scanning and the Emergence of 2D Bar Codes
JANUARY 2011 The Next- Generation Warehouse Long Range Scanning and the Emergence of 2D Bar Codes Table of Contents Introduction...3 Bar coding basics...4 Bar coding in the warehouse...4 Warehouse application
Register your product and get support at www.philips.com/dictation DPM8500. Barcode scanner configuration guide
Register your product and get support at www.philips.com/dictation DPM8500 Barcode scanner configuration guide Table of contents 1 Introduction 5 Operational Parameters 5 Parameter defaults 5 2 Set default
2D BARCODE STANDARD FOR LENSES (OPTICAL PRODUCT CODE/ COUNTRY OF ORIGIN)
2D BARCODE STANDARD FOR LENSES (OPTICAL PRODUCT CODE/ COUNTRY OF ORIGIN) VOLUNTARY GUIDELINES FOR OPTICAL LENSES September 2012 2012 The Vision Council Developed by: Lens Division of The Vision Council
A Brief Guide to Bar Code Printing
WHITE PAPER A Brief Guide to Bar Code Printing Introduction Bar coding is an automatic identification and data collection technology commonly referred to as Auto ID. The most visible and familiar bar codes
MetroSelect Programming Guide. MLPN 2407/December 1998
MetroSelect Programming Guide MLPN 2407/December 1998 Locations: USA Corporate Headquarters Europe Metrologic Instruments, Inc. Metrologic Instruments GmbH 90 Coles Road Dornierstrasse 2 Blackwood, NJ
SocketScan Software Advanced Programming Guide
SocketScan Software Advanced Programming Guide A guide to help you program symbology and parameter settings for the following Socket barcode scanning products: Secure Digital Scan Card Series 3 CompactFlash
Demonstration of Barcodes to QR Codes through Text Using Document Software
Demonstration of Barcodes to QR Codes through Text Using Document Software Dr. Neeraj Bhargava 1, Anchal kumawat 2, Dr. Ritu Bhargava 3 Associate Professor, Department of Computer Science, School of Engineering
Model No. CF-U1 Series
First-time Operation Supplementary Instructions for 2D Barcode Reader Personal Computer Model No. CF-U1 Series This Supplementary Instructions explains how to get started with a barcode reader and point
PrecisionID ITF (Interleaved 2 of 5) Barcode Font User Manual
PrecisionID ITF (Interleaved 2 of 5) Barcode Font User Manual Notice: When you use this product you agree to the End User License Agreement (EULA). The EULA is provided as a file in the package for this
Allen-Bradley. Bar Code. 2-D Hand-Held. Programming Guide. Bar Code. Scanners. (Cat. No. 2755-HTG-4)
Allen-Bradley 2-D Hand-Held Bar Code Scanners Bar Code Programming Guide (Cat. No. 2755-HTG-4) Important User Information The illustrations, charts, sample programs and layout examples shown in this guide
E-i. Section E. Code Formatting. E/D = Enable/Disable T/DNT = Transmit/Do Not Transmit EX/DNEX = Expand/Do Not Expand
Section E Code Formatting E/D = Enable/Disable T/DNT = Transmit/Do Not Transmit EX/DNEX = Expand/Do Not Expand C/DNC = Convert/Do Not Convert E/DNE = Enable/Do Not Enable T/DNT UPC-A Check Digit (E - 1)
LibraryWorld.com. Getting Started Guide
LibraryWorld.com Getting Started Guide Why LibraryWorld? Web-based No software to load No networking issues Updates are automatic Works with any web browser Full feature set at a very low price No backup
Understanding Optical Character Recognition
Understanding Optical Character Recognition Overview of OCR and Its Applications Understanding Optical Character Recognition Optical Character Recognition, commonly known as OCR, is distinct from linear
Barcode Scanner CLV62x CLV62x Bar Code Scanner
Online Help ONLINE HELP Bar Code Scanner Standard Line Software Versions Online Help Software/Tool Version Device description Device specific software module for configuration software SOPAS-ET V 2.0 SOPAS-ET
Matt Cabot Rory Taca QR CODES
Matt Cabot Rory Taca QR CODES QR codes were designed to assist in the manufacturing plants of the automotive industry. These easy to scan codes allowed for a rapid way to identify parts and made the entire
http://barcoderesource.com/pdf417barcode.shtml
2D Barcode Fonts http://barcoderesource.com/pdf417barcode.shtml Copyright (c) 2009-2013, ConnectCode All Rights Reserved. ConnectCode accepts no responsibility for any adverse affect that may result from
White paper. Guide to Scanning Technologies
White paper Guide to Scanning Technologies Introduction Scanning technology has been changing dramatically. Laser scan engines, once considered the workhorses for most scanning applications, have been
Layman's Guide to ANSI X3.182
Layman's Guide to ANSI X3.182 This Guideline was developed by AIM USA, an affiliate of AIM International, the world-wide trade association for manufacturers and providers of automatic data collection
Image Compression through DCT and Huffman Coding Technique
International Journal of Current Engineering and Technology E-ISSN 2277 4106, P-ISSN 2347 5161 2015 INPRESSCO, All Rights Reserved Available at http://inpressco.com/category/ijcet Research Article Rahul
DNA Sequence formats
DNA Sequence formats [Plain] [EMBL] [FASTA] [GCG] [GenBank] [IG] [IUPAC] [How Genomatix represents sequence annotation] Plain sequence format A sequence in plain format may contain only IUPAC characters
Crystal Reports. Overview. Contents. Adding barcodes to reports
Crystal Repts Adding barcodes to repts Overview Contents This document provides an overview of barcodes, how barcodes wk in the Crystal Repts Designer, and examples of the barcode font types. This document
Barcode Scanner CLV640 CLV640 Bar Code Scanner
Online Help ONLINE HELP Bar Code Scanner Advanced Line Software Versions Online Help Software/Tool Version Device description Device specific software module for configuration software SOPAS-ET V 3.0 SOPAS-ET
Encoding Text with a Small Alphabet
Chapter 2 Encoding Text with a Small Alphabet Given the nature of the Internet, we can break the process of understanding how information is transmitted into two components. First, we have to figure out
Barcode Definitions. Labels: Getting Started. Overview. Defining a barcode definition
1 Labels: Getting Started Barcode Definitions Overview Barcode definitions contain information for different types of barcodes. You may skip this document if you are not printing barcodes, or if you are
All you need to know to leverage barcodes. in your apps
All you need to know to leverage barcodes in your apps Oliver Drobnik apple ios Development & Consulting @cocoanetics cocoanetics.com Full-time ios developer and blogger since January 2010 44% off all
White Paper Barcoding
White Paper Barcoding White Paper Barcoding What is a barcode?... 1 The benefits... 1 Barcoding and simpro Enterprise... 3 Managing stock... 3 Asset management... 4 Optimised stocktake and stock transfer...
3/08 Rev. 4.04-01 EASY PLUG MANUAL All Devices. Bar Code Information
3/08 Rev. 4.04-01 EASY PLUG MANUAL Bar Code Information Commonly used bar codes... 2 Code 2/5 Interleaved... 2 EAN 8 / EAN 13... 2 Code 39... 3 Code 93... 4 Code 128... 4 UPC... 5 EAN 128... 5 Codabar...
