Conserved primers for DNA barcoding historical and modern samples from New Zealand and Antarctic Birds
|
|
|
- Rose Harrington
- 10 years ago
- Views:
Transcription
1 Molecular Ecology Resources BARCODING Conserved primers for DNA barcoding historical and modern samples from New Zealand and Antarctic Birds SELINA PATEL*, JOHN WAUGH, CRAIG D MILLAR* and DAVID M LAMBERT *Allan Wilson Centre for Molecular Ecology and Evolution, University of Auckland, Private Bag 92019, Auckland, New Zealand, Allan Wilson Centre for Molecular Ecology and Evolution, Massey University, Private Bag NSMC, Auckland, New Zealand. Griffith School of Environment and School of Biomolecular and Physical Sciences, Griffith University, 170 Kessels Road, Qld 4111, Australia Abstract Our ability to DNA barcode the birds of the world is based on the effective amplification and sequencing of a 648 base pair (bp) region of the mitochondrial cytochrome c oxidase (COI or cox1) gene. For many geographic regions the large numbers of vouchered specimens necessary for the construction of a DNA barcoding database have already been collected and are available in museums and other institutions. However, many of these specimens are old (>20 years) and are stored as either fixed study skins or dried skeletons. DNA extracted from such historical samples is typically degraded and, generally, only short DNA fragments can be recovered from such specimens making the recovery of the barcoding region as a single fragment difficult. We report two sets of conserved primers that allow the amplification of the entire DNA barcoding region in either three or five overlapping fragments. These primer sets allow the recovery of DNA barcodes from valuable historical specimens that in many cases are unique in that they are unable or unlikely to be collected again. We also report three new primers that in combination allow the effective amplification from modern samples of the entire DNA barcoding region as a single DNA fragment for 17 orders of Southern Hemisphere birds. Corresponding author: D. M. Lambert, Fax [email protected]
2 Keywords: DNA barcoding, COI, cox1, avian primers, 5 -tags, species identification Received XX February; revision accepted XX Introduction At the heart of DNA barcoding is the proposition that individuals can be rapidly and easily assigned to the species level using standardised DNA sequences from the mitochondrial genome (Hebert et al. 2003a; Hebert et al. 2003b). A considerable body of research has been carried out that provides support for this proposition and there is currently intense international interest in this area of research. Furthermore, it has been suggested that the DNA barcoding approach, if successful, will complement modern taxonomy while at the same time revolutionising the way we routinely identify species in the future (Hajibabaei et al. 2007). The World s avian fauna has been identified as a good candidate to test the general applicability of DNA barcoding because birds have been extensively studied using a range of approaches including morphology, genetics and behaviour. This has resulted in a stable and mature taxonomy (Baker et al. 2009; Gill 2007). However, to date, the majority of DNA barcoding studies on birds have been conducted using modern samples from Northern Hemisphere species (Hebert et al. 2004; Kerr et al. 2007; Yoo et al. 2006). It remains to be seen whether DNA barcoding will accurately identify species from non-continental regions where biogeographic patterns, mutation and speciation rates may have been quite different (Moritz & Cicero 2004). New Zealand and the Antarctic have a distinctive avian fauna of moderate size (comprising of approximately 290 native or indigenous species) with a high level of endemism (Heather & Robertson 2005). In order to establish a DNA barcode database of these birds it is necessary to have access to a large number of vouchered museum specimens and to effectively amplify and sequence the DNA barcoding region from samples obtained from these specimens. A 648bp region at the 5' end of the mitochondrial gene cytochrome c oxidase subunit 1 (COI or cox1) has been identified as the DNA barcoding region for most animal species, including birds (Hebert et al. 2003a; Hebert et al. 2004). Two types of samples are available from vouchered museum specimens, fresh or modern tissue (blood, feather or muscle that has been 2
3 preserved at low temperatures or in ethanol) and historical specimens (usually study skins or skeletons). Although many museums now collect and preserve samples from vouchered specimens for biochemical and DNA analysis (Arctander & Fjeldsa 1994; Seutin & Boag 1991), this is a relatively recent practice. As a result, there are only a relatively small number of modern tissue samples available from vouchered specimens for New Zealand and Antarctic birds and this is likely to be the case for many regions worldwide. Furthermore, the collection of new or additional vouchered specimens is in many cases difficult, expensive and time consuming. The vast majority of historical specimens are older than 20 years in age and have not been preserved with DNA analyses in mind. Samples from these specimens typically produce highly degraded DNA (Lindahl 1993). The size of the DNA fragments recovered from historical samples depends on the preservation method, sample age and a number of environmental factors (Hofreiter et al. 2001). The degraded nature of the recovered DNA from historical samples makes it difficult to amplify a fragment larger than bp in length as well as resulting in low rates of amplification (Zimmermann et al. 2008). There are a number of approaches used to tackle the problem of generating barcodes from historical museum specimens. Short or minimalist barcodes have been recovered by amplifying only a selected bp fragment of the originally proposed ~650bp COI region. In a number of insect genera mini-barcodes have proved to be successful in identifying almost all species (Hajibabaei et al. 2006). However, mini-barcodes show limited success compared with the full-length barcode and only work within confined taxonomic groups (Hajibabaei et al. 2006). Although potentially useful for the identification of individual samples, this approach does not resolve the issue of having to construct an initial full-length database from which to make these identifications. Furthermore, whether it can be applied to avian species is yet to be determined. Another approach is to use a range of DNA repair enzymes. These enzymes can increase the amplification success rate by repairing some of the damage that is induced in DNA as a result of chemical treatment or aging. The most common types of DNA damage to historical and ancient DNA are oxidative and hydrolytic damage (Hoss et al. 1996). Deamination, a type of hydrolytic damage common to cytosine residues, results in the replacement of cytosine with uracil, ending in C to T and G to A transitions during PCR (Evans 2007). Treatment with DNA repair enzymes can result in the reversal of most types of DNA damage leading to higher amplification success rates (Evans 2007). However, this approach has a number of 3
4 shortcomings specifically its inability to repair fragmented DNA and its high cost when processing large numbers of specimens. The ability to recover DNA sequences from historical samples is in part dependent on the size of the PCR product targeted, generally the smaller the amplicon size the higher the rate of amplification success. Therefore, for any section of DNA, complete sequences can be recovered from historical samples by targeting a number of smaller overlapping regions. Once obtained, these overlapping fragments can be assembled and this approach has been used very successfully in the study of ancient DNA (Millar et al. 2008). Hence, the ability to DNA barcode the birds of the World will be facilitated by the availability of a set of conserved primers that will allow the amplification of the COI barcoding region from historical samples. We report the development of two sets of PCR primers that reliably amplify from historical samples the COI barcoding region in three or five short segments. In addition, one of these primers, in combination with two others, also allows the effective amplification of the entire COI barcoding region as a single fragment from modern samples from 17 orders of Southern Hemisphere birds tested. Materials and Methods Primer Design Primers for the amplification of historical and modern tissue were designed based on an alignment (using the Clustal X algorithm) of sequences obtained from New Zealand and Antarctic avian species in addition to a number of COI sequences available on GenBank (accession numbers available in supplementary data Table S1). Highly conserved regions were targeted as areas of interest for the synthesis of potential primers. Primer integrity was checked using Amplify 3X, available from and NetPrimer available on the PREMIER biosoft International website 4
5 Two sets of internal primers (Table 1) were designed to span the 648bp COI region for historical samples considered to have low quality DNA. The first primer set contained three primer pairs resulting in three overlapping fragments (average length ~310bp; Fig. 1). The second primer set contained five primer pairs resulting in five shorter overlapping fragments (average length ~ 190bp; Fig 1) to span the same 648bp region. Each internal primer contained a randomly generated 18bp tag attached to its 5 end in order to improve the sequencing of the resulting PCR products. Forward internal primers all contained an identical Ftag sequence and similarly all reverse internal primers contained an identical Rtag sequence. Internal primer pairs were tested on a range of modern samples represented from 15 avian orders prior to being used to amplify DNA from historical samples. Three primers, one forward and two reverse were designed to amplify the entire 648bp COI region as a single fragment to be used for modern specimens. The forward primer, AWCF1 was also used as part of the primer set for historical samples. Primer pairs intended for modern specimens did not contain the 18bp tags. All primer sequences and their expected fragment lengths are shown in Table 1. DNA Extraction from historical and modern samples Historical specimens in the form of dried skins used for this study were obtained from Canterbury Museum (Christchurch, New Zealand). Until 1970 all specimens were preserved with arsenical soap. After this date the preservative used was changed to borax. Both methods are commonly used in museums worldwide. Preparation did not involve any special preservation on the legs and toe pads however. These were allowed to dry out naturally (P Scofield 2009, pers. comm. 6 April,). All samples were collected from the foot and toe region of the specimens. Between 5 and 64mg of tissue was used per extraction and all tissue was macerated with a sterile scalpel blade prior to extraction. DNA isolation from dried skins was performed using proteinase K/DTT/SDS digestion followed by a DNeasy tissue extraction kit for the post-lysis steps according to the manufacturer s instructions (Qiagen). Negative controls were included for each set of extractions. No more than five samples were extracted per set. All pre-pcr steps were carried out in a separate laboratory solely dedicated to ancient DNA work. DNA from modern samples (fresh tissue) was extracted in a different laboratory using a standard 5
6 proteinase K digestion and a modified version of the phenol/chloroform method (Lawrence et al. 2008; Sambrook et al. 1989). PCR amplification and Sequencing PCRs were run in 25µl volume reactions and included 1X PCR buffer (Invitrogen), 2.5mM MgCl 2, 1mg/ml BSA, 0.5µM forward and reverse primers, 4% DMSO (only for 5 -tagged primers), 0.2mM dntps, 1U of Platinum Taq DNA polymerase (Invitrogen) and 3-4µl of DNA template from the final elution for historical samples and 25-50ng of DNA for modern samples. The thermal cycling conditions for historical samples was as follows: 2 min at 94 o C followed by 10 cycles of 20s at 94 o C, 20s at 55 o C and 20s at 72 o C followed in turn by 30 cycles of 20s at 94 o C, 20s at 50 o C and 20s at 72 o C and a final 4 min at 72 o C. In the case of modern samples the thermal cycling conditions were altered and consisted of 2 min at 94 o C followed by 35 cycles of 30s at 94 o C, 30s at 57.5 o C and 30s at 72 o C and a final 4 min at 72 o C. PCR products were visualized on a 2% agarose gel. The remaining volume of PCR products were purified using the Agencourt AMPure PCR Purification system (Beckman Coulter). All purified PCR products were then cycle sequenced using Big Dye 3.1 chemistry and subsequently analysed on an ABI Prism 3130xl genetic analyzer. Sequencing was carried out bidirectionally to produce an overlap of at least 648bp of the COI region for all modern samples. In the case of the historical samples, three or five overlapping fragments were amplified which covered the same COI region. In each case, these fragments were bidirectionally sequenced from independent PCR reactions. Once the fragments were sequenced, the complete DNA barcode for each historical sample was assembled by concatenating sequences using the software programmes Sequencher 4.6 (Gene Codes Corporation) and Vector NTI (Invitrogen). Only those sequences which reached PHRED scores of 20 or above for at least 90% of individual bases were deemed acceptable. Results We designed and tested two sets of 5 -tagged PCR primers that reliably amplified short DNA fragments from historical samples for the barcoding region. The first set of primers containing three primer pairs generated three fragments approximately 310bp in size whereas the second set containing five primer pairs generated shorter fragments of approximately 6
7 190bp in size. Both primer sets were first tested on a range of modern samples with representative species from 15 different orders (Table 2) prior to be being used on historical specimens. Of a total of 29 species, both primer sets worked on all species tested. Twenty seven historical samples were utilized in this study belonging to nine different orders (See supporting information Table S2 for species list). The age of the historical specimens tested ranged from 16 to 115 years. PCR products were amplified at similar success rates from both the three and five primer pair sets for the same given samples tested suggesting that the three primer pair set is the best option (Table 2). The AWCF1/AWCR6 primer pair which amplifies the entire 648bp COI fragment was used as a control for historical specimens with no products being amplified. Of the 27 historical samples tested, 16 samples successfully amplified the regions of interest resulting in an amplification success rate of 59%. Further analysis found PCR success to be strongly correlated with specimen age. When separated into age groups we found samples which were 80 years or less in age had a higher average amplification success rate of 77% (n=13) than their older counterparts of greater than 80 years of age which had an average amplification success rate of 50% (n=12). However there was no significance difference found between the two age groups (Fisher s exact test, P value = ). Two of the 27 samples were of unknown ages and could not be classified into age groups; neither produced positive PCR results. Historical specimens belonging to the orders Anseriformes, Pelecaniformes and Psittaciformes did not successfully amplify the three fragments or the five fragments. However, their modern representatives were successfully amplified suggesting that the problem was due DNA damage rather than issues with primer binding. Bar one, all samples were over 80 years of age, stressing again the importance of age on PCR success. For the orders Charadriiformes and Anseriformes the last primer pair (AWCintF5/AWCintR6) posed a problem for some species. We were able to design an alternate primer pair (AWCintF6/AWCintR7) for these orders (refer to Table 1). This primer pair could have future use for other untested orders if a similar problem is encountered. A number of previously described avian COI primers (Hebert et al. 2004; Kerr et al. 2009) designed to amplify a single fragment for modern samples from the Northern Hemisphere 7
8 species had limited success when applied to samples from the New Zealand and Antarctic avifauna (data not shown). In particular, the amplification of DNA from tube nosed seabirds (Procellariformes) and kiwi (Apterygiformes) proved to be difficult. A similar result was found for the internal primers AvMiF1 and AvMiR1 where preliminary tests on Procellariformes resulted in the amplification of multiple fragments. This difficulty could be attributed to the fact that New Zealand and Antarctica have a more diverse and larger number of endemic seabirds than other geographic regions like North America for which these avian primers were originally designed. Moreover, orders like the Apterygiformes (kiwi) are unique to New Zealand. The successful amplification of the entire barcoding region using the newly designed primers AWCF1, AWCR6 and AWCR3, are shown in Table 3. The only previously published avian primer to have applicability to New Zealand and Antarctic birds was the COIbirdR2 primer (Kerr et al. 2009) when paired with our AWCF1 primer. This primer pair worked extremely well for Passerines (Table 3). The newly designed AWCF1/AWCR6 primer pair worked well for most orders of birds, with the forward primer AWCF1 proving to be universally successful at binding appropriately and the main reverse primer AWCR6 proving to be highly successful in the majority of cases. AWCR3 worked well in species for which AWCR6 did not prove successful. AWCR3 worked particularly well in Apterygiformes, where all five species of this order could only be amplified with the AWCF1/AWCR3 primer pair. The majority of the sequences generated using the AWCF1/AWCR3/AWCR6 fell into the category of high quality as stipulated by the Barcode of Life Data System (BOLD) where mean PHRED scores were >40 (Ratnasingham & Hebert 2007). Discussion COI sequence variation between taxonomic groups has led to difficulties in the design of a single primer pair with universal applicability. Furthermore, in the case of historical samples, the 648bp COI barcoding region can only be recovered in smaller fragments requiring multiple primer sets leading to the proposition that primers must be customised to suit. However, the generation of taxa-specific primers is an impractical. A realistic solution to this problem is to generate a small set of primers that will work effectively on all avian species, 8
9 both historical and modern. The primers generated by us are an example of such sets (Figure 1). These primers, designed to amplify the barcode region of historical and modern samples from New Zealand and Antarctic bird species proved generally successful with only a few exceptional taxa, such as the Apterygiformes requiring specialised primers. Since these primers were designed using an alignment of sequences from a range of both Northern and Southern Hemisphere species, it is likely that they will be effective for avian orders from many geographic locations. It is important to note that there are a number other primers published that are not tested in this study which could prove to be highly useful (Lohman et al. 2009; Tavares & Baker 2008). However, our primers have a very broad applicability, having been tested on large number of species from 17 avian orders. All primers generated high quality sequences for the region of interest. Primers designed for modern samples had binding sites at least 80bp from the start and end of the barcode region to allow for good overlapping bi-directional sequence and to make allowance for the loss of sequence data which occurs at the beginning of each sequence read. To maximise chances of obtaining amplifiable DNA from historical specimens we suggest sampling from the toe pad area where the risk of damage from preservatives is minimal. Specimen age should also be carefully considered and where possible, younger specimens should be selected for DNA analysis. The 648bp barcode region for historical avian specimens can now be amplified using tagged internal primers as either three or five fragments, depending on the DNA quality of individual samples. We suggest using the set of primers containing three primer pairs since the likelihood of achieving success with the set of three primers pairs is the same as that from the set of five primer pairs. As our results demonstrate, if one set of internal primers does not prove successful the other set is unlikely to work either. In the event that not all overlapping fragments are amplified there is the added possibility of using one or more of these smaller fragments as a mini-barcode once this approach has be confirmed to work for avian taxa. The addition of 5 -tags to each of the internal primers provides a number of advantages. Not only does it result in an increase in the read length of each sequence, thus allowing for better overlap of individual contigs, but it has been shown to greatly improve sequence quality (Binladen et al. 2007). This is crucial for historical samples where DNA damage is frequent. The 5 -tags also allow for large-scale sequencing as well as being more cost effective, as only 9
10 two primers (forward and reverse tags) are required instead of the many individual forward and reverse primers. The disadvantage, however, is that the processes of DNA extraction, PCR amplification and sequencing from historical specimens can be taxing and time consuming. Thus, modern specimens should be utilised for barcoding purposes wherever possible. We suggest using DNA barcodes generated from historical samples as a way of adding to an already existing database where there is a lack of their modern counterparts or for cases of rare and endangered species where sample collection is problematic. There is now an onus upon museums and other institutions to ensure the storage of well preserved vouchered samples of as many species as possible, from which, high quality DNA can be extracted. The maintenance of such collections is increasingly being adopted around the world. However, until such time as these collections become comprehensive and for rare or now extinct species, study skins and bones provide the only vouchered source of DNA. While that is the case, there is a need for methods, such as those outlined above, to provide a means of generating DNA barcodes. Acknowledgements Funding for this study was provided by the University of Auckland s Vice Chancellor s Development Fund and the Allan Wilson Centre for Molecular Ecology and Evolution. We would like to thank Leon Huynen for help with primer design and invaluable advice on ancient DNA techniques and also Judith Robbins for allowing us to make use of the Department of Anthropology ancient DNA Laboratory at the University of Auckland. We would like to thank all the people who kindly donated samples to make this study possible and in particular Paul Scofield for providing us with all the historical specimens from Canterbury museum. 10
11 Fig. 1 A diagrammatic representation of the COI barcoding region used for birds with the relative position of the primers (triangles) indicated for amplifying historical and modern samples. The three black triangles and the two black bars indicate the combination of primers used and DNA fragments generated for modern samples. Similarly, the grey or white triangles and the grey or white bars represent the primer combinations and resulting DNA fragments generated for historical samples. The position of each primer and the amplified DNA fragments are given relative to the chicken mitochondrial genome. 11
12 References Arctander P, Fjeldsa J (1994) Avian tissue collections for DNA analysis. Ibis 136, Baker AJ, Tavares ES, Elbourne RF (2009) Countering criticisms of single mitochondrial DNA gene barcoding in birds. Molecular Ecology Resources 9, Binladen J, Thomas M, Gilbert P, Campos PF, Eska W (2007) 5'-Tailed sequencing primers improve sequencing quality of PCR products. BioTechniques 42, Evans T (2007) DNA damage. NEB expressions 2.1, 1-3. Gill FB (2007) Ornithology, 3rd edn. W.H. Freeman, New York. Hajibabaei M, Singer GAC, Hebert PDN, Hickey DA (2007) DNA barcoding: how it complements taxonomy, molecular phylogenetics and population genetics. Trends in Genetics 23, Hajibabaei M, Smith AM, Janzen DH, et al. (2006) A minimalist barcode can identify a specimen whose DNA is degraded. Molecular Ecology Notes 6, Heather BD, Robertson HA (2005) The Field Guide to the Birds of New Zealand, Rev. edn. Penguin Books, Auckland Hebert PDN, Cywinska A, Ball SL, dewaard JR (2003a) Biological identifications through DNA barcodes. Proceedings of the Royal Society of London. Series B: Biological Sciences 270, Hebert PDN, Ratnasingham S, de Waard JR (2003b) Barcoding animal life: cytochrome c oxidase subunit 1 divergences among closely related species. Proceedings of the Royal Society of London. Series B: Biological Sciences 270, S96-S99. Hebert PDN, Stoeckle MY, Zemlak TS, Francis CM (2004) Identification of Birds through DNA Barcodes. PLoS Biology 2, Hofreiter M, Serre D, Poinar HN, Kuch M, Paabo S (2001) Ancient DNA. Nature Reviews Genetics 2, Hoss M, Jaruga P, Zastawny TH, Dizdaroglu M, Paabo S (1996) DNA damage and DNA sequence retrieval from ancient tissues. Nucleic Acids Research 24, Kerr KCR, Lijtmaer DA, Barreira AS, Hebert PDN, Tubaro PL (2009) Probing Evolutionary Patterns in Neotropical Birds through DNA Barcodes. PLoS ONE 4, e4379. Kerr KCR, Stoeckle MY, Dove CJ, et al. (2007) Comprehensive DNA barcode coverage of North American birds. Molecular Ecology Notes 7, Lawrence HA, Taylor GA, Millar CD, Lambert DM (2008) High mitochondrial and nuclear genetic diversity in the world s most endangered seabird, the Chatham Island Taiko (Pterodroma magentae). Conservation Genetics 9, Lindahl T (1993) Instability and decay of the primary structure of DNA. Nature 362, Lohman DJ, Prawiradilaga DM, Meier R (2009) Improved COI barcoding primers for Southeast Asian perching birds (Aves: Passeriformes). Molecular Ecology Resources 9, Millar CD, Huynen L, Subramanian S, Mohandesan E, Lambert DM (2008) New developments in ancient genomics. Trends in Ecology & Evolution 23, Moritz C, Cicero C (2004) DNA Barcoding: Promise and Pitfalls. PLoS Biology 2, Ratnasingham S, Hebert PDN (2007) bold: The Barcode of Life Data System. Molecular Ecology Notes 7,
13 Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning : a laboratory manual Cold Spring Harbor Laboratory Press, New York. Seutin GW, Bradley N, Boag PT (1991) Preservation of avian blood and tissue samples for DNA analyses. Canadian Journal of Zoology 69, Tavares E, Baker A (2008) Single mitochondrial gene barcodes reliably identify sisterspecies in diverse clades of birds. BMC Evolutionary Biology 8, 81. Yoo H, Eah J, Kim J, et al. (2006) DNA Barcoding Korean Birds. Molecules and Cells 22, Zimmermann J, Hajibabaei M, Blackburn D, et al. (2008) DNA damage in preserved specimens and tissue samples: a molecular assessment. Frontiers in Zoology 5,
14 mt genome 5 648bp COI barcoding region 3 AWCF1 AWCintF1 AWCintF2 AWCintF3 AWCintF4 AWCintF AWCintR1 AWCintR2 AWCintR3 AWCintR4 AWCintR5 AWCintR6 AWCR6 AWCR
15 Table 1 PCR primers and 5 -tags used for the amplification of the 648bp COI region as either one, three or five fragments. The position of each primer is given relative to the chicken mitochondrial sequence. The 5 -tags were only added to the individual primers when PCR amplifying and sequencing ancient samples as either three or five fragments. AWCintF6 and AWCintR7 represent alternate primer pairs used for the orders Charadriiformes and Anseriformes. Forward Primer Sequence 5 to 3 Position (bp )* Reverse Primer Sequence 5 to 3 Position (bp )* Fragment Size (bp )* Primers for modern samples AWCF1 CGCYTWAACAYTCYGCCATCTTACC AWCR6 ATTCCTATGTAGCCGAATGGTTCTTT AWCF1 AWCR3 ATGCTCGGGTGTCTACGTCTAT First set of internal primers containing 3 primer pairs AWCF1 AWCintR2 ATGTTGTTTATGAGTGGGAATGCTATG 328 AWCintF2 ATCGGAGCCCCAGACATAGCATT AWCintR4 TTGATGGCTGTTGTGATAAAGTTGAT AWCintF4 TCCTCAATCCTGGGAGCAATCAACTT AWCintR6 GGATTAGGATGTAGACTTCTGGGTG Second set of internal primers containing 5 primer pairs AWCF1 AWCintR1 CCTGGTTGACCTAGTTCTGCTCG AWCintF1 CCGAGCAGAACTACGTCAACC AWCintR AWCintF3 ATAATCGGAGGCTTCGGAAACTGA AWCintR3 TGGGAKAGGGCTGGTGGTTTTATGTT AWCintF4 AWCintR5 TGCTGGGTCGAAGAATGTGGTGTT AWCintF5 GGCATCACCATACTACTAACAGACCG AWCintR tags for internal primers Ftag AGTCGACGCTTCTAGCTT - Rtag CATGCTACCTGCTACTGT - AWCintF6 TAGGGGCAATCAACTTCATCACAAC ( ) AWCintR7 ACGTRTGAGATAATTCCGAATCC ( ) *basepairs
16 Table 2 Results of PCR success of modern and historical samples for the two primer sets designed to amplify DNA from historical specimens. PCR success is defined as fragments amplified (Y = amplified; N = not amplified; NT = not tested). Modern Specimens Historical Specimens Order 3 fragments 5 fragments No. of Species 3 fragments 5 fragments No. of Species Anseriformes Y* Y* 2 N N 0/2 Ciconiiformes Y Y 2 Y Y 2/2 Charadriiformes Y* Y* 2 Y* Y* 2/4 Falconiformes Y Y 2 Y Y 1/2 Gruiformes Y Y 2 Y Y 1/2 Pelecaniformes Y Y 2 N N 0/2 Procellariformes Y Y 2 Y Y 9/10 Sphenisciformes Y Y 2 Y Y 1/2 Psittaciformes Y Y 2 N N 0/1 Passeriformes Y Y 2 NT NT - Apterygiformes Y Y 2 NT NT - Coraciiformes Y Y 2 NT NT - Galliformes Y Y 2 NT NT - Columbiformes Y Y 2 NT NT - Podcipediformes Y Y 1 NT NT - * Not all primer pairs were successful, alternate primer pairs have been supplied for these orders (see Table 1).
17 Table 3 PCR primer success on 17 different avian orders. The numbers represent the species of each order from which the target sequence was successfully amplified, using different combinations of PCR primers. Order AWCF1/R6 AWCF1/R3 AWCF1/R6 & AWCR3 AWCF1/ COIbirdR2 No. of species per order Anseriformes Apterygiformes Charadriiformes Ciconiiformes Columbiformes Coraciiformes Cuculiformes Falconiformes Galliformes Gruiformes Passeriformes Pelecaniformes Podcipediformes Procellariformes Psittaciformes Sphenisciformes Strigiformes Total
18 Supporting Information for online publication only Table S1 Accession numbers of species used as part of the alignment for primer design Scientific Name Anas clypeata Anas platyrhynchos Branta canadensis Arenaria interpes Bartramia longicauda Calidris alba Calidris fuscicollis Calidris mauri Calidris minutilla Larus dominicanus Limosa haemastica Pluvialis dominica Pluvialis squatarola Tringa flavipes Egretta novaehollandiae Nycticorax caledonicus Eurystomus orientalis Chrysococcyx lucidus Alectoris chukar Callipepla californica Colinus virginianus Numida meleagris Phasianus colchicus Acanthisitta chloris Acridotheres tristis Carduelis flammea Corvus frugilegus Gymnorhina tibican Passer domesticus Pelecanus conspicillatus Phaethon rubricauda Podiceps cristatus Pterodroma brevirostris Oceanodroma leucorhoa Procellaria cinerea Thalassarche chrysostoma Thalassarche melanophris Strigops habroptilus Eudyptes chrysocome Eudyptula minor Ninox nvaeseelandiae Apteryx australis Apteryx haastii Apteryx mantelli Accession Number AY AY DQ AY AY AY AY AY AY AY AY AY AY AY DQ AY AF AF AY AY AY AP AY AY AY AY Y18522 AF AY DQ AP AP AY AY AP AP AY AY AP AF AY AF AY AY016010
19 Table S2 List of historical specimens from Canterbury museum Scientific Name Museum Voucher ID Collection Date (Year) Daption capensis Av Stictocarbo punctatus Av Gallirallus australis Av Falco novaeseelandiae Av Botaurus poiciloptilus Av Oceanites nereis Av Pelecanoides urinatrix Av Cyanomorphus auriceps Av Pterodroma macroptera Av Hymenolaimus malacorhynchos Av Anas gracilis Av Charadrius obscurus Av Sterna caspia Av Eudyptes scalteri Av Himantopus himantopus Av Micronectes giganteus Av Leucocarbo carunculatus Av Egretta sacra Av Falco novaeseelandiae Av Porzana pusilla Av Pterodroma macroptera Av Diomedea epomophora Av Oceanites nereis Av Himantopus ostralegus Av Eudyptula minor Av Fregata tropica Av Pterodroma cervicalis Av
Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: ignatius.tan@nyu.
Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: [email protected] Course Hours: Section 1: Mon: 12:30-3:15 Section 2: Wed: 12:30-3:15
ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing.
User manual imegen Anchovies II ID kit Anchovies species (E. encrasicolus and E. japonicus) DNA detection by sequencing Reference: Made in Spain The information in this guide is subject to change without
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
Supplementary Information - PCR amplification PCR amplification reactions for the partial mitochondrial cytochrome oxidase subunit I (COI), the
Supplementary Information - PCR amplification PCR amplification reactions for the partial mitochondrial cytochrome oxidase subunit I (COI), the ribosomal 16S rdna gene and a fragment of the nuclear single
ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.
A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT
Application Guide... 2
Protocol for GenomePlex Whole Genome Amplification from Formalin-Fixed Parrafin-Embedded (FFPE) tissue Application Guide... 2 I. Description... 2 II. Product Components... 2 III. Materials to be Supplied
PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,
Supplemental Text/Tables PCR Amplification and Sequencing PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Foster City, CA). Each PCR reaction contained 20 ng genomic
PrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR
Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR BioTechniques 25:415-419 (September 1998) ABSTRACT The determination of unknown DNA sequences around
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
How To Use An Enzymatics Spark Dna Sample Prep Kit For Ion Torrent
SPARK DNA Sample Prep Kit Ion Torrent (SPK0002-V08) Frequently Asked Questions Under what circumstances would I use SPARK DNA Sample Prep Kit for Ion Torrent? Enzymatics SPARK DNA Sample Prep Kit for Ion
DNA and Forensic Science
DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief
Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013)
Protocols Internal transcribed spacer region (ITS) region Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) The nuclear ribosomal RNA (rrna) genes (small subunit, large subunit and 5.8S) are
Mitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
Genomic DNA Extraction Kit INSTRUCTION MANUAL
Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview
Description: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
BARCODING LIFE, ILLUSTRATED
BARCODING LIFE, ILLUSTRATED Goals, Rationale, Results Barcoding is a standardized approach to identifying animals and plants by minimal sequences of DNA. 1. Why barcode animal and plant species? By harnessing
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
Analysis of the DNA Methylation Patterns at the BRCA1 CpG Island
Analysis of the DNA Methylation Patterns at the BRCA1 CpG Island Frédérique Magdinier 1 and Robert Dante 2 1 Laboratory of Molecular Biology of the Cell, Ecole Normale Superieure, Lyon, France 2 Laboratory
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
TIANquick Mini Purification Kit
TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer
Genolution Pharmaceuticals, Inc. Life Science and Molecular Diagnostic Products
Genolution Pharmaceuticals, Inc. Revolution through genes, And Solution through genes. Life Science and Molecular Diagnostic Products www.genolution1.com TEL; 02-3010-8670, 8672 Geno-Serum Hepatitis B
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
ZR DNA Sequencing Clean-up Kit
INSTRUCTION MANUAL ZR DNA Sequencing Clean-up Kit Catalog Nos. D40 & D4051 Highlights Simple 2 Minute Bind, Wash, Elute Procedure Flexible 6-20 µl Elution Volumes Allow for Direct Loading of Samples with
DNA Core Facility: DNA Sequencing Guide
DNA Core Facility: DNA Sequencing Guide University of Missouri-Columbia 216 Life Sciences Center Columbia, MO 65211 http://biotech.missouri.edu/dnacore/ Table of Contents 1. Evaluating Sequencing Data..
Introduction To Real Time Quantitative PCR (qpcr)
Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors
Multiple Losses of Flight and Recent Speciation in Steamer Ducks Tara L. Fulton, Brandon Letts, and Beth Shapiro
Supplementary Material for: Multiple Losses of Flight and Recent Speciation in Steamer Ducks Tara L. Fulton, Brandon Letts, and Beth Shapiro 1. Supplementary Tables Supplementary Table S1. Sample information.
Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix
CLONING & MAPPING DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix LIBRARY PREP FOR NET GEN SEQUENCING PROTEIN
Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation.
Introduction to SMRTbell Template Preparation 100 338 500 01 1. SMRTbell Template Preparation 1.1 Introduction to SMRTbell Template Preparation Welcome to Pacific Biosciences' Introduction to SMRTbell
VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10
Topic J10+11: Molecular-biological methods + Clinical virology I (hepatitis A, B & C, HIV) To study: PCR, ELISA, your own notes from serology reactions Task J10/1: DNA isolation of the etiological agent
MagExtractor -Genome-
Instruction manual MagExtractor-Genome-0810 F0981K MagExtractor -Genome- NPK-101 100 preparations Store at 4 C Contents [1] Introduction [2] Components [3] Materials required [4] Protocol 1. Purification
ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053
INSTRUCTION MANUAL ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 Highlights Simple 10 Minute Bind, Wash, Elute Procedure Flexible 15-20 µl Elution Volumes Allow for Direct Loading of Samples
Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011
Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)
Sanger Sequencing. Troubleshooting Guide. Failed sequence
Sanger Sequencing Troubleshooting Guide Below are examples of the main problems experienced in ABI Sanger sequencing. Possible causes for failure and their solutions are listed below each example. The
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)
Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website
Biomolecular Core Facility AI Dupont Hospital for Children, Rockland Center One, Room 214 Core: (302) 651-6712, Office: (302) 651-6707, [email protected] Katia Sol-Church, Ph.D., Director Jennifer Frenck
Mir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
IMBB 2013. Genomic DNA purifica8on
IMBB 2013 Genomic DNA purifica8on Why purify DNA? The purpose of DNA purifica8on from the cell/8ssue is to ensure it performs well in subsequent downstream applica8ons, e.g. Polymerase Chain Reac8on (PCR),
Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
Troubleshooting Sequencing Data
Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page
QUANTITATIVE RT-PCR. A = B (1+e) n. A=amplified products, B=input templates, n=cycle number, and e=amplification efficiency.
QUANTITATIVE RT-PCR Application: Quantitative RT-PCR is used to quantify mrna in both relative and absolute terms. It can be applied for the quantification of mrna expressed from endogenous genes, and
DNA Sequence Analysis
DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide
The Techniques of Molecular Biology: Forensic DNA Fingerprinting
Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins
360 Master Mix. , and a supplementary 360 GC Enhancer.
Product Bulletin AmpliTaq Gold 360 Master Mix and 360 DNA Polymerase AmpliTaq Gold 360 Master Mix AmpliTaq Gold 360 DNA Polymerase 360 Coverage for a Full Range of Targets AmpliTaq Gold 360 Master Mix
Aurora Forensic Sample Clean-up Protocol
Aurora Forensic Sample Clean-up Protocol 106-0008-BA-D 2015 Boreal Genomics, Inc. All rights reserved. All trademarks are property of their owners. http://www.borealgenomics.com [email protected]
Real-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
NimbleGen DNA Methylation Microarrays and Services
NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]
DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE
DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE We recommend for the sequence visualization the use of software that allows the examination of raw data in order to determine quantitatively how good has
BacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
Technical Manual No. 0173 Update Date 10112010
TissueDirect TM Multiplex PCR System Technical Manual No. 0173 Update Date 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 3 V Simplified Procedures. 3 VI Detailed
Gene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant. MARGARET M. KOOPMAN*, ELIZABETH GALLAGHER, and BRYAN C.
Page 1 of 28 1 1 2 3 PERMANENT GENETIC RESOURCES Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant Sarracenia alata (Sarraceniaceae). 4 5 6 MARGARET M. KOOPMAN*, ELIZABETH
Real-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application
GenScript BloodReady TM Multiplex PCR System
GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI
SYBR Green Realtime PCR Master Mix -Plus-
Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction
Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
RT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.
Unzipping Genes MBPCR014 Beta-Thalassemia Detection Kit P r o d u c t I n f o r m a t i o n Description: Thalassemia is a group of genetic disorders characterized by quantitative defects in globin chain
Long-term storage of nucleic acids
Long-term storage of nucleic acids Permanent storage below the temperature of recrystallization White Paper Generated at 02/20/2013 Page 1 of 8 Content: 1. Importance of the long-term storage of nucleic
DNA Isolation Kit for Cells and Tissues
DNA Isolation Kit for Cells and Tissues for 10 isolations of 00 mg each for tissue or 5 x 10 7 cultured cells Cat. No. 11 81 770 001 Principle Starting material Application Time required Results Benefits
The RNAi Consortium (TRC) Broad Institute
TRC Laboratory Protocols Protocol Title: One Step PCR Preparation of Samples for Illumina Sequencing Current Revision Date: 11/10/2012 RNAi Platform,, [email protected] Brief Description: This
Taq98 Hot Start 2X Master Mix
Taq98 Hot Start 2X Master Mix Optimized for 98C Denaturation Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608) 831-9012 [email protected]
Hepatitis B Virus Genemer Mix
Product Manual Hepatitis B Virus Genemer Mix Primer Pair for amplification of HBV Specific DNA Fragment Includes Internal Negative Control Primers and Template Catalog No.: 60-2007-12 Store at 20 o C For
Terra PCR Direct Polymerase Mix User Manual
Clontech Laboratories, Inc. Terra PCR Direct Polymerase Mix User Manual Cat. Nos. 639269, 639270, 639271 PT5126-1 (031416) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain
ABSTRACT INTRODUCTION
Performance of the PAXgene Blood DNA Tube for the Collection, Transport, and Storage of Whole Blood and the Purification of DNA Using the QIAsymphony Instrument L. Rainen 1, K. Guenther 2, E. Provencher
Troubleshooting for PCR and multiplex PCR
Page 1 of 5 Page designed and maintained by Octavian Henegariu (Email: Tavi's Yale email or Tavi's Yahoo email). As I am currently pursuing a new junior faculty position, the Yale URL and email may change
DNA-functionalized hydrogels for confined membrane-free in vitro transcription/translation
Electronic Supplementary Material (ESI) for Lab on a Chip. This journal is The Royal Society of Chemistry 2014 DNA-functionalized hydrogels for confined membrane-free in vitro transcription/translation
ab185916 Hi-Fi cdna Synthesis Kit
ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1
Analysis of DNA methylation: bisulfite libraries and SOLiD sequencing
Analysis of DNA methylation: bisulfite libraries and SOLiD sequencing An easy view of the bisulfite approach CH3 genome TAGTACGTTGAT TAGTACGTTGAT read TAGTACGTTGAT TAGTATGTTGAT Three main problems 1.
Preparing Samples for Sequencing Genomic DNA
Preparing Samples for Sequencing Genomic DNA FOR RESEARCH ONLY Topics 3 Introduction 5 Kit Contents and Equipment Checklist 7 Fragment the Genomic DNA 11 Perform End Repair 12 Add A Bases to the 3' End
DNA Sequencing Troubleshooting Guide
DNA Sequencing Troubleshooting Guide Successful DNA Sequencing Read Peaks are well formed and separated with good quality scores. There is a small area at the beginning of the run before the chemistry
Vector NTI Advance 11 Quick Start Guide
Vector NTI Advance 11 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Version 11.0 December 15, 2008 12605022 Published by: Invitrogen Corporation 5791 Van Allen Way Carlsbad, CA 92008 U.S.A.
Řekněte si o vzorky zdarma!
strana 1 z 6 Ceník platí v souladu s Obchodními podmínkami LAB MARK od 15.10.2015 Core Reagents for Molecular Biology www.bioline.com Řekněte si o vzorky zdarma! PCR ENZYME & MIXES DNA Polymerases - For
Robert G. Young & Sarah Adamowicz University of Guelph Cathryn Abbott & Tom Therriault Department of Fisheries and Oceans
Evaluating Canadian zooplankton biodiversity through DNA barcodes: assessing non-indigenous species presence to provide a framework for future monitoring Robert G. Young & Sarah Adamowicz University of
GENOTYPING ASSAYS AT ZIRC
GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed
Essentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
FOR REFERENCE PURPOSES
BIOO LIFE SCIENCE PRODUCTS FOR REFERENCE PURPOSES This manual is for Reference Purposes Only. DO NOT use this protocol to run your assays. Periodically, optimizations and revisions are made to the kit
Introduction. Preparation of Template DNA
Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;
Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing
STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAAC GTGCAC GTGAAC Wouter Coppieters Head of the genomics core facility GIGA center, University of Liège Bioruptor NGS: Unbiased DNA
Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3
Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
- In 1976 1977, Allan Maxam and walter Gilbert devised the first method for sequencing DNA fragments containing up to ~ 500 nucleotides.
DNA Sequencing - DNA sequencing includes several methods and technologies that are used for determining the order of the nucleotide bases adenine, guanine, cytosine, and thymine in a molecule of DNA. -
ExpressArt Bacterial H-TR cdna synthesis kit. With extreme selectivity against rrnas
ExpressArt Bacterial H-TR cdna synthesis kit With extreme selectivity against rrnas suitable for 2 to 4 µg total RNA Catalogue No. 8004-A30 (30 rxns) Reagents Materials are provided for 30 cdna synthesis
CompleteⅡ 1st strand cdna Synthesis Kit
Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:
FINDING RELATION BETWEEN AGING AND
FINDING RELATION BETWEEN AGING AND TELOMERE BY APRIORI AND DECISION TREE Jieun Sung 1, Youngshin Joo, and Taeseon Yoon 1 Department of National Science, Hankuk Academy of Foreign Studies, Yong-In, Republic
GenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
Becker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476
BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of
Chapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
A quick and simple method for the identi cation of meat species and meat products by PCR assay
Meat Science 51 (1999) 143±148 A quick and simple method for the identi cation of meat species and meat products by PCR assay T. Matsunaga a, K. Chikuni b *, R. Tanabe b, S. Muroya b, K. Shibata a, J.
