Multiple Losses of Flight and Recent Speciation in Steamer Ducks Tara L. Fulton, Brandon Letts, and Beth Shapiro
|
|
|
- Brendan McCoy
- 8 years ago
- Views:
Transcription
1 Supplementary Material for: Multiple Losses of Flight and Recent Speciation in Steamer Ducks Tara L. Fulton, Brandon Letts, and Beth Shapiro 1. Supplementary Tables Supplementary Table S1. Sample information. Please see attached excel file.
2 Supplementary Table S2. PCR Amplification and Sequencing Information. Modern PCRs comprised 0.25 mm dntps, 1X buffer, 1.25 units GoTaq polymerase (Promega), 2 mm MgCl2, 1µM of each primer, and 1 µl DNA extract in 25µl total. Cycling conditions were 94 C for 5 min.; 35 cycles of 94 C for 1 min., annealing 1 min, 68 C for 2 min.; final extension at 72 C for 10 min. Historic DNA PCRs were 25 µl reactions comprising 50µg rabbit serum albumin, 0.25 mm dntps, 1X buffer, 1.25 units Platinum Taq High Fidelity polymerase (Invitrogen), 1 mm MgSO4, 0.4 µm of each primer, and 1 µl DNA extract. Cycling conditions were 94 C for 60 sec.; 60 cycles of 94 C for 30 sec., annealing for 45 sec, and 68 C for 45 sec. Locus Fragment D loop modern 997 bp historic 1 historic 2 Final aligned length Forward primer (5' to 3') Reverse primer (5' to 3') 140 bp 220 bp L16722 ACTACCCGAGACCTACGGCT TachyDloopF1 GCGGGGGTTATTTGGCTATG TachyDloopF2 CCATCTCCATGTAAACGGACAT PCR primer reference H1254 TCTTGGCAGCTTCAGTGCCA [1] 60 Anneal. temp. (deg. C) Fwd sequencing primer Rev sequencing primer DloopMidF CTAAACCCCTCGCCCTCC DloopMidR TAGGATAGGACGATAACG TachyDloopR1 AGAGCATTCATCCTAAGTCCGTTG This study 65 M13F (cloned) M13F (cloned) TachyDloopR2 ACATCGGACATTATGTGCAAGG This study 65 M13F (cloned) M13F (cloned) historic full 336 bp TachyDloopF1 TachyDloopR2 This study 65 M13F (cloned) M13F (cloned) ND2 full 738 bp Myo full 603 short 603 5' fragment 110 bp 3' fragment 93 bp CHD 385 bp ENO 303 bp ODC 256 bp L5219 CCCATACCCCGAAAATGATG TbrachyMyo145F TTCAGTTAACTCTCAAGTCCAAG ENO.F CGCGATGGAAAGTATGACCT OD7.Fstr: GCTGTGTGTTTGATATGGGAGT TachyND2endR GCAAGGCGTAGGTAGAAGAATAGG [2]; This study 65 myo2 GCCACCAAGCACAAGATCCC [3] 56 myo2 TachyND2seqF TCAACCCCCTCCTCTACTAA T TachyND2seqR2 CTGCTTAGTCAGTTCTTGG myo3f GCAAGGACCTTGATAATGACTT TachyMyoF AGGTATGGAAAAGGGCAGGGAA TC TachyMyo2SeqR TCAGAAAATCCAGACTAAG TachyMyoR AAAAACAGAAGGGACGCTCAGGG This study 65 TachyMyoF TachyMyoR TbrachyMyo256R GCATGCAGGGGCTGGTTTATTATT GTC This study 55 TbrachyMyo145F TbrachyMyo256R TbrachyMyo545F GCATGCTAGACCACAGTGTC CHDZa.F CTGGACATCCTAGCAGAGTACCT A TbrachyMyo639R ACAGAAGGGACGCTCAGGG This study 60 TbrachyMyo545 TbrachyMyo639R CHDZa.R TCCTCAATTCCCCTTTTATTGA [4] 55 CHDZa.F ENO.R CCAACGCTGCCAGTAAACTT [5] 61 ENO.F ENO.R OD8.Rstr: TGAAGCCAAGTTCAGCCTAA [5] 57 OD7.Fstr n.a. TachyCHDseqR GATCCATCAAGTCTCTAAAG
3 Table S3. Best fit model of evolution for each locus. Best fit models were selected using AIC in jmodeltest as described in text. Data set CR-just newly sequenced CR-including GenBank ND2 - Tachyeres only ND2 - Anatidae Myo CHD Best-fit model HKY+I HKY+I+G GTR+G GTR+I+G K80 HKY
4 2. Supplementary Figures Phylogenies Supplemental Phylogenetic Methods: We performed Maximum likelihood (ML), ML bootstrapping (MLBP) and Bayesian analyses for ND1, Dloop, MB and CHD separately and combined. Wood duck (Anas strepera) and crested duck (Lophonetta specularioides) were included as outgroups (Table S1). We performed Dloop only analyses both with and without previously published sequences from [6] obtained from GenBank (Table S1). We performed ML analyses using RAxML v7.2.8alpha [7, 8], using the GTR + Γ model of evolution for each gene (partitioned in the combined analysis) and 100 rapid bootstrap pseudoreplicates (option f a). We performed Bayesian Markov chain Monte Carlo (MCMC) analyses using MrBayes version or 3.2 [9], which incorporates both hot and cold chains in a single analysis to improve mixing. We ran MrBayes twice for 5 million generations each for all single gene analyses. We ran the combined loci analysis for 30 million generations, with each locus assigned a separate partition with unlinked model parameters. In all runs, chains were sampled every 1000 iterations, and the first 10% of sampled states were discarded as burn in following convergence assessment using the sump command. Convergence was assumed when the runs were sampling the same posterior distribution and all parameters had a potential scale reduction factor of 1.0. All trees were summarized in treeannotator v1.6.1 (part of the BEAST v1.6.1 package; [10]) and visualized in FigTree version [11].
![We performed Dloop only analyses both with and without previously published sequences from [6] obtained from GenBank (Table S1). We performed ML analyses using RAxML v7.2.](/docs-images/51/13545470/images/page_4.jpg "8alpha [7, 8], using the GTR + Γ model of evolution for each gene (partitioned in the combined analysis) and 100 rapid bootstrap pseudoreplicates (option f a).")
5 BL233 T. patachonicus FI KEY BL235 T. patachonicus FI BL236 T. patachonicus FI Falkland flightless s.d. BL237 T. patachonicus FI (Tachyeres brachypterus) BL239 T. patachonicus FI Magellanic flightless s.d. (Tachyeres pteneres) BL030 T. brachypterus FI flying steamer duck 1.0 (Tachyeres patachonicus) BL023 T. brachypterus FI /92 EP016 T. brachypterus FI white-headed flightless s.d. BL024 T. brachypterus FI (Tachyeres leucocephalus) BL025 T. brachypterus FI BL026 T. brachypterus FI BL028 T. brachypterus FI BL029 T. brachypterus FI EP014 T. brachypterus FI BL256 T. brachypterus FI BL257 T. brachypterus FI BL255 T. brachypterus FI 1.0/96 BL238 T. patachonicus FI BL050 T. brachypterus FI BL051 T. brachypterus FI BL055 T. brachypterus FI EP013 T. brachypterus FI /100 /72 BL019 T. patachonicus Osorno, Chile BL033 T. leucocephalus Chubut, Argentina 0.98 BL034 T. leucocephalus Chubut, Argentina /97 BL035 T. leucocephalus Chubut, Argentina BL036 T. leucocephalus Chubut, Argentina BL037 T. leucocephalus Chubut, Argentina BL011 T. patachonicus Tierra del Fuego, Argentina BL015 T. patachonicus Chubut, Argentina 1.0 BL042 T. pteneres Chile /85 BL043 T. pteneres Chile 0.98/69 BL041 T. pteneres Argentina BL258 T. pteneres unknown 1.0/100 GB Anas strepera Figure S1. Steamer duck phylogeny based on two mitochondrial (D-loop, ND2) and two nuclear (MB, CHD) genes. The consensus tree from mrbayes is shown. Node labels indicate Bayesian posterior clade probabilites from mrbayes / maximum likelihood bootstrap values from RAxML. Taxa are coloured and coded as in Figures 1, 2.
6 1.0/100 BL233 T. patachonicus FI BL235 T. patachonicus FI BL236 T. patachonicus FI BL237 T. patachonicus FI BL239 T. patachonicus FI 0.93/84 BL030 T. brachypterus FI HM T. pteneres *captiveusa 0.85/99 BL023 T. brachypterus FI EP016 T. brachypterus FI BL024 T. brachypterus FI 1.0/90 BL025 T. brachypterus FI 0.85/66 BL026 T. brachypterus FI BL028 T. brachypterus FI BL029 T. brachypterus FI EP014 T. brachypterus FI BL256 T. patachonicus FI BL257 T. brachypterus FI BL255 T. brachypterus FI bhm T. brachypterus FI bhm T. brachypterus FI bhm T. brachypterus FI 1.0/100 bhm T. brachypterus FI BL238 T. patachonicus FI BL050 T. brachypterus FI BL051 T. brachypterus FI BL055 T. brachypterus FI EP013 T. brachypterus FI 0.85/62 BL019 T. patachonicus Osorno, Chile phm T. patachonicus Santa Cruz, Argentina phm T. patachonicus Santa Cruz, Argentina BL033 T. leucocephalus Chubut, Argentina BL034 T. leucocephalus Chubut, Argentina BL035 T. leucocephalus Chubut, Argentina 0.6/47 BL036 T. leucocephalus Chubut, Argentina BL037 T. leucocephalus Chubut, Argentina 0.99/91 HM T. leucocephalus Chubut, Argentina HM T. leucocephalus Chubut, Argentina HM T. leucocephalus Chubut, Argentina BL011 T. patachonicus Tierra del Fuego, Argentina BL015 T. patachonicus Chubut, Argentina HM T. patachonicus Chubut, Argentina 0.63/32 HM T. patachonicus Chubut, Argentina HM T. patachonicus Santa Cruz, Argentina HM T. patachonicus Santa Cruz, Argentina BL042 T. pteneres Chile 0.91/91 BL043 T. pteneres Chile HM T. patachonicus Santa Cruz, Argentina 0.92/47 BL041 T. pteneres Argentina BL258 T. pteneres unknown 0.53/16 HM T. pteneres Navarino Island, Chile GB Anas strepera Figure S2. Consensus tree resulting from the single-locus mrbayes analysis of the amplified D-loop fragment including previously published sequences downloaded from GenBank. Node labels indicate Bayesian posterior clade probabilites from mrbayes / maximum likelihood bootstrap values from RAxML estimated as described in the supplementary methods. Taxa are coloured and coded as in Figures 1, 2.
7 1.0/ / / / / /99 BL233 T. patachonicus FI BL235 T. patachonicus FI BL236 T. patachonicus FI BL237 T. patachonicus FI BL239 T. patachonicus FI BL030 T. brachypterus FI BL023 T. brachypterus FI EP016 T. brachypterus FI BL024 T. brachypterus FI BL025 T. brachypterus FI BL026 T. brachypterus FI BL028 T. brachypterus FI BL029 T. brachypterus FI EP014 T. brachypterus FI BL256 T. patachonicus FI BL257 T. brachypterus FI BL255 T. brachypterus FI BL238 T. patachonicus FI BL050 T. brachypterus FI BL051 T. brachypterus FI BL055 T. brachypterus FI EP013 T. brachypterus FI BL011 T. patachonicus Tierra del Fuego, Argentina BL015 T. patachonicus Chubut, Argentina BL033 T. leucocephalus Chubut, Argentina BL034 T. leucocephalus Chubut, Argentina BL035 T. leucocephalus Chubut, Argentina BL036 T. leucocephalus Chubut, Argentina BL037 T. leucocephalus Chubut, Argentina n.s./ /84 BL019 T. patachonicus Osorno, Chile BL042 T. pteneres Chile 0.95/97 BL043 T. pteneres Chile 0.75/54 BL041 T. pteneres Argentina BL258 T. pteneres unknown GB Anas strepera Figure S3. Consensus tree resulting from the single-locus mrbayes analysis of the amplified D-loop fragment excluding previously published sequences available from GenBank. Node labels indicate Bayesian posterior clade probabilites from mrbayes / maximum likelihood bootstrap values from RAxML estimated as described in the supplementary methods. Taxa are coloured and coded as in Figures 1, 2.
8 1.0/93 BL023 T. brachypterus FI BL024 T. brachypterus FI 0.52/85 BL025 T. brachypterus FI BL026 T. brachypterus FI 0.89/68 BL028 T. brachypterus FI BL029 T. brachypterus FI BL030 T. brachypterus FI EP014 T. brachypterus FI EP013 T. brachypterus FI BL011 T. patachonicus Tierra del Fuego, Argentina BL019 T. patachonicus Osorno, Chile 0.69/94 BL033 T. leucocephalus Chubut, Argentina BL034 T. leucocephalus Chubut, Argentina BL035 T. leucocephalus Chubut, Argentina BL036 T. leucocephalus Chubut, Argentina BL037 T. leucocephalus Chubut, Argentina BL041 T. pteneres Argentina BL042 T. pteneres Chile BL043 T. pteneres Chile GB Anas strepera Figure S4. Consensus tree resulting from the single-locus mrbayes analysis of the ND2 fragment only. Node labels indicate Bayesian posterior clade probabilites from mrbayes / maximum likelihood bootstrap values from RAxML estimated as described in the supplementary methods. Taxa are coloured and coded as in Figures 1, 2.
9 BL011 T. patachonicus Tierra del Fuego, Argentina BL015 T. patachonicus Chubut, Argentina BL019 T. patachonicus Osorno, Chile BL023 T. brachypterus FI BL024 T. brachypterus FI BL025 T. brachypterus FI BL026 T. brachypterus FI BL028 T. brachypterus FI BL030 T. brachypterus FI BL033 T. leucocephalus Chubut, Argentina BL034 T. leucocephalus Chubut, Argentina BL035 T. leucocephalus Chubut, Argentina BL036 T. leucocephalus Chubut, Argentina BL037 T. leucocephalus Chubut, Argentina BL041 T. pteneres Argentina BL042 T. pteneres Chile BL043 T. pteneres Chile 0.79/100 GB Anas strepera Figure S5. Consensus tree resulting from the single-locus mrbayes analysis of the CHD1Z fragment only. Node labels indicate Bayesian posterior clade probabilites from mrbayes / maximum likelihood bootstrap values from RAxML estimated as described in the supplementary methods. Taxa are coloured and coded as in Figures 1, 2.
10 BL011 T. patachonicus Tierra del Fuego, Argentina BL023 T. brachypterus FI BL024 T. brachypterus FI BL025 T. brachypterus FI BL019 T. patachonicus Osorno, Chile BL028 T. brachypterus FI BL026 T. brachypterus FI BL029 T. brachypterus FI EP014 T. brachypterus FI BL033 T. leucocephalus Chubut, Argentina BL034 T. leucocephalus Chubut, Argentina BL035 T. leucocephalus Chubut, Argentina BL036 T. leucocephalus Chubut, Argentina BL037 T. leucocephalus Chubut, Argentina BL041 T. pteneres Argentina BL043 T. pteneres Chile 0.82/98 BL030 T. brachypterus FI 0.69/80 BL015 T. patachonicus Chubut, Argentina BL042 T. pteneres Chile Figure S4. Consensus tree resulting from the single-locus mrbayes analysis of the MB fragment only. Node labels indicate Bayesian posterior clade probabilites from mrbayes / maximum likelihood bootstrap values from RAxML estimated as described in the supplementary methods. Taxa are coloured and coded as in Figures 1, 2.
11 REFERENCES 1. Donne-Gousse C., Laudet V., Hanni C A molecular phylogeny of anseriformes based on mitochondrial DNA analysis. Mol Phylogenet Evol 23(3), Sorenson M.D., Ast J.C., Dimcheff D.E., Yuri T., Mindell D.P Primers for a PCR-based approach to mitochondrial genome sequencing in birds and other vertebrates. Mol Phylogenet Evol 12(2), (doi: /mpev ). 3. Slade R.W., Moritz C., Heideman A., Hale P.T Rapid assessment of singlecopy nuclear DNA variation in diverse species. Mol Ecol 2(6), Peters J.L., McCracken K.G., Zhuravlev Y.N., Lu Y., Wilson R.E., Johnson K.P., Omland K.E Phylogenetics of wigeons and allies (Anatidae : Anas): the importance of sampling multiple loci and multiple individuals. Mol Phylogenet Evol 35(1), (doi: /j.ympev ). 5. Peters J.L., Zhuravlev Y.N., Fefelov I., Humphries E.M., Omland K.E Multilocus phylogeography of a holarctic duck: colonization of North America from Eurasia by gadwall (Anas strepera). Evolution 62(6), Bulgarella M., Sorenson M.D., Peters J.L., Wilson R.E., McCracken K.G Phylogenetic relationships of Amazonetta, Speculanas, Lophonetta, and Tachyeres: four morphologically divergent duck genera endemic to South America. Journal of Avian Biology 41, Stamatakis A RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 22(21), Stamatakis A., Hoover P., Rougemont J A Rapid Bootstrap Algorithm for the RAxML Web Servers. Systematic Biology 57(5), (doi:doi / ). 9. Ronquist F., Huelsenbeck J.P MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19(12), (doi:doi /Bioinformatics/Btg180). 10. Drummond A.J., Rambaut A BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology 7, 214. (doi:artn 214Doi / ). 11. Rambaut A Figtree v (Available at
Bayesian Phylogeny and Measures of Branch Support
Bayesian Phylogeny and Measures of Branch Support Bayesian Statistics Imagine we have a bag containing 100 dice of which we know that 90 are fair and 10 are biased. The
PHYML Online: A Web Server for Fast Maximum Likelihood-Based Phylogenetic Inference
PHYML Online: A Web Server for Fast Maximum Likelihood-Based Phylogenetic Inference Stephane Guindon, F. Le Thiec, Patrice Duroux, Olivier Gascuel To cite this version: Stephane Guindon, F. Le Thiec, Patrice
Data Partitions and Complex Models in Bayesian Analysis: The Phylogeny of Gymnophthalmid Lizards
Syst. Biol. 53(3):448 469, 2004 Copyright c Society of Systematic Biologists ISSN: 1063-5157 print / 1076-836X online DOI: 10.1080/10635150490445797 Data Partitions and Complex Models in Bayesian Analysis:
Molecular Clocks and Tree Dating with r8s and BEAST
Integrative Biology 200B University of California, Berkeley Principals of Phylogenetics: Ecology and Evolution Spring 2011 Updated by Nick Matzke Molecular Clocks and Tree Dating with r8s and BEAST Today
ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing.
User manual imegen Anchovies II ID kit Anchovies species (E. encrasicolus and E. japonicus) DNA detection by sequencing Reference: Made in Spain The information in this guide is subject to change without
Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013)
Protocols Internal transcribed spacer region (ITS) region Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) The nuclear ribosomal RNA (rrna) genes (small subunit, large subunit and 5.8S) are
A comparison of methods for estimating the transition:transversion ratio from DNA sequences
Molecular Phylogenetics and Evolution 32 (2004) 495 503 MOLECULAR PHYLOGENETICS AND EVOLUTION www.elsevier.com/locate/ympev A comparison of methods for estimating the transition:transversion ratio from
Supplementary Methods
Supplementary Methods DNA Sequencing Methods Most of the tissues used in this study are directly linked to morphological voucher specimens in publicly accessible natural history collections. However, 17
RT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
Phylogenetic Trees Made Easy
Phylogenetic Trees Made Easy A How-To Manual Fourth Edition Barry G. Hall University of Rochester, Emeritus and Bellingham Research Institute Sinauer Associates, Inc. Publishers Sunderland, Massachusetts
Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant. MARGARET M. KOOPMAN*, ELIZABETH GALLAGHER, and BRYAN C.
Page 1 of 28 1 1 2 3 PERMANENT GENETIC RESOURCES Isolation and characterization of nine microsatellite loci in the Pale Pitcher Plant Sarracenia alata (Sarraceniaceae). 4 5 6 MARGARET M. KOOPMAN*, ELIZABETH
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)
Troubleshooting for PCR and multiplex PCR
Page 1 of 5 Page designed and maintained by Octavian Henegariu (Email: Tavi's Yale email or Tavi's Yahoo email). As I am currently pursuing a new junior faculty position, the Yale URL and email may change
Supplementary Information - PCR amplification PCR amplification reactions for the partial mitochondrial cytochrome oxidase subunit I (COI), the
Supplementary Information - PCR amplification PCR amplification reactions for the partial mitochondrial cytochrome oxidase subunit I (COI), the ribosomal 16S rdna gene and a fragment of the nuclear single
Reliable PCR Components for Molecular Diagnostic Assays
Reliable PCR Components for Molecular Diagnostic Assays Terri McDonnell, MBA, PMP Senior Program Manager, Molecular Diagnostics March 2014 In this webinar we will: Discuss requirements for amplification
Supporting Online Material for
www.sciencemag.org/cgi/content/full/312/5781/1762/dc1 Supporting Online Material for Silk Genes Support the Single Origin of Orb Webs Jessica E. Garb,* Teresa DiMauro, Victoria Vo, Cheryl Y. Hayashi *To
A data management framework for the Fungal Tree of Life
Web Accessible Sequence Analysis for Biological Inference A data management framework for the Fungal Tree of Life Kauff F, Cox CJ, Lutzoni F. 2007. WASABI: An automated sequence processing system for multi-gene
Phylogenetic relationships among Staphylococcus species and refinement of cluster groups based on multilocus data
Lamers et al. BMC Evolutionary Biology 2012, 12:171 RESEARCH ARTICLE Open Access Phylogenetic relationships among Staphylococcus species and refinement of cluster groups based on multilocus data Ryan P
Divergence Time Estimation using BEAST v1.7.5
Divergence Time Estimation using BEAST v1.7.5 Central among the questions explored in biology are those that seek to understand the timing and rates of evolutionary processes. Accurate estimates of species
PrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
(Anisoptera: Libellulidae)
Odonatohgica34(2): 173178 June I, 2005 The morphological forms of Palpopleuralucia (Drury) are separatespecies as evidenced by DNA sequencing (Anisoptera: Libellulidae) A. Mitchell¹ and M.J. Samways ²
A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML
9 June 2011 A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML by Jun Inoue, Mario dos Reis, and Ziheng Yang In this tutorial we will analyze
A Rough Guide to BEAST 1.4
A Rough Guide to BEAST 1.4 Alexei J. Drummond 1, Simon Y.W. Ho, Nic Rawlence and Andrew Rambaut 2 1 Department of Computer Science The University of Auckland, Private Bag 92019 Auckland, New Zealand alexei@cs.auckland.ac.nz
CALIBRATING DIVERGENCE TIMES ON SPECIES TREES VERSUS GENE TREES: IMPLICATIONS FOR SPECIATION HISTORY OF APHELOCOMA JAYS
ORIGINAL ARTICLE doi:10.1111/j.1558-5646.2010.01097.x CALIBRATING DIVERGENCE TIMES ON SPECIES TREES VERSUS GENE TREES: IMPLICATIONS FOR SPECIATION HISTORY OF APHELOCOMA JAYS John E. McCormack, 1,2 Joseph
An Introduction to Phylogenetics
An Introduction to Phylogenetics Bret Larget larget@stat.wisc.edu Departments of Botany and of Statistics University of Wisconsin Madison February 4, 2008 1 / 70 Phylogenetics and Darwin A phylogeny is
ARTICLE IN PRESS. Molecular Phylogenetics and Evolution xxx (2005) xxx xxx
Molecular Phylogenetics and Evolution xxx (2005) xxx xxx MOLECULAR PHYLOGENETICS AND EVOLUTION www.elsevier.com/locate/ympev Molecular phylogeny of coleoid cephalopods (Mollusca: Cephalopoda) using a multigene
ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.
A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT
Missing data and the accuracy of Bayesian phylogenetics
Journal of Systematics and Evolution 46 (3): 307 314 (2008) (formerly Acta Phytotaxonomica Sinica) doi: 10.3724/SP.J.1002.2008.08040 http://www.plantsystematics.com Missing data and the accuracy of Bayesian
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
Bio-Informatics Lectures. A Short Introduction
Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively
A short guide to phylogeny reconstruction
A short guide to phylogeny reconstruction E. Michu Institute of Biophysics, Academy of Sciences of the Czech Republic, Brno, Czech Republic ABSTRACT This review is a short introduction to phylogenetic
GenScript BloodReady TM Multiplex PCR System
GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI
DnaSP, DNA polymorphism analyses by the coalescent and other methods.
DnaSP, DNA polymorphism analyses by the coalescent and other methods. Author affiliation: Julio Rozas 1, *, Juan C. Sánchez-DelBarrio 2,3, Xavier Messeguer 2 and Ricardo Rozas 1 1 Departament de Genètica,
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
Genomic DNA Extraction Kit INSTRUCTION MANUAL
Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview
BacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
Mitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI,
Supplemental Text/Tables PCR Amplification and Sequencing PCR was carried out in a reaction volume of 20 µl using the ABI AmpliTaq GOLD kit (ABI, Foster City, CA). Each PCR reaction contained 20 ng genomic
SOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis
SOP Title: Multiplex-PCR check of genomic DNA isolated from FFPE tissue for its usability in array CGH analysis The STORE processing methods were shown to be fit-for purpose for DNA, RNA and protein extraction
Molecular typing of VTEC: from PFGE to NGS-based phylogeny
Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing
Phylogenetic Models of Rate Heterogeneity: A High Performance Computing Perspective
Phylogenetic Models of Rate Heterogeneity: A High Performance Computing Perspective Alexandros Stamatakis Institute of Computer Science, Foundation for Research and Technology-Hellas P.O. Box 1385, Heraklion,
Mir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
Reverse Transcription System
TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/
Scaling the gene duplication problem towards the Tree of Life: Accelerating the rspr heuristic search
Scaling the gene duplication problem towards the Tree of Life: Accelerating the rspr heuristic search André Wehe 1 and J. Gordon Burleigh 2 1 Department of Computer Science, Iowa State University, Ames,
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR
Rapid Acquisition of Unknown DNA Sequence Adjacent to a Known Segment by Multiplex Restriction Site PCR BioTechniques 25:415-419 (September 1998) ABSTRACT The determination of unknown DNA sequences around
National Center for Biotechnology Information, National Library of Medicine, NIH, Bethesda, MD 20894, USA
1 2 GPT: a web-server to map phylogenetic trees on a virtual globe Pere Puigbò 1,* and Jacqueline M. Major 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 1 National Center for Biotechnology Information,
mircute mirna qpcr Detection Kit (SYBR Green)
mircute mirna qpcr Detection Kit (SYBR Green) For detection of mirna using real-time RT-PCR (SYBR Green I) www.tiangen.com QP110302 mircute mirna qpcr Detection Kit (SYBR Green) Kit Contents Cat. no. FP401
Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix
CLONING & MAPPING DNA CLONING DNA AMPLIFICATION & PCR EPIGENETICS RNA ANALYSIS Improved methods for site-directed mutagenesis using Gibson Assembly TM Master Mix LIBRARY PREP FOR NET GEN SEQUENCING PROTEIN
Taq98 Hot Start 2X Master Mix
Taq98 Hot Start 2X Master Mix Optimized for 98C Denaturation Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608) 831-9012 lucigen@lucigen.com
Analysis of the DNA Methylation Patterns at the BRCA1 CpG Island
Analysis of the DNA Methylation Patterns at the BRCA1 CpG Island Frédérique Magdinier 1 and Robert Dante 2 1 Laboratory of Molecular Biology of the Cell, Ecole Normale Superieure, Lyon, France 2 Laboratory
NimbleGen DNA Methylation Microarrays and Services
NimbleGen DNA Methylation Microarrays and Services Sample Preparation Instructions Outline This protocol describes the process for preparing samples for NimbleGen DNA Methylation microarrays using the
jmodeltest 0.1.1 (April 2008) David Posada 2008 onwards
jmodeltest 0.1.1 (April 2008) David Posada 2008 onwards dposada@uvigo.es http://darwin.uvigo.es/ See the jmodeltest FORUM and FAQs at http://darwin.uvigo.es/ INDEX 1 1. DISCLAIMER 3 2. PURPOSE 3 3. CITATION
Contents. list of contributors. Preface. Basic concepts of molecular evolution 3
list of contributors Foreword Preface page xix xxiii XXV Section I: Introduction Basic concepts of molecular evolution 3 Anne-Mieke Vandamme 1.1 Genetic information 3 1.2 Population dynamics 9 1.3 Evolution
360 Master Mix. , and a supplementary 360 GC Enhancer.
Product Bulletin AmpliTaq Gold 360 Master Mix and 360 DNA Polymerase AmpliTaq Gold 360 Master Mix AmpliTaq Gold 360 DNA Polymerase 360 Coverage for a Full Range of Targets AmpliTaq Gold 360 Master Mix
Chromatin Immunoprecipitation
Chromatin Immunoprecipitation A) Prepare a yeast culture (see the Galactose Induction Protocol for details). 1) Start a small culture (e.g. 2 ml) in YEPD or selective media from a single colony. 2) Spin
DNA Barcoding in Plants: Biodiversity Identification and Discovery
DNA Barcoding in Plants: Biodiversity Identification and Discovery University of Sao Paulo December 2009 W. John Kress Department of Botany National Museum of Natural History Smithsonian Institution New
Rules and Format for Taxonomic Nucleotide Sequence Annotation for Fungi: a proposal
Rules and Format for Taxonomic Nucleotide Sequence Annotation for Fungi: a proposal The need for third-party sequence annotation Taxonomic names attached to nucleotide sequences occasionally need to be
TIANquick Mini Purification Kit
TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer
Point of View. Missing Data in Phylogenetic Analysis: Reconciling Results from Simulations and Empirical Data JOHN J. WIENS AND MATTHEW C.
Systematic Biology Advance Access published March 28, 2011 Point of View c The Author(s) 2011. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. All rights reserved.
Evaluating the Performance of a Successive-Approximations Approach to Parameter Optimization in Maximum-Likelihood Phylogeny Estimation
Evaluating the Performance of a Successive-Approximations Approach to Parameter Optimization in Maximum-Likelihood Phylogeny Estimation Jack Sullivan,* Zaid Abdo, à Paul Joyce, à and David L. Swofford
The enigmatic monotypic crab plover Dromas ardeola is closely related to pratincoles and coursers (Aves, Charadriiformes, Glareolidae)
Short Communication Genetics and Molecular Biology, 33, 3, 583-586 (2010) Copyright 2010, Sociedade Brasileira de Genética. Printed in Brazil www.sbg.org.br The enigmatic monotypic crab plover Dromas ardeola
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
Description: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh
Speculative Moves: Multithreading Markov Chain Monte Carlo Programs
Speculative Moves: Multithreading Markov Chain Monte Carlo Programs Jonathan M. R. Byrd, Stephen A. Jarvis and Abhir H. Bhalerao Department of Computer Science, University of Warwick, Coventry, CV4 7AL,
SNP genotyping. Gene expression. And now Solexa sequencing.
SNP genotyping. Gene expression. And now Solexa sequencing. Let s find the answers together. It s your research. You question. You test. You want answers quickly, accurately, and at a good value. Illumina
Supplementary Material
Supplementary Material Fernando Izquierdo-Carrasco, John Cazes, Stephen A. Smith, and Alexandros Stamatakis November 22, 2013 Contents 1 The PUmPER Framework 2 1.1 MSA Construction/Extension with PHLAWD.........
Dating Phylogenies with Sequentially Sampled Tips
Syst. Biol. 62(5):674 688, 2013 The Author(s) 2013. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. All rights reserved. For Permissions, please email: journals.permissions@oup.com
A quick and simple method for the identi cation of meat species and meat products by PCR assay
Meat Science 51 (1999) 143±148 A quick and simple method for the identi cation of meat species and meat products by PCR assay T. Matsunaga a, K. Chikuni b *, R. Tanabe b, S. Muroya b, K. Shibata a, J.
Extensive Cryptic Diversity in Indo-Australian Rainbowfishes Revealed by DNA Barcoding
Extensive Cryptic Diversity in Indo-Australian Rainbowfishes Revealed by DNA Barcoding Kadarusman, Hubert N, Hadiaty R.K #, Sudarto, Paradis E., Pouyaud L. Akademi Perikanan Sorong, Papua Barat, Indonesia
1/12 Dideoxy DNA Sequencing
1/12 Dideoxy DNA Sequencing Dideoxy DNA sequencing utilizes two steps: PCR (polymerase chain reaction) amplification of DNA using dideoxy nucleoside triphosphates (Figures 1 and 2)and denaturing polyacrylamide
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
ab185916 Hi-Fi cdna Synthesis Kit
ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1
PHYLOGENY AND EVOLUTION OF NEWCASTLE DISEASE VIRUS GENOTYPES
Eötvös Lóránd University Biology Doctorate School Classical and molecular genetics program Project leader: Dr. László Orosz, corresponding member of HAS PHYLOGENY AND EVOLUTION OF NEWCASTLE DISEASE VIRUS
AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data
Csaba Kerepesi, Dániel Bánky, Vince Grolmusz: AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data http://pitgroup.org/amphoranet/ PIT Bioinformatics Group, Department of Computer
JERZY A. LIS 1, JOANNA OLCHOWIK 2, MAGDALENA BULIŃSKA-BALAS 3. Introduction
Preliminary studies on the usefulness of DNA mini-barcodes for determining phylogenetic relationships within shieldbugs (Hemiptera: Heteroptera: ) JERZY A. LIS 1, JOANNA OLCHOWIK 2, MAGDALENA BULIŃSKA-BALAS
Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr
User Manual Mir-X mirna First-Strand Synthesis and SYBR qrt-pcr User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories,
Amazing DNA facts. Hands-on DNA: A Question of Taste Amazing facts and quiz questions
Amazing DNA facts These facts can form the basis of a quiz (for example, how many base pairs are there in the human genome?). Students should be familiar with most of this material, so the quiz could be
complex trait evolution (i.e. polygyny, bower construction, decoration use, etc.); either
ABSTRACT Title of Dissertation: USE OF MOLECULAR TECHNIQUES TO ADDRESS THE EVOLUTION OF DISPLAY TRAITS IN THE PTILONORHYNCHIDAE AND OTHER PASSERIFORM SPECIES Paul Berton Zwiers, Doctor of Philosophy, 2009
More details on the inputs, functionality, and output can be found below.
Overview: The SMEEACT (Software for More Efficient, Ethical, and Affordable Clinical Trials) web interface (http://research.mdacc.tmc.edu/smeeactweb) implements a single analysis of a two-armed trial comparing
Bayesian coalescent inference of population size history
Bayesian coalescent inference of population size history Alexei Drummond University of Auckland Workshop on Population and Speciation Genomics, 2016 1st February 2016 1 / 39 BEAST tutorials Population
Systematic Biology. A Species Tree for the Australo-Papuan Fairy-wrens and Allies (Aves: Maluridae)
For peer review only. Do not cite. A Species Tree for the Australo-Papuan Fairy-wrens and Allies (Aves: Maluridae) Journal: Systematic Biology Manuscript ID: USYB-00-.R Manuscript Type: Regular Manuscript
Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Chapter 17 Practice Multiple Choice Identify the choice that best completes the statement or answers the question. 1. The correct order for the levels of Linnaeus's classification system,
PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org
BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,
pcas-guide System Validation in Genome Editing
pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible
Nucleic Acid Techniques in Bacterial Systematics
Nucleic Acid Techniques in Bacterial Systematics Edited by Erko Stackebrandt Department of Microbiology University of Queensland St Lucia, Australia and Michael Goodfellow Department of Microbiology University
STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR)
STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY CO VE TIO AL POLYMERASE CHAI REACTIO (PCR) jmvizcaino@vet.ucm.es Av/ Puerta de Hierro s/n. 28040 Madrid. Tel: (34) 913944082
Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011
Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)
GENOTYPING ASSAYS AT ZIRC
GENOTYPING ASSAYS AT ZIRC A. READ THIS FIRST - DISCLAIMER Dear ZIRC user, We now provide detailed genotyping protocols for a number of zebrafish lines distributed by ZIRC. These protocols were developed
Cloning Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems
Promega Notes Number 71, 1999, p. 10 Blunt-End Pfu DNA Polymerase- Generated PCR Fragments into pgem -T Vector Systems By Kimberly Knoche, Ph.D., and Dan Kephart, Ph.D. Promega Corporation Corresponding
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research. March 17, 2011 Rendez-Vous Séquençage
Advances in RainDance Sequence Enrichment Technology and Applications in Cancer Research March 17, 2011 Rendez-Vous Séquençage Presentation Overview Core Technology Review Sequence Enrichment Application
IMBB 2013. Genomic DNA purifica8on
IMBB 2013 Genomic DNA purifica8on Why purify DNA? The purpose of DNA purifica8on from the cell/8ssue is to ensure it performs well in subsequent downstream applica8ons, e.g. Polymerase Chain Reac8on (PCR),
Phylogenetic Position of the Japanese River Otter Lutra nippon Inferred from the Nucleotide Sequence of 224 bp of the Mitochondrial Cytochrome b Gene
Phylogenetic Position of the Japanese River Otter Lutra nippon Inferred from the Nucleotide Sequence of 224 bp of the Mitochondrial Cytochrome b Gene Author(s): Tomohiko Suzuki, Hajime Yuasa, and Yoshihiko
Lecture/Recitation Topic SMA 5303 L1 Sampling and statistical distributions
SMA 50: Statistical Learning and Data Mining in Bioinformatics (also listed as 5.077: Statistical Learning and Data Mining ()) Spring Term (Feb May 200) Faculty: Professor Roy Welsch Wed 0 Feb 7:00-8:0
DNA: A Person s Ultimate Fingerprint
A partnership between the UAB Center for Community Outreach Development and McWane Center DNA: A Person s Ultimate Fingerprint This project is supported by a Science Education Partnership Award (SEPA)
Terra PCR Direct Polymerase Mix User Manual
Clontech Laboratories, Inc. Terra PCR Direct Polymerase Mix User Manual Cat. Nos. 639269, 639270, 639271 PT5126-1 (031416) Clontech Laboratories, Inc. A Takara Bio Company 1290 Terra Bella Avenue, Mountain
Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3
Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA
BAPS: Bayesian Analysis of Population Structure
BAPS: Bayesian Analysis of Population Structure Manual v. 6.0 NOTE: ANY INQUIRIES CONCERNING THE PROGRAM SHOULD BE SENT TO JUKKA CORANDER (first.last at helsinki.fi). http://www.helsinki.fi/bsg/software/baps/
quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476
BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of