Genetic bases of rice grain shape: so many genes, so little known
|
|
|
- Reynold McLaughlin
- 10 years ago
- Views:
Transcription
1 Review Genetic bases of rice grain shape: so many genes, so little known Rongyu Huang 1,2,3, Liangrong Jiang 1, Jingsheng Zheng 1, Tiansheng Wang 2, Houcong Wang 1, Yumin Huang 1, and Zonglie Hong 1,3 1 School of Life Sciences, Xiamen University, Xiamen 361, China 2 Quanzhou Agricultural Sciences Institute, Quanzhou , China 3 Department of Plant, Soil, and Entomological Sciences and Program of Microbiology, Molecular Biology and Biochemistry, University of Idaho, Moscow, ID 83844, USA Rice (Oryza sativa) grain shape is a key determinant of grain yield and market values. Facilitated by advancements in genomics and various molecular markers, more than 4 quantitative trait loci (QTLs) associated with rice grain traits have been identified. In this review, we examine the genetic bases of rice grain shape, focusing on the protein products of 13 genes that have been cloned and the chromosome locations of 1 QTLs that have been fine mapped. Although more genes affecting grain traits are likely to be cloned in the near future, characterizing their functions at the biochemical level and applying these molecular data to rice breeding programs will be a more challenging task. Grain shape is a key determinant of rice yield Rice has become a useful model system for monocot plant research, largely because it has a small genome (4 Mb) compared with other major crops and because of the availability of a high-precision genomic sequence and highly saturated molecular markers [1,2]. The high degree of conservation in genome structure between rice and other important cereal crops also offers an opportunity to disseminate knowledge gained in rice genetic research to experimental work on other crop plants [3]. Rice is one of the most important cereal crops in the world, providing more than 21% of the food for the world population and up to 6% of the calorific intake in Southeast Asia [4,]. It has been estimated that a 4% increase in rice production by 23 will be needed to meet the predicted demand of the growing world population [6]. Among the strategies proposed for improving rice yield, the development and application of superior rice varieties is one of the most effective, sustainable, and economical approaches []. An ideal superior rice cultivar should have high grain-yield potential with improved grain shape, nutritional value, disease resistance, and stress tolerance. Grain yield in rice is determined by three major components: number of panicles per plant, number of grains per panicle, and grain weight. Among these, the most reliable trait is grain weight, which is measured as the 1-grain weight (KGW). Grain shape is characterized by a combination of grain length, grain width, grain Corresponding authors: Huang, Y. ([email protected]); Hong, Z. ([email protected]). length-to-width ratio, and grain thickness. These four parameters are positively correlated with grain weight [8]. Besides its contribution to grain yield, grain shape is an important quality trait that has a major impact on the market values of rice grain products. A long, slender grain of rice is generally preferred by consumers in Southern Glossary Additive effect: contribution of two or more genes to the phenotype of a trait in an additive manner. Brassinosteroid (BR) signaling pathway: a sequence of processes by which the signal of the plant hormone BR is relayed to downstream responses including cell expansion and elongation, and vascular differentiation. Collinearity: used in comparative genomics to describe conservation in the order of gene arrangement on a chromosomal segment of common evolutionary ancestry among phylogenetically related species. Dominant effect: the phenotype of one allele masks the phenotype of another allele of the same locus in heterozygotes. The allele that is masked is known as the recessive allele. Epistatic effect: contribution of two or more genes to the phenotype of a trait in a manner where the effect of one gene is modified by another gene. The gene that exerts its genetic effect is known as the epistatic gene, whereas the one whose genetic effect is suppressed is called the hypostatic gene. Floral meristem identity: characteristic anatomical structures of a flower primordium. Heterotrimeric G protein: a GTP-binding protein complex of three subunits. The a-subunit is largest in molecular mass and binds GTP. The b- and g- subunits form a tight protein complex. On activation by G protein-coupled receptors, the a-subunit dissociates from the b g complex, the two halves of which stimulate downstream enzymes of the signal transduction pathway. Next generation sequencing (NGS): DNA sequencing technologies by which hundreds of thousands of single-stranded DNA molecules are immobilized on a solid surface and their sequences are determined in a parallel manner. NGS differs fundamentally from the traditional Sanger sequencing technology. Pleiotropic effect: genetic contribution of one gene to the phenotype of more than one trait. Polygene: one group of non-allelic genes that together contribute to the phenotype of a trait. Quantitative trait locus (QTL): a genetic locus responsible for phenotypic variation of a quantitative trait. A quantitative trait is typically affected by multiple QTLs, some having a larger effect than others. Synteny: was originally introduced in cytogenetics to describe the presence of a set of genes located on the same chromosome regardless of their genetic linkage and physical location order. The term is now used widely in comparative genomics to indicate similarity in location and organization of a set of genes on a chromosome region of common evolutionary ancestry among different species. Transgressive segregation: a genetic population that has offspring individuals with extreme phenotypes exceeding the phenotypic values of their two parental lines. Ubiquitin proteasome pathway: a multiple enzyme system that labels unwanted peptides with ubiquitin and delivers them to proteasomes for protein degradation /$ see front matter ß 212 Elsevier Ltd. All rights reserved. Trends in Plant Science xx (212) 1 9 1
2 China, the USA, and South and Southeast Asian countries, whereas consumers in Japan, Korea, and Northern China prefer a rice grain that is short and round [9,1]. Most of these agronomically important traits are known to be genetically controlled by multiple genes [8], referred to as quantitative trait loci (QTLs) (see Glossary). Although some of the QTLs may have a dominant effect on one grain trait, most have been found to affect more than one trait. The identification of major QTLs for grain shape and grain weight is an important objective of rice genetic research and breeding programs. The rapid development of DNA markers and the completion of rice genome sequencing have greatly facilitated the discovery and mapping of QTLs for rice grain traits. Over the past two decades, many QTLs associated with these traits have been identified in primary and fine-mapping experiments and 13 have recently been cloned. This review focuses on the recent progress in cloned genes and fine-mapped QTLs associated with grain traits in rice. The challenges and opportunities for rice geneticists and breeders in the postgenomic era are also discussed. Genetic analysis of grain shape and weight Grain length, length-to-width ratio, and grain weight are three components that can vary dramatically depending on the rice variety (Figure 1). Grain length can be as short as 6 mm or over 1 mm, and the KGW can vary from 1 g to g. However, the grain width and grain thickness of different rice varieties are much less variable (Figure 1). Data from genetic studies conducted more than a decade ago [11 16] suggested that rice grain length, grain width, length-to-width ratio, grain thickness, and grain weight are controlled by QTLs. Grain length has been shown to be controlled by three to five major QTLs [16] that often exhibit additive effects, although dominant effects have also been detected in some studies [12,14]. However, the epistatic effects of genes for grain length have rarely been observed. Grain width has also been shown to be controlled by polygenes with either an additive effect or a dominant effect [13,1,16]. Grain thickness has been demonstrated to be determined by polygenes with additive effects, but an additional maternal effect may exist as well. Grain thickness is believed to vary, to a certain extent, depending on (a) (b) (c) Ma8 JF3 JF18 JF11 P1 DHS DHL P2 (d) OSR M T V MH63 FL FL MTV MTV OMV OMV OMT OMT MV MV C C OM OM (e) (f) T6 d11-1 d61-1 d2-1 WT srs3 TRENDS in Plant Science Figure 1. Rice grain traits and their genetic bases. (a) Isolation of long-grain mutants through mutagenesis of a short-grain cultivar. Ma8 is an indica rice cultivar grown in Fujian Province, China. Mature pollen grains of Ma8 were treated with g-rays from cobalt-6 and used to pollinate the parental plants. Seeds with long grains (JF3, JF18, and JF11) were selected from the M 2 population and maintained for more than 1 generations. A major quantitative trait locus (QTL) affecting grain length has been mapped to chromosome 2 [2] and the candidate gene has been cloned (R. Huang et al., unpublished). (b) In contrast to the highly variable grain length of rice, domesticated wheat cultivars vary only slightly in grain length. Shown are representative images of a cross used for selection of grain shape in wheat. P1, parental line Avalon; P2, parental line Cadenza; DHS, the doubled haploid (DH) line with the shortest grain; DHL, the DH line with the longest grain [14]. (c) Domesticated rice (Oryza sativa) grain ranging in length from 3 mm to 11 mm and in width from 1.2 mm to 3.8 mm [4]. (d) Dissection of the functional domains of the GS3 gene. The full-length (FL) or truncated cdna sequences of GS3 are expressed in the MH63 cultivar. Grains of T 1 transgenic plants are compared with those of MH63 [2]. Domain abbreviations: OSR, organ size regulation domain; M, putative transmembrane domain; T, TNFR/NGRF domain; V, VWFC domain. The green box represents the polypeptide sequence resulting from a frameshift. (e) Mutations in the Dwarf (D) genes result in dwarf plants (d11-1, d61-1, and d2-1) with pleiotropic effects on grain length and size [22]. T6 is the wild type parent cultivar. (f) Mutations in the SRS3 gene result in the formation of short and round grains (srs3) with pleiotropic effects on the development of other organs [34]. Scale bars: (a) 1 mm; (b,c) 2 mm; (e,f) upper, mm, lower 2 mm. (ß Elsevier, the Crop Science Society of America, American Society of Plant Biologists, National Academy of Sciences, and Oxford University Press; adapted, with permissions, from [4,2,22,2,34,14]). 2
3 the environmental conditions [13,16]. Grain length-towidth ratio is a compound trait of grain length and width [1,16] and is controlled by several genes with either an additive or a dominant effect. Grain weight is one of the key determinants of rice yield and genes associated with grain weight are mostly additive, although genes with dominant effects may also exist. Transgressive segregation has often been observed in genetic populations [16,1]. In these studies, quantity traits are usually treated as a whole and are not dissected into individual QTLs. Correlations among the five grain traits have been analyzed in many studies [1,13,16 19]. Grain length, grain width, length-to-width ratio, and grain thickness have all been shown to correlate positively with grain weight, although different studies by different groups have shown some variation in the degree of correlation. Grain length has been shown to contribute more to grain weight than other grain shape traits in some studies [1,1,19,2]. Cloned genes underlying grain shape and weight Over the past 2 years, the development of DNA markers and genomic sequencing technology have led to rapid progress in the mapping and cloning of genes underlying grain shape and grain weight in rice [2]. To date, 13 genes associated with grain shape and weight have been isolated by map-based cloning strategies. Most of them are still poorly understood, particularly with regard to their functions at the biochemical and cell biological levels [21 34]. These cloned genes can be divided into three functional groups on the basis of the phenotypes of the mutants (Table 1). The first group of cloned genes associated with grain shape and weight comprises Dwarf1 (D1), also known as the rice heterotrimeric G protein alpha subunit (RGA1), D2, D11, and D61. Mutations in these genes result in dwarf plants and have detrimental pleiotropic effects on organ growth, including a reduction in seed size. D1/RGA1 was the first gene to be cloned that had substantial effects on seed-size regulation [21,3]. An 833-base pair (bp) deletion of D1 disrupts the coding region of the heterotrimeric G protein alpha subunit and results in dwarf plant phenotypes with smaller grain. Genes affecting brassinosteroid (BR) biosynthesis and signal transduction have also been shown to regulate grain size in rice. D2 and D11 encode two cytochrome P4 oxidoreductase enzymes involved in BR biosynthesis [22,23] and D61 encodes a BR receptor, an ortholog of BRI1 in Arabidopsis (Arabidopsis thaliana) [2]. The D2 protein represents a novel type of P4 (CYP9D2) that catalyzes the steps from 6-deoxoteasterone to 3-dehydro-6-deoxoteasterone and from teasterone to 3-dehydroteasterone in the late BR biosynthesis pathway [23]. The D11 P4 (YP24B1) enzyme is required for the supply of 6-deoxotyphasterol and typhasterol in the BR biosynthesis network [22]. The second group of cloned genes associated with grain shape and weight comprises genes that appear to specifically affect grain traits. GRAIN SIZE 3 (GS3) is a major QTL for grain length and weight and a minor QTL for grain width and thickness and functions as a negative regulator for grain size [26,36]. GS3 was originally detected from the progeny produced by a cross between Minghui 63 and Chuan. The GS3 protein contains an organ size regulation (OSR) domain in the N terminus, a transmembrane domain, a tumor necrosis factor receptor/nerve growth factor receptor (TNFR/NGFR)-like domain, and a von Willebrand factor type C (VWFC) domain in the C terminus. The OSR domain functions as a negative regulator of grain length and deletion mutants of this domain result in the formation of long-grain rice. The C-terminal TNFR/NGFR and VWFC domains act as positive regulators of grain length and loss-of-function mutations of these domains lead to the development of very short grain [2,3]. A molecular maker based on GS3 has been developed for the selection of long-grain lines in rice breeding programs Table 1. Cloned genes associated with grain shape and weight in rice Gene Trait Gene difference a Encoded protein Refs D1 Seed size 833-bp deletion Heterotrimeric G protein a [21] D2 Seed size Nonsense mutation in d2-1; Cytochrome P4 (CYP9D) enzyme [23] missense mutation in d2-2 D11 Seed size 1-bp deletion in d11-1; 1-bp insertion Cytochrome P4 (CYP24B1) enzyme [22] in d11-2; missense mutation in d11-3; abnormal splicing in d11-4 D61 Seed size Missense mutation in d61-1 and d61-2 BR insensitive (BRI)-like leucine-rich [2] repeat (LRR) receptor kinase GS3 Grain length Nonsense mutation Membrane protein with multiple domains [26,2] GW2 Grain width 1-bp deletion RING-type E3 ubiquitin ligase [28] GW/qGW Grain width 1212-bp deletion Arginine-rich protein of 144 amino acids [29,42] GIF1 Grain filling 1-bp deletion Cell wall invertase [3,43] GS Grain shape 6-bp insertion Serine carboxypeptidase [32] GW8/SPL16 Grain width 1-bp deletion in the promoter SQUAMOSA promoter-binding protein-like 16 [31] SRS1/DEP2 Seed size Deletion in srs1-1 and srs1-4; nonsense Protein of 136 amino acids with unknown function [33] mutation in srs1-3; abnormal splicing in srs1-2 and srs1- SRS3 Seed size Missense mutation in srs3; nonsense Kinesin 13 protein [34] mutation in TCM68; abnormal splicing in TCM292 SRS Seed size Missense mutation Alpha-tubulin protein [24] a Genetic mutations and natural variations. 3
4 [38]. The GS3 ortholog in maize (Zea mays) has also been cloned and characterized. ZmGS3 has functional domains in common with the rice GS3 protein and ZmGS3 has been shown to be involved in maize kernel development [39]. GRAIN WIDTH 2 (GW2), a major QTL for rice grain width and weight, encodes a RING-type E3 ubiquitin ligase [28]. GW2 was initially detected from a cross between a large-grain japonica rice variety, WY3, and a small-grain indica rice variety, Fengaizhan-1. A 1-bp deletion in the GW2 gene in WY3 results in the introduction of a premature stop codon in its exon 4, causing the large-grain phenotype in WY3. GW2 negatively regulates cell division by targeting its substrates to proteasomes for regulated proteolysis; loss of GW2 function results in an increase in cell number in the spikelet hull and acceleration of the grain-milk filling rate, thus enhancing grain width, weight, and yield. There are two homologs of the rice GW2 in maize, referred to as ZmGW2-CHR4 and ZmGW2-CHR, both of which contribute to the phenotypic variation in kernel size and weight [4]. GRAIN WIDTH (GW) has been identified as a major QTL for Seed Width on chromosome (qsw) for the determination of rice grain width and weight [29,41,42]. A survey of GW/qSW polymorphisms in various rice landraces has revealed that deletions in this gene may have played an important role in the selection of increased grain size from artificial and natural crossings during rice domestication [29]. The GW/qSW gene encodes a nuclear protein of 144 amino acids with an arginine-rich domain. Because GW/qSW physically interacts with polyubiquitin, it is likely to act as a regulator in the ubiquitin proteasome pathway and regulates cell division of the outer glume of the rice spikelet [29,41,42]. The grain incomplete filling 1 (gif1) mutant was isolated from a screen for mutants with grain-filling defects. The gif1 mutant also has more grain chalkiness as a result of loosely packed starch granules. GIF1 encodes a cell-wall invertase required for carbon partitioning during early grain filling [3]. A frameshift mutation caused by a 1-bp nucleotide deletion in GIF1 results in premature termination of its open reading frame. The GIF1 gene is expressed in a more restricted pattern in the flowers of cultivated rice varieties than in the flowers of wild rice, which is apparently a consequence of accumulated changes in the regulatory sequence of the promoter as a result of domestication [3]. Its paralog CIN1 appears to have evolved through segmental duplication of chromosome 4. In contrast to GIF1, which has a domestication trace in nucleotide change in the promoter region, CIN1 contains a distinct mutation in the coding region in cultivated rice cultivars that is absent in wild-rice germplasm resources [43]. GRAIN SIZE ON CHROMOSOME (GS) is a major QTL affecting grain width, grain filling, and grain weight [32]. It encodes a serine carboxypeptidase and functions as a positive regulator of grain size. Analysis of genomic DNA sequences and promoter swaps in transgenic plants reveals that nucleotide changes in three segments of the GS promoter seem to be responsible for the variations in grain width [32]. GRAIN WIDTH 8 (GW8) was identified from a cross between HXJ4 and Basmati38 as a major QTL affecting grain width and grain yield [31]. A recent gene-cloning project has revealed that GW8 encodes SQUAMOSA promoter-binding protein-like 16, referred to as OsSPL16, which belongs to the protein family of SBP domain-containing transcription factors. There are six polymorphisms in the DNA sequence of OsSPL16 between HXJ4 and Basmati38. Among them, a 1-bp deletion in the promoter region has been shown to be responsible for the slender grain trait of Basmati38 [31]. Given that GS3, GW2, and GW/qSW act as negative regulators of grain size, GS and GW8, which act as positive regulators of cell proliferation, may have a more important role in future hybrid rice breeding programs. What will complicate these studies, however, is that all of the genes studied to date appear to have pleiotropic effects on grain shape and grain weight. For example, GS3 controls grain length, weight, width, and thickness [26]; GW2 substantially increases grain width and weight but has much less effect on grain thickness and length [28]; GW/ qsw affects grain width and weight [29,42]; and GS and GW8 control both grain width and weight [31,32]. With regard to the gene expression patterns, GS3, GS, and GW8 are expressed specifically and at a high level in young panicles, whereas GW2 is ubiquitously expressed in all organs tested [2,28,31,32]. The third group of cloned genes associated with grain shape and weight includes the SMALL AND ROUND SEED (SRS) loci identified in the japonica rice subspecies. Mutations in SRS1 result in reduction in both cell length and cell numbers in the longitudinal direction, and elongation of the cells in the lateral direction of the lemma of rice flowers. Deletions of 38 bp in srs1-1 and 31 bp in srs1-4 disrupt the coding region. Other srs1 mutant alleles are caused by alterations in the stop codon and mrna splicing sites [33]. The SRS1 mrna and proteins are abundant in young leaves, internodes, and panicles. SRS1 encodes a protein of 136 amino acids with no known functional domains [33]. The small and round seed phenotype of srs3 is a result of the reduction in cell length of the lemma. The SRS3 protein contains a kinesin motor domain and a coiled-coil structure and is a member of the kinesin 13 subfamily [34]. The cell length of the lemma in srs mutants is shorter than that in the wild type plants. A 1-bp substitution in the fourth exon of SRS is responsible for the phenotype. SRS encodes alpha-tubulin and may regulate cell elongation in a pathway independent from the BR signaling network [24]. Genetic mapping of QTLs affecting grain shape and weight In addition to the cloned genes discussed above, over 4 QTLs associated with rice grain shape and grain weight have been mapped on chromosomes in independent studies [19,44 84]. There are at least 16 QTLs that have been associated with KGW, 13 QTLs associated with grain length, and 9 QTLs associated with grain width (Figure 2a and Tables S1 S3 in the supplementary material online). The number of QTLs for grain length-to-width ratio and for grain thickness is relatively low. All of these QTLs have been integrated into the public Simple Sequence Repeat (SSR) genetic map of rice [8 8] and are unevenly 4
5 (a) (b) Number of QTLs for grain shape GL GW LWR GT KGW Grain trait Number of QTLs for grain shape Chromosome number TRENDS in Plant Science Figure 2. Number and distribution of quantitative trait loci (QTLs) for rice grain traits. (a) Number of QTLs associated with grain length (GL), grain width (GW), length-towidth ratio (LWR), grain thickness (GT), and 1-grain weight (KGW). Data were collected from all accessible public references. (b) Distribution of QTLs for grain shape on the 12 rice chromosomes. Data on the QTLs associated with rice grain shape and weight were collected from all published references D2 31 GW1.1 3 GW D qgrl Chr 1 RM 499 RG 42 RM 46 A RM 283 RM 22 RM 49 RM 8 RM 312 RM 62 RM 36 RM 246 RM 128 RM 32 RM 486 RM 42 RM 29 RM GW2 6 RM 48 RM 14 RM RM Chr 2 Chr 3 Chr 4 Chr Chr 6 RM 423 RM RM 14 RM RM 42 RM 324 RM 262 RM 4 RM 183 RM 263 RM 26 RM 2 RM 318 RM 24 RM 2 RM 166 RM RM qgl3a 113 GW GS3 128 GW RM 6 RM 3 RM 13 RM RM 41 D1 RM RM RM GS 31 RM RM RM RM 4 1 RM 18 GW 1 6 RM 41 RM 289 SRS3 RM RM RM RM 119 GIF1 8 RM 163 RM 63 qgl4 GW RM 44 RM 23 9 RM 3 RM 282 D11 99 RM RM RM RM 43D RM RM RM RM RM RM RM RM RM RM 3 RM 4 1 RM 9 3 RM 168 RM 2 RM 468 RM 13 RM RM 4 RM 19 RM 1 RM 24 RM 314 RM 42 RM 49 RM 138 RM 41 RM 44 RM 2 RM 343 RM 3 RM 34 RM 412 RG RM 8 qss GS SRS1 9 qgl Chr Chr 8 Chr 9 Chr 1 Chr 11 Chr 12 RM 436 RM 6 RG RM 44 RM 28 RM 41 3 RM RM 4A 9 RM 12 3 RM RM RM RM RM RZ 638 RM RM RM 36 2 RM RM 311 RM 332 RM RM 32B RM RM 491 RM RM 44 RM RM 441 RM RM 46 4 RM 83 2 SRS RM 2 RM 96 RM 22 RM 2 RM RM RM 21 2 RM 2 RM 4 64 RM RM 26 RM RM RM RM RM RM 34 RM 39 RM RM 1 8 RM 28 RM RM RM 234 GW8.1 8 RM 294A 86 RM 21 9 RM 21 GW RM 2 11 RM 118 RM 248 SPL RM 26 RM 36 RM 23 RM 2 RM RM 21 RM RM 484 RM 333 RM 91 tgw RM 43E RM 26 RM 24 RM 224 RM RM 23 RM 1 TRENDS in Plant Science Figure 3. Distribution of quantitative trait loci (QTLs) for grain traits on rice chromosomes. The positions (cm) of the SSR markers of rice chromosomes are derived from the Cornell SSR 21 ( Major QTLs associated with grain shape and weight that have been characterized by gene cloning (labeled in red) (Table 1) or by fine mapping (labeled in green) (Table 2). The locations of QTLs affecting grain shape and weight that have been identified only in primary mapping experiments are indicated by blue bars with the corresponding number of QTLs. Some segments of the chromosomes have more QTLs affecting grain shape and weight than others.
6 Table 2. Fine-mapped QTLs associated with grain shape in rice Trait QTL Chromosome Marker interval Distance a Parents and population b Refs GL c qgl-3a 3 RMw3 RMw33 8. kb Asominori/IR24 RILs, CSSLs, BC 4 F 2, BC 4 F 3 [8] GL qgl4b 4 RM86 RM324 3 Mb Cytoto/kasalath F 2 F [92] GL qgl RID11 RM kb Nanyangzhan/Chuan RILs and NIL-F 2 [88] GL GS Indel3 Indel 4.8 kb D/HB2 RHL [9] GL qss GL293 GL28 23 kb ZS9/Cypress CSSL [91] GL qgrl1 1 RM431 CHR kb Pusa1121/Pusa1342 RIL F 6 [84] GL LGS1 2 RM13838 RM cm JF11/Samba BC 2 F 2 [2] KGW gw3.1 3 JL123 JL kb Jefferson/Oryza rufipogon BC 2 F 2 [62] KGW GW3 3 WGW16 WGW kb Baodali/Zhonghua 11 F 2, F 3, BC 2 F 2 [93] KGW GW6 6 RM19 RM cm Baodali/Zhonghua 11 F 2, F 3, BC 2 F 2 [93] KGW gw8.1 8 RM2321.CNR1 RM3.CNR kb Hwaseongbyeo/O. rufipogon BC 3 F 4 [94] KGW gw9.1 9 RM2418.CNR11 RM3.CNR kb Hwaseongbyeo/ [9] O. rufipogon BC 3 F 4 NIL KGW tgw11 11 RM224 RM238 9 kb Hwaseong/Oryza grandiglumis NIL [96] KGW GW1 1 1 RM136 RM kb ZS9B/MY46 RHLs [9] KGW GW1 2 1 RM144 RM kb ZS9B/MY46 RHLs [9] a Distance: genetic distance (cm) or physical distance (kb). b Parents and population: parents used for crossing and genetic populations used in quantitative trait locus (QTL) mapping. c Abbreviation: GL, grain length; KGW, 1-grain weight. distributed among the twelve rice chromosomes (Figure 2b). As shown in Figure 3, most of the major QTLs for grain traits that have been fine mapped or cloned are located in regions that have a high concentration of QTLs. Among the QTLs that have been detected in genetic analyses but have not been cloned, 1 loci have been fine mapped on chromosomes (Table 2). qgl, a QTL for grain length on chromosome, has been shown to cosegregate with InDel markers RID1 and RID6 and has been mapped to a 28-kb fragment of genomic DNA between InDel marker RID11 and the SSR marker RM6389 [88]. qgl exhibits pleiotropic effects on grain length, grain width, grain thickness, and KGW. Another major QTL for grain length, qgl-2, was originally mapped to a 28-kb interval of chromosome between markers of Indel1 and RM2194 at a location 13.2 cm from qgl [89]. The interval has recently been narrowed down to a 4.8-kb genomic DNA fragment that contains two open reading frames encoding proteins with unknown functions. qgl-2 has been renamed GS for its pleiotropic effects on grain shape traits [9]. Another major QTL for grain length, qss, has been mapped to a 23-kb interval between GL293 and GL28 that contains two open reading frames [91]. A QTL for grain length, qgl4b, has recently been fine mapped to a 3-Mb segment between RM86 and RM324 on chromosome 4, using a population derived from a cross between the japonica cultivar Cytoto and the indica variety Kasalath [92]. A major QTL for grain length, qgrl-1.1 has been mapped to a 18-kb region between markers RM431 and CHR1.1 on chromosome 1 [84]. GW3 and GW6 are major grain weight QTLs that have been fine mapped on chromosome 3 and 6, respectively. GW3 has been narrowed down to a 122-kb physical distance containing 16 open reading frames. The cloned GS3 gene is located in this region and it remains to be determined whether they represent the same locus. GW6 has been localized to an interval between the SSR marker RM19 and RM318 [93]. GW8.1, a QTL for grain weight, has been mapped to a 36-kb interval between RM2321.CNR11 and RM3.CNR99 on chromosome 8 [94]. Another grain weight QTL, GW9.1, has been mapped to a 3.4-kb region containing seven predicted open reading frames [9]. A QTL for grain weight, tgw11, has been mapped to a 9-kb interval between markers RM224 and RM238 [96]. Two QTLs for grain weight, GW1-1 and GW1-2, have been mapped on chromosome 1 [9]. GW1-1 is located in a kb region between markers RM136 and RM1398, whereas GW1-2 is mapped to a 38.-kb interval between RM144 and RM1344. They are likely to represent two tightly linked genes. Candidate genes for some of these fine-mapped QTLs have already been isolated but have not been confirmed and are regarded as fine-mapped loci in this review. Supporting evidence from functional complementation tests remains the gold standard for verification of these cloned candidate genes. The remaining fine-mapped QTLs are likely to be cloned in the near future. Genes associated with seed size in other plants In contrast to the rapid progress that has been made in cloning QTLs for rice grain shape and weight, our knowledge about the molecular mechanisms underlying the control of seed size and weight in other crops remains limited. Compared with rice, the molecular cloning of genes responsible for seed weight in other cereal crops, such as wheat (Triticum aestivum), maize, and sorghum (Sorghum bicolor), is lagging behind. ZmGS3 and ZmGW2 have recently been identified in maize; the approach adopted for these investigations was based largely on the cloning results of orthologous genes in rice [39,4]. Several key genes associated with seed size and seed mass control have been cloned and studied in Arabidopsis, a noncrop dicot model plant [98 12]. Arabidopsis APETALA2 (AP2) encodes a transcription factor that is involved in the specification of floral organ identity and development of the ovule and seed coat [11]. Loss-of-function ap2 mutations cause an increase in seed mass [1,11]. Arabidopsis DA1, encoding a ubiquitin receptor, has been shown to set final seed and organ size [12]. MINI3 and IKU2 have also been 6
7 identified as regulators of seed size in Arabidopsis [13]. An Arabidopsis seed contains mostly the embryo, whereas a rice grain is filled mainly with the endosperm. Thus, caution must be exercised when applying knowledge gained from Arabidopsis research to rice. Concluding remarks Facilitated by the recent development of molecular biotechnology, genomics, and bioinformatics, the fine mapping and gene cloning of major QTLs associated with rice grain shape and weight has proceeded at a rapid pace for the past 2 years. Of the several hundred QTLs that have been detected by primary mapping (Figure 3 and Tables S1 S3 in the supplementary material online), only 13 genes have been cloned (Table 1) and 1 have been fine mapped (Table 2). There remains a long way to go to complete the cloning work for most clonable QTLs. The completion of highly accurate rice genome information, development of high-throughput sequencing and genotyping technologies, and a drastic reduction in the cost of whole-genome sequencing using the next-generation sequencing technology will accelerate the pace of gene cloning in rice. The plan to sequence 1 rice accessions and the development of extensive single nucleotide polymorphism (SNP) chips are just two examples of current efforts in the rice research community to decipher the complexity of rice germplasm. The successful completion of these projects will allow rice researchers to pinpoint specific genes that confer desirable traits and to accelerate the pace of fine-mapping and rice-breeding work. It is likely that many genes associated with rice grain development will be cloned in the near future. However, the successful cloning of a locus is not the end of the quest for that genetic element, but the start of a new journey to determine how the gene works. Elucidating the biochemical pathways and understanding the molecular mechanisms underlying rice grain development is likely to remain a challenging task for rice researchers for many years to come. As a model crop that shares close synteny and collinearity with other agronomically important cereals, rice offers a great opportunity for understanding how grain development is regulated, which should benefit breeding programs and the biotechnology industry in their attempts to improve the yield and quality of food crops. A close collaboration between rice geneticists and breeders will facilitate transfer of the achievements gained from genetic and genomic studies into breeding programs. There have been recent successes using cloned gene-based markers for the breeding of rice varieties with improved yield, grain shape, and nutritional quality [36,38]. As more genes are cloned and the interactions among these genes are identified and their biochemical pathways elucidated, the ultimate goal of integrating multiple favorable genes in one rice variety will become possible. Acknowledgments We thank Allan Caplan for critical reading of this manuscript. This work was supported by grants from the National Natural Science Foundation of China (311866), Fujian Province Science and Technology Major Projects (28NZ1-1), and the Basic Research Funds for Central Universities ( ). R.H. was supported by fellowships from Xiamen University and Quanzhou city for visiting research abroad. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at j.tplants References 1 Xing, Y.Z. and Zhang, Q.F. (21) Genetic and molecular bases of rice yield. Annu. Rev. Plant Biol. 61, Ashikari, M. and Matsuoka, M. (26) Identification, isolation and pyramiding of quantitative trait loci for rice breeding. Trends Plant Sci. 11, Devos, K.M. (2) Updating the crop circle. Curr. Opin. Plant Biol. 8, Fitzgerald, M.A. et al. (29) Not just a grain of rice: the quest for quality. Trends Plant Sci. 14, Miura, K. et al. (211) The role of QTLs in the breeding of highyielding rice. Trends Plant Sci. 16, Khush, G.S. (2) What it will take to feed. billion rice consumers in 23. Plant Mol. Biol. 9, 1 6 Rosegrant, M.W. and Cline, S.A. (23) Global food security: challenges and policies. Science 32, Tan, Y.F. et al. (2) Genetic bases of appearance quality of rice grains in Shanyou 63, an elite rice hybrid. Theor. Appl. Genet. 11, Unnevehr, L. (1992) Consumer Demand for Rice Grain Quality, International Rice Research Institute and International Development Research Center 1 Juliano, B. and Villareal, C. (1993) Grain Quality Evaluation of World Rice, International Rice Research Institute 11 Zhou, Y.Q. et al. (2) Study on heredity of morphological character of rice grain. J. Southwest Agric. Univ. 22, Shi, Q.H. and Shen, Z.T. (1994) Analysis of genetic effects of grain trait in indica rice. J. Zhejiang Agric. Univ. 2, Shi, Q.H. and Shen, Z.T. (199) Inheritance and improvement of grain shape in indica rice. Chin. J. Rice Sci. 9, Shi, Q.H. and Shen, Z.T. (1996) Additive and dominance correlation analysis of grain shape and yield traits in incica rice. Acta Agron. Sin. 22, Fu, F.H. et al. (1994) Genetic analysis on grain characters in hybrid rice. Acta Agron. Sin. 2, Yang, L.S. et al. (21) Research progress of rice grain type and its inheritance. J. Anfui Agric. Sci. 29, Rui, C.Q. and Zhao, A.C. (1983) Genetic analysis of weight and shape F 1 s grain by diallel crossing methods in indica rice. Sci. Agric. Sin., Zhang, L.Q. (2) Correlation analysis between grain shape and brown rice shape in hybrid rice. Fujian Sci. Technol. Rice Wheat 18, Lin, L.H. and Wu, W.R. (23) Mapping of QTLs underlying grain shape and grain weight in rice. Mol. Plant Breed. 1, Huang, R. et al. Identification of major QTLs associated with grain shape and grain weight in rice. Crop Sci. (in press) 21 Ashikari, M. et al. (1999) Rice gibberellin-insensive dwarf mutant gene Dwarf 1 encodes the a-subunit of GTP-binding protein. Proc. Natl. Acad. Sci. U.S.A. 96, Tanabe, S. et al. (2) A novel cytochrome P4 is implicated in brassinosteroid biosynthesis via the characterization of a rice dwarf mutant, dwarf11, with reduced seed length. Plant Cell 1, Hong, Z. et al. (23) A rice brassinosteroid-deficient mutant, ebisu dwarf (d2), is caused by a loss of function of a new member of cytochrome P4. Plant Cell 1, Segami et al. (212) Small and round seed gene encodes alphatubulin regulating seed cell elongation in rice. Rice, 4 2 Yamamuro, C. et al. (2) Loss of function of a rice brassinosteroid insensitive1 homolog prevents internode elongation and bending of the lamina joint. Plant Cell 12, Fan, C. et al. (26) GS3, a major QTL for grain length and weight and minor QTL for grain width and thickness in rice, encodes a putative transmembrane protein. Theor. Appl. Genet. 112, Mao, H. et al. (21) Linking differential domain functions of the GS3 protein to natural variation of grain size in rice. Proc. Natl. Acad. Sci. U.S.A. 1,
8 28 Song, X.J. et al. (2) A QTL for rice grain width and weight encodes a previously unknown RING-type E3 ubiquitin ligase. Nat. Genet. 39, Shomura, A. et al. (28) Deletion in a gene associated with grain size increased yields during rice domestication. Nat. Genet. 4, Wang, E. et al. (28) Control of rice grain-filling and yield by a gene with a potential signature of domestication. Nat. Genet. 4, Wang, S. et al. (212) Control of grain size, shape and quality by OsSPL16 in rice. Nat. Genet. 44, Li, Y. et al. (211) Natural variation in GS plays an important role in regulating grain size and yield in rice. Nat. Genet. 43, Abe, Y. et al. (21) The SMALL AND ROUND SEED1 (SRS1/DEP2) gene is involved in the regulation of seed size in rice. Genes Genet. Syst. 8, Kitagawa, K. et al. (21) A novel kinesin 13 protein regulating rice seed length. Plant Cell Physiol. 1, Fujisawa, Y. et al. (1999) Suppression of the heterotrimeric G protein causes abnormal morphology, including dwarfism, in rice. Proc. Natl. Acad. Sci. U.S.A. 96, 8 36 Fan, C. et al. (29) A causal C-A mutation in the second exon of GS3 highly associated with rice grain length and validated as a functional marker. Theor. Appl. Genet. 118, Takano-Kai, N. et al. (29) Evolutionary history of GS3, a gene conferring grain length in rice. Genetics 182, Wang, C. et al. (211) Functional markers developed from multiple loci in GS3 for fine marker-assisted selection of grain length in rice. Theor. Appl. Genet. 122, Li, Q. et al. (21) Cloning and characterization of a putative GS3 ortholog involved in maize kernel development. Theor. Appl. Genet. 12, Li, Q. et al. (21) Relationship, evolutionary fate and function of two maize co-orthologs of rice GW2 associated with kernel size and weight. BMC Plant Biol. 1, Wan, X. et al. (28) Quantitative trait loci (QTL) analysis for rice grain width and fine mapping of an identified QTL allele gw- in a recombination hotspot region on chromosome. Genetics 19, Weng, J.F. et al. (28) Isolation and initial characterization of GW, a major QTL associated with rice grain width and weight. Cell Res. 18, Wang, E. et al. (21) Duplication and independent selection of cellwall invertase genes GIF1 and OsCIN1 during rice evolution and domestication. BMC Evol. Biol. 1, Aluko, G. et al. (24) QTL mapping of grain quality traits from the interspecific cross Oryza sativa x O. glaberrima. Theor. Appl. Genet. 19, Wang, C.M. et al. (22) Analysis QTL of grain shape by using of RFLP map in rice. J. Jilin Agric. Sci. 2, 3 46 Wang, B. et al. (23) Identification of QTLs underlining grain traits in rice using SSLP linkage map. Fujian J. Agric. Sci. 18, Chen, B.X. et al. (28) QTL detection of grain size and shape with BC 2 F 2 advanced backcross population of rice. Acta Agron. Sin. 34, Lin, H.X. et al. (199) RFLP mapping of QTLs for grain shape traits in indica rice. Sci. Agric. Sin. 28, 1 49 Huang, N. et al. (199) RFLP mapping of isozymes, RAPD and QTLs for grain shape, brown planthopper resistance in a doubled haploid rice population. Mol. Breed. 3, Xu, J.L. et al. (22) Genetic dissection of grain weight and its related traits in rice (Oryza sativa L.). Chin. J. Rice Sci. 16, Marri, P.R. et al. (2) Identification and mapping of yield and yield related QTLs from an Indian accession of Oryza rufipogon. BMC Genet. 6, 33 2 Moncada, P. et al. (21) Quantitative trait loci for yield and yield components in an Oryza sativa x Oryza rufipogon BC 2 F 2 population evaluated in an upland environment. Theor. Appl. Genet. 12, Rabiei, B. et al. (24) Identification of QTLs for rice grain size and shape of Iranian cultivars using SSR markers. Euphytica 13, Redona, E.D. and Mackill, D.J. (1998) Quantitative trait locus analysis for rice panicle and grain characteristics. Theor. Appl. Genet. 96, Septiningsih, E.M. et al. (23) Identification of quantitative trait loci for yield and yield components in an advanced backcross population derived from the Oryza sativa variety IR64 and the wild relative O. rufipogon. Theor. Appl. Genet. 1, Wan, X.Y. et al. (24) Stable expression of QTL for grain shape of milled rice (Oryza sativa L.) using a CSSLs population. Acta Genet. Sin. 31, Wan, X.Y. et al. (2) Stability of QTLs for rice grain dimension and endosperm chalkiness characteristics across eight environments. Theor. Appl. Genet. 11, Wan, X.Y. et al. (26) QTL analysis for rice grain length and fine mapping of an identified QTL with stable and major effects. Theor. Appl. Genet. 112, Xing, Y.Z. et al. (21) Mapping quantitative trait loci for grain appearance traits of rice using a recombinant inbred line population. Acta Bot. Sin. 43, Yan, C.J. et al. (23) Mapping quantitative trait loci associated with rice grain shape based on an indica/japonica backcross population. Acta Genet. Sin. 3, Yoon, D.B. et al. (26) Mapping quantitative trait loci for yield components and morphological traits in an advanced backcross population between Oryza grandiglumis and the O. sativa japonica cultivar Hwaseongbyeo. Theor. Appl. Genet. 112, Li, J.M. et al. (24) Fine mapping of a grain-weight quantitative trait locus in the pericentromeric region of rice chromosome 3. Genetics 168, Li, J.M. et al. (24) QTL detection for rice grain quality traits using an interspecific backcross population derived from cultivated Asian (O. sativa L.) and African (O. glaberrima S.) rice. Genome 4, Li, Z.F. et al. (22) Mapping quantitative trait loci controlling yield and its related characters in rice (Oryza sativa L.). J. Nanjing Agric. Univ. 2, Li, Z.F. et al. (23) Mapping quantitative trait loci underlying appearance quality of rice grains (Oryza sativa L.). Acta Genet. Sin. 3, Zhang, Q. et al. (211) Identification of QTLs for grain traits in rice using extreme materials in grain size. Acta Agron. Sin. 3, Zhao, M.F. et al. (28) Genetic analyses and mapping of a major dominant QTL for grain length in rice. Mol. Plant Breed. 6, Zhou, L.Q. et al. (26) Genetic analysis and physical mapping of Lk- 4(t), a major gene controlling grain length in rice, with a BC 2 F 2 population. Acta Genet. Sin. 33, Zhuang, J.Y. et al. (22) Analysis on additive effects and additive-byadditive epistatic effects of QTLs for yield traits in a recombinant inbred line population of rice. Theor. Appl. Genet. 1, Amarawathi, Y. et al. (28) Mapping of quantitative trait loci for basmati quality traits in rice (Oryza sativa L.). Mol. Breed. 21, Brondani, C. et al. (22) QTL mapping and introgression of yieldrelated traits from Oryza glumaepatula to cultivated rice (Oryza sativa) using microsatellite markers. Theor. Appl. Genet. 14, Li, Z. et al. (199) Epistasis for three grain yield components in rice (Oryza sativa L.). Genetics 14, Li, J. et al. (2) Analyzing quantitative trait loci for yield using a vegetatively replicate F 2 population from a cross between the parents of an elite rice hybrid. Theor. Appl. Genet. 11, Liu, T. et al. (21) Mapping and validation of quantitative trait loci for spikelets per panicle and 1,-grain weight in rice (Oryza sativa L.). Theor. Appl. Genet. 12, Redona, E. et al. (1998) Quantitative trait locus analysis for rice panicle and grain characteristics. Theor. Appl. Genet. 96, Yoshida, S. et al. (22) QTL analysis for plant and grain characters of sake-brewing rice using a double haploid population. Breed. Sci. 2, Yao, G. et al. (21) Mapping QTLs for grain weight and shape using four sister near isogenic lines in rice (Oryza sativa L.). Acta Agron. Sin. 36, Zou, G. et al. (2) Grain yield responses to moisture regimes in a rice population: association among traits and genetic markers. Theor. Appl. Genet. 112, Bai, X. et al. (211) Quantitative trait loci for rice yield-related traits using recombinant inbred lines derived from two diverse cultivars. J. Genet. 9, Liang, Y. et al. (212) Mapping of QTLs associated with important agronomic traits using three populations derived from a super hybrid rice xieyou938. Euphytica 184,
9 81 Marathi, B. et al. (212) QTL analysis of novel genomic regions associated with yield and yield related traits in new plant type based recombinant inbred lines of rice (Oryza sativa L.). BMC Plant Biol. 12, Yuan, P. et al. (29) QTL dissection of agronomic and domestication traits using introgression lines carrying wild rice (Oryza rufipogon Griff.) segments in cultivated rice (O. sativa L.) background. J. Crop Sci. Biotechnol. 12, Zhang, H. et al. (212) Simultaneous improvement and genetic dissection of grain yield and its related traits in a backbone parent of hybrid rice (Oryza sativa L.) using selective introgression. Mol. Breed Singh, R. et al. (212) Fine mapping of grain length QTLs on chromosomes 1 and in Basmati rice (Oryza sativa L.). J. Plant Biochem. Biotechnol. 21, Temnykh, S. et al. (2) Mapping and genome organization of microsatellite sequences in rice (Oryza sativa L.). Theor. Appl. Genet. 1, Temnykh, S. et al. (21) Computational and experimental analysis of microsatellites in rice (Oryza sativa L.): Frequency, length variation, transposon associations, and genetic marker potential. Genome Res. 11, McCouch, S.R. et al. (22) Development and mapping of 224 New SSR markers for rice (Oryza sativa L.). DNA Res. 9, Bai, X. et al. (21) Genetic dissection of rice grain shape using a recombinant inbred line population derived from two contrasting parents and fine mapping a pleiotropic quantitative trait locus qgl. BMC Genet. 11, Shao, G. et al. (21) Mapping of qgl-2, a grain length QTL on chromosome of rice. J. Genet. Genomics 3, Shao, G. et al. (212) Allelic variation for a candidate gene for GS, responsible for grain shape in rice. Theor. Appl. Genet. 12, Qiu, X. et al. (212) Mapping and characterization of the major quantitative trait locus qss associated with increased length and decreased width of rice seeds. Theor. Appl. Genet. 12, Kato, T. et al. (211) Detection of QTLs for grain length from large grain rice (Oryza sativa L.). Breed. Sci. 61, Guo, L. et al. (29) Genetic analysis and fine mapping of two genes for grain shape and weight in rice. J. Integr. Plant Biol. 1, Xie, X.B. et al. (26) Fine mapping of a grain weight quantitative trait locus on rice chromosome 8 using near-isogenic lines derived from a cross between Oryza sativa and Oryza rufipogon. Theor. Appl. Genet. 113, Xie, X.B. et al. (28) Fine mapping of a yield-enhancing QTL cluster associated with transgressive variation in an Oryza sativa x O. rufipogon cross. Theor. Appl. Genet. 116, Oh, J. et al. (211) Fine mapping of grain weight QTL, tgw11 using near isogenic lines from a cross between Oryza sativa and O. grandiglumis. Genes Genomics 33, Yu, S. et al. (28) Genetic dissection of a thousand-grain weight quantitative trait locus on rice chromosome 1. Chin. Sci. Bull. 3, Disch, S. et al. (26) The E3 ubiquitin ligase BIG BROTHER controls Arabidopsis organ size in a dosage-dependent manner. Curr. Biol. 16, Garcia, D. et al. (2) Maternal control of integument cell elongation and zygotic control of endosperm growth are coordinated to determine seed size in Arabidopsis. Plant Cell 1, Jofuku, K.D. et al. (2) Control of seed mass and seed yield by the floral homeotic gene APETALA2. Proc. Natl. Acad. Sci. U.S.A. 12, Ohto, M.A. et al. (2) Control of seed mass by APETALA2. Proc. Natl. Acad. Sci. U.S.A. 12, Li, Y.H. et al. (29) Control of final seed and organ size by the DA1 gene family in Arabidopsis thaliana. Genes Dev. 22, Luo, M. et al. (2) MINISEED3 (MINI3), a WRKY family gene, and HAIKU2 (IKU2), a leucine-rich repeat (LRR) KINASE gene, are regulators of seed size in Arabidopsis. Proc. Natl. Acad. Sci. U.S.A. 12, Gegas, V.C. et al. (21) A genetic framework for grain size and shape variation in wheat. Plant Cell 22,
Marker-Assisted Backcrossing. Marker-Assisted Selection. 1. Select donor alleles at markers flanking target gene. Losing the target allele
Marker-Assisted Backcrossing Marker-Assisted Selection CS74 009 Jim Holland Target gene = Recurrent parent allele = Donor parent allele. Select donor allele at markers linked to target gene.. Select recurrent
TARGETED INTROGRESSION OF COTTON FIBER QUALITY QTLs USING MOLECULAR MARKERS
TARGETED INTROGRESSION OF COTTON FIBER QUALITY QTLs USING MOLECULAR MARKERS J.-M. Lacape, T.-B. Nguyen, B. Hau, and M. Giband CIRAD-CA, Programme Coton, TA 70/03, Avenue Agropolis, 34398 Montpellier Cede
Deletion in a gene associated with grain size increased yields during rice domestication
Deletion in a gene associated with grain size increased yields during rice domestication Ayahiko Shomura,, Takeshi Izawa 2,, Kaworu Ebana, Takeshi Ebitani 4, Hiromi Kanegae, Saeko Konishi 2 & Masahiro
GENE CLONING AND RECOMBINANT DNA TECHNOLOGY
GENE CLONING AND RECOMBINANT DNA TECHNOLOGY What is recombinant DNA? DNA from 2 different sources (often from 2 different species) are combined together in vitro. Recombinant DNA forms the basis of cloning.
BioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
Genetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
MOLECULAR MARKERS AND THEIR APPLICATIONS IN CEREALS BREEDING
MOLECULAR MARKERS AND THEIR APPLICATIONS IN CEREALS BREEDING Viktor Korzun Lochow-Petkus GmbH, Grimsehlstr.24, 37574 Einbeck, Germany [email protected] Summary The development of molecular techniques
Genetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
Gene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
PLANT BREEDING: CAN METABOLOMICS HELP?
PLANT BREEDING: CAN METABOLOMICS HELP? Carlos Muñoz Schick Ingeniero Agrónomo, M.S., Ph.D. UNIVERSIDAD DE CHILE Facultad de Ciencias Agronómicas OUTLINE OF THE PRESENTATION Origin of Plant Breeding Domestication
Lecture 3: Mutations
Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)
Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
Site-Directed Nucleases and Cisgenesis Maria Fedorova, Ph.D.
Site-Directed Nucleases and Cisgenesis Maria Fedorova, Ph.D. Regulatory Strategy Lead Enabling Technologies DuPont-Pioneer, USA 1 New Plant Breeding Techniques 2007 New Techniques Working Group established
Arabidopsis. A Practical Approach. Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham
Arabidopsis A Practical Approach Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham OXPORD UNIVERSITY PRESS List of Contributors Abbreviations xv xvu
AP BIOLOGY 2010 SCORING GUIDELINES (Form B)
AP BIOLOGY 2010 SCORING GUIDELINES (Form B) Question 2 Certain human genetic conditions, such as sickle cell anemia, result from single base-pair mutations in DNA. (a) Explain how a single base-pair mutation
Sickle cell anemia: Altered beta chain Single AA change (#6 Glu to Val) Consequence: Protein polymerizes Change in RBC shape ---> phenotypes
Protein Structure Polypeptide: Protein: Therefore: Example: Single chain of amino acids 1 or more polypeptide chains All polypeptides are proteins Some proteins contain >1 polypeptide Hemoglobin (O 2 binding
Recombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
The correct answer is c A. Answer a is incorrect. The white-eye gene must be recessive since heterozygous females have red eyes.
1. Why is the white-eye phenotype always observed in males carrying the white-eye allele? a. Because the trait is dominant b. Because the trait is recessive c. Because the allele is located on the X chromosome
SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE
AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,
MUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
Human Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
Biology Final Exam Study Guide: Semester 2
Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion
Genetics 301 Sample Final Examination Spring 2003
Genetics 301 Sample Final Examination Spring 2003 50 Multiple Choice Questions-(Choose the best answer) 1. A cross between two true breeding lines one with dark blue flowers and one with bright white flowers
Introductory genetics for veterinary students
Introductory genetics for veterinary students Michel Georges Introduction 1 References Genetics Analysis of Genes and Genomes 7 th edition. Hartl & Jones Molecular Biology of the Cell 5 th edition. Alberts
Plant Growth & Development. Growth Stages. Differences in the Developmental Mechanisms of Plants and Animals. Development
Plant Growth & Development Plant body is unable to move. To survive and grow, plants must be able to alter its growth, development and physiology. Plants are able to produce complex, yet variable forms
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
TEXAS A&M PLANT BREEDING BULLETIN
TEXAS A&M PLANT BREEDING BULLETIN October 2015 Our Mission: Educate and develop Plant Breeders worldwide Our Vision: Alleviate hunger and poverty through genetic improvement of plants A group of 54 graduate
Genomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
Gene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
Bio EOC Topics for Cell Reproduction: Bio EOC Questions for Cell Reproduction:
Bio EOC Topics for Cell Reproduction: Asexual vs. sexual reproduction Mitosis steps, diagrams, purpose o Interphase, Prophase, Metaphase, Anaphase, Telophase, Cytokinesis Meiosis steps, diagrams, purpose
Statistical approaches in QTL mapping and molecular breeding for complex traits
Progress SPECIAL ISSUE Quantitative Genetics doi: 10.1007/s11434-012-5107-1 Statistical approaches in QTL mapping and molecular breeding for complex traits XU HaiMing & ZHU Jun * Institute of Bioinformatics,
RNA and Protein Synthesis
Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic
MCAS Biology. Review Packet
MCAS Biology Review Packet 1 Name Class Date 1. Define organic. THE CHEMISTRY OF LIFE 2. All living things are made up of 6 essential elements: SPONCH. Name the six elements of life. S N P C O H 3. Elements
Chapter 9 Patterns of Inheritance
Bio 100 Patterns of Inheritance 1 Chapter 9 Patterns of Inheritance Modern genetics began with Gregor Mendel s quantitative experiments with pea plants History of Heredity Blending theory of heredity -
Genetic mapping of fiber color genes on two brown cotton cultivars in Xinjiang
Wang et al. SpringerPlus 2014, 3:480 a SpringerOpen Journal RESEARCH Genetic mapping of fiber color genes on two brown cotton cultivars in Xinjiang Lixiang Wang 1,5, Haifeng Liu 2, Xueyuan Li 3, Xiangwen
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
Phillips McDougall. The cost and time involved in the discovery, development and authorisation of a new plant biotechnology derived trait
R&D Study Phillips McDougall The cost and time involved in the discovery, development and authorisation of a new plant biotechnology derived trait A Consultancy Study for Crop Life International September
Becker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
DNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
Bio 102 Practice Problems Genetic Code and Mutation
Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine
Innovations in Molecular Epidemiology
Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether
Umm AL Qura University MUTATIONS. Dr Neda M Bogari
Umm AL Qura University MUTATIONS Dr Neda M Bogari CONTACTS www.bogari.net http://web.me.com/bogari/bogari.net/ From DNA to Mutations MUTATION Definition: Permanent change in nucleotide sequence. It can
Mitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
Name: Class: Date: ID: A
Name: Class: _ Date: _ Meiosis Quiz 1. (1 point) A kidney cell is an example of which type of cell? a. sex cell b. germ cell c. somatic cell d. haploid cell 2. (1 point) How many chromosomes are in a human
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA
Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns
BCOR101 Midterm II Wednesday, October 26, 2005
BCOR101 Midterm II Wednesday, October 26, 2005 Name Key Please show all of your work. 1. A donor strain is trp+, pro+, met+ and a recipient strain is trp-, pro-, met-. The donor strain is infected with
AP Biology Essential Knowledge Student Diagnostic
AP Biology Essential Knowledge Student Diagnostic Background The Essential Knowledge statements provided in the AP Biology Curriculum Framework are scientific claims describing phenomenon occurring in
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
Name: 4. A typical phenotypic ratio for a dihybrid cross is a) 9:1 b) 3:4 c) 9:3:3:1 d) 1:2:1:2:1 e) 6:3:3:6
Name: Multiple-choice section Choose the answer which best completes each of the following statements or answers the following questions and so make your tutor happy! 1. Which of the following conclusions
(1-p) 2. p(1-p) From the table, frequency of DpyUnc = ¼ (p^2) = #DpyUnc = p^2 = 0.0004 ¼(1-p)^2 + ½(1-p)p + ¼(p^2) #Dpy + #DpyUnc
Advanced genetics Kornfeld problem set_key 1A (5 points) Brenner employed 2-factor and 3-factor crosses with the mutants isolated from his screen, and visually assayed for recombination events between
Chromosomes, Mapping, and the Meiosis Inheritance Connection
Chromosomes, Mapping, and the Meiosis Inheritance Connection Carl Correns 1900 Chapter 13 First suggests central role for chromosomes Rediscovery of Mendel s work Walter Sutton 1902 Chromosomal theory
Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary
Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]
The world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes
ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination
"Fingerprinting" Vegetables DNA-based Marker Assisted Selection
"Fingerprinting" Vegetables DNA-based Marker Assisted Selection Faster, Cheaper, More Reliable; These are some of the goals that vegetable breeders at seed companies and public institutions desire for
Trasposable elements: P elements
Trasposable elements: P elements In 1938 Marcus Rhodes provided the first genetic description of an unstable mutation, an allele of a gene required for the production of pigment in maize. This instability
somatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive
CHAPTER 6 MEIOSIS AND MENDEL Vocabulary Practice somatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive CHAPTER 6 Meiosis and Mendel sex
a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled
Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino
LECTURE 6 Gene Mutation (Chapter 16.1-16.2)
LECTURE 6 Gene Mutation (Chapter 16.1-16.2) 1 Mutation: A permanent change in the genetic material that can be passed from parent to offspring. Mutant (genotype): An organism whose DNA differs from the
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
Summary. 16 1 Genes and Variation. 16 2 Evolution as Genetic Change. Name Class Date
Chapter 16 Summary Evolution of Populations 16 1 Genes and Variation Darwin s original ideas can now be understood in genetic terms. Beginning with variation, we now know that traits are controlled by
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
COMBINING ABILITY IN LOCAL AND CIMMYT INBRED LINES OF MAIZE (Zea mays L.) FOR GRAIN YIELD AND YIELD COMPONENTS USING LINE TESTER ANALYSIS
RESEARCH ARTICLE SABRAO Journal of Breeding and Genetics 46 (2) 256-264, 2014 COMBINING ABILITY IN LOCAL AND CIMMYT INBRED LINES OF MAIZE (Zea mays L.) FOR GRAIN YIELD AND YIELD COMPONENTS USING LINE TESTER
Genetics for the Novice
Genetics for the Novice by Carol Barbee Wait! Don't leave yet. I know that for many breeders any article with the word genetics in the title causes an immediate negative reaction. Either they quickly turn
ADVANCES IN BOTANICAL RESEARCH
o >VOLUME SIXTY NINE ADVANCES IN BOTANICAL RESEARCH Genomes of Herbaceous Land Plants Volume Editor ANDREW H. PATERSON Plant Genome Mapping Laboratory Department of Crop and Soil Sciences, Department of
Heredity. Sarah crosses a homozygous white flower and a homozygous purple flower. The cross results in all purple flowers.
Heredity 1. Sarah is doing an experiment on pea plants. She is studying the color of the pea plants. Sarah has noticed that many pea plants have purple flowers and many have white flowers. Sarah crosses
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
A and B are not absolutely linked. They could be far enough apart on the chromosome that they assort independently.
Name Section 7.014 Problem Set 5 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68-120 by 5:00pm on Friday
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University [email protected] http://tandem.bu.edu/ The Human Genome Project took
Chapter 5: Organization and Expression of Immunoglobulin Genes
Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed
Terms: The following terms are presented in this lesson (shown in bold italics and on PowerPoint Slides 2 and 3):
Unit B: Understanding Animal Reproduction Lesson 4: Understanding Genetics Student Learning Objectives: Instruction in this lesson should result in students achieving the following objectives: 1. Explain
THE GENETIC ARCHITECTURE
Annu. Rev. Genet. 2001. 35:303 39 Copyright c 2001 by Annual Reviews. All rights reserved THE GENETIC ARCHITECTURE OF QUANTITATIVE TRAITS TrudyF.C.Mackay Department of Genetics, Box 7614, North Carolina
Introduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
GENOMIC SELECTION: THE FUTURE OF MARKER ASSISTED SELECTION AND ANIMAL BREEDING
GENOMIC SELECTION: THE FUTURE OF MARKER ASSISTED SELECTION AND ANIMAL BREEDING Theo Meuwissen Institute for Animal Science and Aquaculture, Box 5025, 1432 Ås, Norway, [email protected] Summary
Biology 1406 - Notes for exam 5 - Population genetics Ch 13, 14, 15
Biology 1406 - Notes for exam 5 - Population genetics Ch 13, 14, 15 Species - group of individuals that are capable of interbreeding and producing fertile offspring; genetically similar 13.7, 14.2 Population
Genetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists
Heredity - Patterns of Inheritance
Heredity - Patterns of Inheritance Genes and Alleles A. Genes 1. A sequence of nucleotides that codes for a special functional product a. Transfer RNA b. Enzyme c. Structural protein d. Pigments 2. Genes
Basics of Marker Assisted Selection
asics of Marker ssisted Selection Chapter 15 asics of Marker ssisted Selection Julius van der Werf, Department of nimal Science rian Kinghorn, Twynam Chair of nimal reeding Technologies University of New
A trait is a variation of a particular character (e.g. color, height). Traits are passed from parents to offspring through genes.
1 Biology Chapter 10 Study Guide Trait A trait is a variation of a particular character (e.g. color, height). Traits are passed from parents to offspring through genes. Genes Genes are located on chromosomes
Translation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
Single Nucleotide Polymorphisms (SNPs)
Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded
Human Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
20-10-2015. DNA profiles in DUS testing of grasses. A new UPOV model? Lolium perenne (perennial ryegrass) Pilot study (2014)
2--25 DNA profiles in DUS testing of grasses A new UPOV model? Henk Bonthuis Naktuinbouw Aanvragersoverleg Rvp Wageningsche Berg 9 oktober 25 Lolium perenne (perennial ryegrass) Challenges Genetically
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
