ANNALES UNIVERSITATIS MARIAE CURIE-SKŁ ODOWSKA LUBLIN POLONIA
|
|
|
- Derek Sparks
- 10 years ago
- Views:
Transcription
1 ANNALES UNIVERSITATIS MARIAE CURIE-SKŁ ODOWSKA LUBLIN POLONIA VOL. XXIX (4) SECTIO EE Departament of Animal Cytogenetics and Molecular Genetics, National Institute of Animal Production, Krakowska 1, Balice/Kraków, [email protected] 2 Department of Pig Breeding and Production Technology, University of Life Sciences in Lublin, Akademicka 13, Lublin, [email protected] BARBARA DANIELAK-CZECH 1, BARBARA REJDUCH 1, MAREK BABICZ 2 Cytomolecular assay of size nucleolar organizer regions (NORs) polymorphism in Pietrain pigs Cytomolekularna analiza polimorfizmu wielkości regionów jąderkotwórczych (NORs) u świń rasy pietrain Summary. The aim of this study was to identify and classify the size variants of nucleolar organizing regions (NORs) as markers useful for genetic characteristics of Pietrain breed pigs. On the basis of cytomolecular analysis carried out by silver staining (Ag-I) and fluorescence in situ hybridization (FISH) techniques, four size variants of rdna-fish-signals and Ag-NORs silver deposits were classified. Results of cytomolecular assay of size NORs polymorphism can be used in inter-breed or inter-species comparative surveys and studies of evolutionary relationships in Suidae family. Key words: pigs, chromosomes, nucleolar organizing regions (NORs), genetic markers, FISH technique INTRODUCTION Investigation of chromosome distribution of repeated sequences like ribosomal DNA is a key for evolutional cytogenetics concerning wild animals or detection of aneuploidy and chromosomal polymorphisms in farm animals. In domestic pigs, rdna sequences are organized into two distinct gene classes. The 5.8S, 18S and 28S ribosomal RNA genes are localized as tandemly repeated clusters at the secondary constrictions of chro-
2 34 B. Danielak-Czech, B. Rejduch, M. Babicz mosomes 8. and 10., called nucleolar organizer regions (NORs). The locations of rrna gene clusters revealed by fluorescence in situ hybridization technique (FISH) with human rdna probe correspond with the positions of silver stained NORs. Both fluorescent signals and silver deposits on NOR-bearing chromosomes demonstrate a clear size diversity resulting from number variation of repeated rdna sequences and different level of their transcriptional activity. This phenomenon meets the criteria of polymorphism, and polymorphic NORs may be considered as chromosome markers (a special category of genetic markers). Size polymorphism of NORs (examined mainly by silver staining and only sporadically by FISH) has been reported in numerous pig breeds and hybrid lines in the world, including populations bred in Poland (Polish Landrace, Polish Large White, Hampshire, Duroc, Pietrain, Pulawska, Zlotnicka Spotted, 990 and 890 hybrid line) [Miyake et al. 1988; Mellink et al. 1991, 1994, 1996, Solinas-Toldo et al. 1992, Świtoński i Pietrzak 1992, Lomholt et al. 1995, Świtoński et al. 1997a, b, Słota 1998, Danielak-Czech et al. 1999, 2006, 2009]. The aim of this study was double cytomolecular identification and classification of NORs size variants in order to apply them as a chromosome markers for genetic characteristic of Pietrain breed. MATERIAL AND METHODS A cytogenetic analysis based on the FISH and Ag-I techniques was performed in population of 16 Pietrain pigs from individual farm. Studies were carried out on metaphase chromosomes obtained after routine lymphocyte cultures in vitro. Evaluation of silver deposits obtained by Ag-I technique was accomplished by the computer image analysis system-multiscan 6.08 (Poland). The Ag-NORs polymorphism was expressed in the relative value of silver deposits calculated from a ratio of the silver deposit area to the whole chromosome-bearing NOR area. Values of the Ag-NORs relative area were classified into four categories (I: ; II: ; III: ; IV: for chromosome pair 10 and I: ; II: ; III: ; IV: for pair 8). FISH experiments were performed using biotynylated human 5.2kb Bg/ II-EcoRI 18S+28S rdna probe [Pinkel et al. 1986; Wachtler et al. 1986]. FITC-detected NORs were analyzed in DAPI counterstained chromosomes with fluorescence microscope equipped with the computer-assisted image analysis system LUCIA-FISH (Laboratory Imaging Ltd, Prague, Czech Republic). The rdna FISH-signal variants were classified, proportionally to the size and intensity, as: 1 small and weak, and 2, 3, 4 large and strong. RESULTS AND DISCUSSION FISH and silver staining confirmed the location of rrna genes in 8p11 and 10p11 chromosome regions of Pietrain pigs and revealed size and number polymorphism of NORs in the studied pigs. The detailed results of size variants evaluation are shown in Table 1.
3 CYTOMOLECULAR ASSAY OF SIZE NUCLEOLAR ORGANIZER REGIONS (NORs) 35 Table 1. The rdna-fish signals and Ag-NORs size variants on 10. and 8. chromosome in Pietrain pigs Tabela 1. Warianty wielkości sygnałów rdna-fish i Ag-NORs na chromosomach 10. i 8. u świń rasy pietrain Animals Zwierzęta Size variants FISH Warianty wielkości FISH 10 : 10 : 8 : 8 Size variants Ag-NORs Warianty wielkości Ag-NORs 10 : 10 : 8 : /II 0.177/ III /III 0.219/II 0.160/III 0.150/II /III 0.126/I 0.166/III 0.102/II /II 0.130/I 0.170/III /III 0.125/I 0.246/IV 0.237/IV /II 0.220/II 0.190/III 0.185/III /IV 0.110/I /II /IV 0.181/I 0.190/III /III 0.136/I 0.197/III 0.179/III /III 0.145/I 0.220/IV 0.133/II /III 0.126/I 0.215/IV 0.191/III /III 0.260/II 0.222/IV 0.098/I /III 0.214/II 0.205/IV 0.189/III /III 0.281/II 0.216/IV 0.180/III /III 0.350/III 0.210/IV /II 0.182/I 0.140/III 0.129/II FISH signals were consistently observed in four NOR sites, whereas silver deposits were often visible on three chromosomes only two in pair 10. and one 8. Maximum differences in relative quantities of rdna in all NOR-bearing chromosomes were estimated at about 4 (range 1 to 4) within animals. Correspondingly, Ag-NORs measured variants were classified into size categories (I IV) ranging from (I) to (IV) for chromosome pair 10, and (I) to (IV) for pair 8 (Tab. 1). The size diversity of rdna signals and Ag-NORs was distinct enough to classify adequately into four size variants, comparable to the scale presented by Mellink et al. [1994], Słota [1998] and Danielak-Czech et al. [1999]. In one case only NORs in both chromosome pairs were ascertained to be expressed almost evenly and classified by the same size categories (the animal no 2) (Tab. 1, Fig. 1a, b). In remaining animals under study, the FISH signals and Ag-deposits on chromosome 8. were regularly classified as higher size variant values than on chromosome 10., what could be well exemplified by the most morphologically distinct and great NORs areas on both chromosome 8 in the pig no 5 (Tab. 1, Fig. 1c). As known from published data, some cases of unusually large NORs on chromosome 8 were found in previous studies in Pietrain and Yorkshire pigs as well as in the primitive Asiatic Meishan and Polish indigenous Złotnicka Spotted breeds. On the other hand, the results of NORs variation assays for the majority of Landrace populations currently bred in Europe pointed out the tendency to occurrence of prominent nucleolar organizing regions on chromosome 10., suggesting a dominant role of this chromosome in the production of ribosomal RNA [Mellink et al. 1994, Świtoński and Pietrzak 1992, Świtoński i in. 1997a, b, Słota 1998, Danielak-Czech et al. 1999, 2006, 2009].
4 36 B. Danielak-Czech, B. Rejduch, M. Babicz Fig. 1. Size polymorphism of NORs in metaphase chromosomes of Pietrain pigs: NORs after fluorescent in situ hybridization with the 18S + 28S rdna probe in the pig no 2. Arrows show fluorescent signals (rdna-fish) on chromosome of 10. and 8. pair, classified as size variants: 3 + and 2 + Ryc. 1. Polimorfizm wielkości NORs w chromosomach metafazowych świń rasy pietrain: NORs po fluorescencyjnej hybrydyzacji in situ z sondą 18S + 28S rdna u świni nr 2. Strzałki wskazują sygnały fluorescencyjne (rdna-fish) na chromosomach 10. i 8. pary, sklasyfikowane jako warianty wielkości 3 + i 2 + Fig. 2. Size polymorphism of NORs in metaphase chromosomes of Pietrain pigs: NORs after silver staining in the pig no 2. Arrows show silver deposits (Ag-NORs) on chromosomes 10. and 8. pair, classified as size variants: III and II Ryc. 2. Polimorfizm wielkości NORs w chromosomach metafazowych świń rasy pietrain: NORs po barwieniu srebrowym u świni no 2. Strzałki wskazują depozyty srebrowe (Ag-NORs) na chromosomach 10. i 8. pary, sklasyfikowane jako warianty wielkości: III i II
5 CYTOMOLECULAR ASSAY OF SIZE NUCLEOLAR ORGANIZER REGIONS (NORs) 37 Fig. 3. Size polymorphism of NORs in metaphase chromosomes of Pietrain pigs: NORs after fluorescent in situ hybridization with the 18S+ 28S rdna probe in the pig no 5. Arrows show fluorescence signals (rdna-fish) on chromosome 10. pair, classified as size variants: (3+/1+) and 8. pair valued as variants: (4+/4+) Ryc. 3. Polimorfizm wielkości NORs w chromosomach metafazowych świń rasy pietrain: NORs po fluorescencyjnej hybrydyzacji in situ z sondą 18S + 28S rdna u świni no 5 Strzałki wskazują sygnały fluorescencyjne (rdna-fish) na chromosomach 10. pary, sklasyfikowane jako warianty wielkości: (3+/1+) i 8. pary, określone jako warianty: (4+/4+) On the whole, our findings are in agreement with the hypothesis that size polymorphism of rdna signals and active Ag-NORs corresponds to the length variation of the tandemly repeated DNA sequences generated by unequal crossing-over due to an incorrect meiotic pairing of homologous chromosomes [Harding et al. 1992]. CONCLUSIONS 1. Chromosome markers in the form of nucleolar organizing regions the rdna- -FISH signals and Ag-NORs size variants classified in the presented study supplement genetic characteristics of Pietrain breed pigs, which had been earlier drawn up on the basis of centromeric hetrochromatin markers. 2. The results of cytomolecular assay of NORs polymorphism can be applied for studies on differentiation of pig breeds as well as estimation of genetic distance or evolutionary relationships in domestic pigs or between domestic and wild pigs.
6 38 B. Danielak-Czech, B. Rejduch, M. Babicz REFERENCES Danielak-Czech B., Kaczor U., Sharan M., Chromosome markers survey of Duroc pigs. Anim. Biol. 11, Danielak-Czech B., Słota E., Babicz M., Kozubska-Sobocińska A., Rejduch B., Ocena wielkości regionów jąderkotwórczych (NOR) u świń rasy puławskiej. Rocz. Nauk. Zoot. 33, Danielak-Czech B., Słota E., Lindblad K., Gustavsson I., Size polymorphism of nucleolar organizer regions in pigs bred in Poland as determined by FISH and silver staining technique. Anim. Sci. Pap. Rep. 17, Harding R.M., Boyce A.J., Clegg J.B., The evolution of tandemly repetitive DNA: Recombination rules. Genetics 132, Lomholt B., Christenssen K., Hallenberg C., Frederiksen J., Porcine 5S rrna genes mapped to 14q23 revealing syntenic relation to human HSPA6- and 7. Mamm. Genome 6, Mellink C.H.M., Bosma A.A., De Haan N.A., Wiegant J., Distribution of rrna genes in breeds of domestic pig studied by non-radioactive in situ hybridization and selective silverstaining. Genet. Sel. Evol. 23, suppl. 1, Mellink C.H.M., Bosma A.A., De Haan N.A., Variation in size of Ag-NORs and fluorescent rdna in situ hybridization signals in six breeds of domestic pig. Hereditas 120 (2), Mellink C.H.M., Bosma A.A., De Haan N.A., Zijlstra C., Physical localization of 5S rrna genes in the pig by fluorescence in situ hybridization. Hereditas 124, Miyake M.L., O brien S.J., Kaneda Y., Regional localization of rdna genes on pig chromosome 10 by in situ hybridization. Jap. J. Vet. Sci. 50, Pinkel D., Straume T., Gray J.W., Cytogenetic analysis using quantitative, high sensitive, fluorescence hybridization. Proceed. Nation. Acad. Sci. USA 83, Słota E., Polymorphism of pig chromosomes. Rocz. Nauk. Zoot. (Habilitation Thesis), Solinas Toldo S., Pieńkowska A., Fries R., Świtoński M., Localization of nucleolar organizer regions in farm animals by in situ hybridization method with a probe from a human rrna gene. Proceedings of 10th European Colloquium on Cytogenetics of Domestic Animals, Utrecht, Świtoński M., Pietrzak A., Cytogenetic survey of AI boars; distribution of C-band and Ag-NORs polymorphism. Anim. Sci. Pap. Rep. 9, Świtoński M., Komisarek J., Pietrzak A., 1997a. The Polish Pig Genome Project: III. Chromosomal markers in generation F1. Anim. Sci. Pap. Rep. 15 (2), Świtoński M., Pietrzak A., Buczyński J., 1997b. Chromosomal markers (C-band and Ag-NOR) in the Zlotnicka Spotted pig. Anim. Sci. Pap. Rep. 15 (3), Wachtler F., Hopman A.H.N., Wiegant J., Schwarzacher H.G., On the position of nucleolus organizer regions (NORs) in interphase nuclei. Studies with a new, non-autoradiographic in situ Hybridization Method. Exp. Cell Res. 167, This work was conducted as part of the research project no. N N , financed by The Polish Ministry of Science and Higher Education. Streszczenie. Celem badań była identyfikacja i klasyfikacja wariantów wielkości regionów jąderkotwórczych (NORs) jako markerów genetycznych przydatnych do charakterystyki świń rasy pietrain. Na podstawie cytomolekularnej analizy przeprowadzonej technikami barwienia srebrowego (Ag-I) i fluorescencyjnej hybrydyzacji in situ (FISH) sklasyfikowano cztery warianty wielkości sygnałów rdna-fish oraz depozytów srebrowych Ag-NORs. Wyniki cytomolekularnej oceny polimorfizmu wielkości NORs mogą zostać wykorzystane w międzyrasowych lub międzygatunkowych analizach porównawczych oraz badaniach związków ewolucyjnych w rodzinie Suidae. Słowa kluczowe: świnie, chromosomy, regiony jąderkotwórcze (NORs), markery genetyczne, technika FISH
Genetic conservation of microsatellite sequences in Suidae* *
Ann. Anim. Sci., Vol. 9, No. 3 (2009) 243 248 Genetic conservation of microsatellite sequences in Suidae* * A n n a K o z u b s k a - S o b o c i ń s k a 1, B a r b a r a R e j d u c h 1, M a r i a O c
A N N A L E S U N I V E R S I T A T I S M A R I A E C U R I E - S K Ł O D O W S K A L U B L I N P O L O N I A
A N N A L E S U N I V E R S I T A T I S M A R I A E C U R I E - S K Ł O D O W S K A L U B L I N P O L O N I A VOL. XXXI(4) SECTIO EE 2013 1 Departament of Animal Cytogenetics and Molecular Genetics, National
FISH-based comparative analysis of human and porcine
Ann. Anim. Sci., Vol. 10, No. 4 (2010) 367 372 FISH-based comparative analysis of human and porcine chromosome region involving obesity-related genes* * B a r b a r a R e j d u c h, B a r b a r a D a n
CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA
CHROMOSOMES Dr. Fern Tsien, Dept. of Genetics, LSUHSC, NO, LA Cytogenetics is the study of chromosomes and their structure, inheritance, and abnormalities. Chromosome abnormalities occur in approximately:
The following chapter is called "Preimplantation Genetic Diagnosis (PGD)".
Slide 1 Welcome to chapter 9. The following chapter is called "Preimplantation Genetic Diagnosis (PGD)". The author is Dr. Maria Lalioti. Slide 2 The learning objectives of this chapter are: To learn the
Gene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
PREPARED FOR: U.S. Army Medical Research and Materiel CommandFort Detrick, Maryland 21702 5012
AD Award Number: W81XWH 07 1 0542 TITLE: Is Nuclear Structure Altered in Breast Cancer Cells? PRINCIPAL INVESTIGATOR: Han Htun, Ph.D. CONTRACTING ORGANIZATION: University of California Los Angeles, CA
Fluorescence in situ hybridisation (FISH)
Fluorescence in situ hybridisation (FISH) rarechromo.org Fluorescence in situ hybridization (FISH) Chromosomes Chromosomes are structures that contain the genetic information (DNA) that tells the body
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
Chromosomes, Karyotyping, and Abnormalities (Learning Objectives) Learn the components and parts of a metaphase chromosome.
Chromosomes, Karyotyping, and Abnormalities (Learning Objectives) Learn the components and parts of a metaphase chromosome. Define the terms karyotype, autosomal and sex chromosomes. Explain how many of
Polymorphism of selected microsatellite DNA sequences in Simmental cattle chosen for identification of QTLs for meat traits
Animal Science Papers and Reports vol. 24 (2006) Supplement 2, 71-77 Institute of Genetics and Animal Breeding, Jastrzębiec, Poland Presented at the III Conference Genetic and environmental possibilities
Chromosomal diversification of reef fishes from genus Centropyge (Perciformes, Pomacanthidae)
Genetica (2005) 123: 227 233 Ó Springer 2005 Chromosomal diversification of reef fishes from genus Centropyge (Perciformes, Pomacanthidae) Paulo Roberto Antunes de Mello Affonso & Pedro Manoel Galetti
Cell Growth and Reproduction Module B, Anchor 1
Cell Growth and Reproduction Module B, Anchor 1 Key Concepts: - The larger a cell becomes, the more demands the cell places on its DNA. In addition, a larger cell is less efficient in moving nutrients
Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA
Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns
Cell Division CELL DIVISION. Mitosis. Designation of Number of Chromosomes. Homologous Chromosomes. Meiosis
Cell Division CELL DIVISION Anatomy and Physiology Text and Laboratory Workbook, Stephen G. Davenport, Copyright 2006, All Rights Reserved, no part of this publication can be used for any commercial purpose.
March 19, 2014. Dear Dr. Duvall, Dr. Hambrick, and Ms. Smith,
Dr. Daniel Duvall, Medical Officer Center for Medicare, Hospital and Ambulatory Policy Group Centers for Medicare and Medicaid Services 7500 Security Boulevard Baltimore, Maryland 21244 Dr. Edith Hambrick,
CHROMOSOME STRUCTURE CHROMOSOME NUMBERS
CHROMOSOME STRUCTURE 1. During nuclear division, the DNA (as chromatin) in a Eukaryotic cell's nucleus is coiled into very tight compact structures called chromosomes. These are rod-shaped structures made
The Human Genome Project
The Human Genome Project Brief History of the Human Genome Project Physical Chromosome Maps Genetic (or Linkage) Maps DNA Markers Sequencing and Annotating Genomic DNA What Have We learned from the HGP?
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
DnaSP, DNA polymorphism analyses by the coalescent and other methods.
DnaSP, DNA polymorphism analyses by the coalescent and other methods. Author affiliation: Julio Rozas 1, *, Juan C. Sánchez-DelBarrio 2,3, Xavier Messeguer 2 and Ricardo Rozas 1 1 Departament de Genètica,
1. Why is mitosis alone insufficient for the life cycle of sexually reproducing eukaryotes?
Chapter 13: Meiosis and Sexual Life Cycles 1. Why is mitosis alone insufficient for the life cycle of sexually reproducing eukaryotes? 2. Define: gamete zygote meiosis homologous chromosomes diploid haploid
Recombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
Heredity - Patterns of Inheritance
Heredity - Patterns of Inheritance Genes and Alleles A. Genes 1. A sequence of nucleotides that codes for a special functional product a. Transfer RNA b. Enzyme c. Structural protein d. Pigments 2. Genes
ANNALES UNIVERSITATIS MARIAE CURIE-SKŁODOWSKA LUBLIN POLONIA
DOI: 10.2478/v10083-012-0013-1 ANNALES UNIVERSITATIS MARIAE CURIE-SKŁODOWSKA LUBLIN POLONIA VOL. XXX (2) SECTIO EE 2012 1 Department of Biological Bases of Animal Production, University of Life Sciences
Chapter 13: Meiosis and Sexual Life Cycles
Name Period Chapter 13: Meiosis and Sexual Life Cycles Concept 13.1 Offspring acquire genes from parents by inheriting chromosomes 1. Let s begin with a review of several terms that you may already know.
Chapter 3. Cell Division. Laboratory Activities Activity 3.1: Mock Mitosis Activity 3.2: Mitosis in Onion Cells Activity 3.
Chapter 3 Cell Division Laboratory Activities Activity 3.1: Mock Mitosis Activity 3.2: Mitosis in Onion Cells Activity 3.3: Mock Meiosis Goals Following this exercise students should be able to Recognize
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
Genetics 301 Sample Final Examination Spring 2003
Genetics 301 Sample Final Examination Spring 2003 50 Multiple Choice Questions-(Choose the best answer) 1. A cross between two true breeding lines one with dark blue flowers and one with bright white flowers
Appendix 2 Molecular Biology Core Curriculum. Websites and Other Resources
Appendix 2 Molecular Biology Core Curriculum Websites and Other Resources Chapter 1 - The Molecular Basis of Cancer 1. Inside Cancer http://www.insidecancer.org/ From the Dolan DNA Learning Center Cold
Human Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA
DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence
Translation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
Chromosome Preparation and Banding
Chromosome Preparation and Banding Charleen M Moore, University of Texas Health Science Center at San Antonio, Texas, USA Robert G Best, University of South Carolina School of Medicine, Columbia, South
Mitosis in Onion Root Tip Cells
Mitosis in Onion Root Tip Cells A quick overview of cell division The genetic information of plants, animals and other eukaryotic organisms resides in several (or many) individual DNA molecules, or chromosomes.
Overview of Genetic Testing and Screening
Integrating Genetics into Your Practice Webinar Series Overview of Genetic Testing and Screening Genetic testing is an important tool in the screening and diagnosis of many conditions. New technology is
Practice Problems 4. (a) 19. (b) 36. (c) 17
Chapter 10 Practice Problems Practice Problems 4 1. The diploid chromosome number in a variety of chrysanthemum is 18. What would you call varieties with the following chromosome numbers? (a) 19 (b) 36
Breeds of Swine. Berkshire. Chester White
Breeds of Swine Picture Provided by Prairie State Berkshire The Berkshire breed has long been known for its efficiency in gaining weight. Berkshire hogs have possessed their excellent carcass quality since
Lecture 2: Mitosis and meiosis
Lecture 2: Mitosis and meiosis 1. Chromosomes 2. Diploid life cycle 3. Cell cycle 4. Mitosis 5. Meiosis 6. Parallel behavior of genes and chromosomes Basic morphology of chromosomes telomere short arm
Sample Questions for Exam 3
Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.
BioSci 2200 General Genetics Problem Set 1 Answer Key Introduction and Mitosis/ Meiosis
BioSci 2200 General Genetics Problem Set 1 Answer Key Introduction and Mitosis/ Meiosis Introduction - Fields of Genetics To answer the following question, review the three traditional subdivisions of
1. When new cells are formed through the process of mitosis, the number of chromosomes in the new cells
Cell Growth and Reproduction 1. When new cells are formed through the process of mitosis, the number of chromosomes in the new cells A. is half of that of the parent cell. B. remains the same as in the
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
List, describe, diagram, and identify the stages of meiosis.
Meiosis and Sexual Life Cycles In this topic we will examine a second type of cell division used by eukaryotic cells: meiosis. In addition, we will see how the 2 types of eukaryotic cell division, mitosis
Feature. WWW.Cell Biology Education. Robert V. Blystone. Department of Biology, Trinity University, San Antonio, TX 78212 INTRODUCTION
Cell Biology Education Vol. 3, 223 227, Winter 2004 Feature WWW.Cell Biology Education Robert V. Blystone Department of Biology, Trinity University, San Antonio, TX 78212 Each quarter, Cell Biology Education
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
DNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
HER2 FISH pharmdx. Assay Kit
PATHOLOGY HER2 FISH pharmdx Assay Kit HER2 FISH pharmdx Clarity You Can Count On Reliable Results at a Glance The robust HER2 FISH pharmdx assay offers bright and distinct signals for easy and fast reading
Biology Final Exam Study Guide: Semester 2
Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion
Chapter 13: Meiosis and Sexual Life Cycles
Name Period Concept 13.1 Offspring acquire genes from parents by inheriting chromosomes 1. Let s begin with a review of several terms that you may already know. Define: gene locus gamete male gamete female
Prof Brian McStay Wellcome Trust Senior Investigator Award April 2015- March 2020
Prof Brian McStay Wellcome Trust Senior Investigator Award April 2015- March 2020 Career History BA (Genetics) Trinity College Dublin PhD University of Edinburgh (with Adrian Bird) Post-Doc Fred Hutchinson
Molecular Genetics: Challenges for Statistical Practice. J.K. Lindsey
Molecular Genetics: Challenges for Statistical Practice J.K. Lindsey 1. What is a Microarray? 2. Design Questions 3. Modelling Questions 4. Longitudinal Data 5. Conclusions 1. What is a microarray? A microarray
The genetic screening of preimplantation embryos by comparative genomic hybridisation
Vol. 11, Suppl. 3 51 The genetic screening of preimplantation embryos by comparative genomic hybridisation Maria V Traversa 1, James Marshall, Steven McArthur, Don Leigh Genea, Sydney, Australia Received:
Worksheet - COMPARATIVE MAPPING 1
Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that
From DNA to Protein
Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins
Cell Cycle in Onion Root Tip Cells (IB)
Cell Cycle in Onion Root Tip Cells (IB) A quick overview of cell division The genetic information of plants, animals and other eukaryotic organisms resides in several (or many) individual DNA molecules,
Genetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
Gene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
Bio EOC Topics for Cell Reproduction: Bio EOC Questions for Cell Reproduction:
Bio EOC Topics for Cell Reproduction: Asexual vs. sexual reproduction Mitosis steps, diagrams, purpose o Interphase, Prophase, Metaphase, Anaphase, Telophase, Cytokinesis Meiosis steps, diagrams, purpose
Polymorphism of retrotransposons in Bos taurus
Polymorphism of retrotransposons in Bos taurus Bernt Guldbrandtsen Goutam Sahana Mogens Sandø Lund Center for Quantitative Genetics and Genomics Aarhus University Denmark Transposons Type of jumping genes
The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
The Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
Summary.-Miniature-3 gamma gene is unstable in somatic cells.
434 4GENETICS: C. R. BURNHAM be influenced by several genetic factors.6 'The higher rate in the males might be accounted for by the assumption that the male sex stimulates the instability. Experiments
HUMAN CHROMOSOMES. Using this criterion, human chromosomes are divided in: metacentric, submetacentric, and acrocentric.
HUMAN CHROMOSOMES Normal human somatic cells contain a diploid number of chromosomes (2n=46), so there are 23 pairs of chromosomes: - 22 pairs are identical in man and women and are called autosomes; -
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
Innovations in Molecular Epidemiology
Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether
Lecture 7 Mitosis & Meiosis
Lecture 7 Mitosis & Meiosis Cell Division Essential for body growth and tissue repair Interphase G 1 phase Primary cell growth phase S phase DNA replication G 2 phase Microtubule synthesis Mitosis Nuclear
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa,
Protocols. Internal transcribed spacer region (ITS) region. Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013)
Protocols Internal transcribed spacer region (ITS) region Niklaus J. Grünwald, Frank N. Martin, and Meg M. Larsen (2013) The nuclear ribosomal RNA (rrna) genes (small subunit, large subunit and 5.8S) are
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Cytogenetics for the Rest of Us: A Primer
Cytogenetics for the Rest of Us: A Primer James J. Stark, MD, FACP Medical Director Cancer Program Maryview Medical Center Diane Maia, M.D. Pathologist, Bon Secours Hampton Roads Case #1 78 y.o. lady seen
Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS
Lab 2/Phylogenetics/September 16, 2002 1 Read: Tudge Chapter 2 PHYLOGENETICS Objective of the Lab: To understand how DNA and protein sequence information can be used to make comparisons and assess evolutionary
CORRELATIONS BETWEEN SERUM LEVELS OF CREATINE KINASE AND CORTISOL IN SCREENING OF HAL GENE CARRIER PIGLETS
CORRELATIONS BETWEEN SERUM LEVELS OF CREATINE KINASE AND CORTISOL IN SCREENING OF HAL GENE CARRIER PIGLETS GH. BONCA, S. VĂDUVA, RENATE KNOP, R. URIAN, C. MIRCU, V. ARDELEAN Faculty of Veterinary Medicine
What is Cancer? Cancer is a genetic disease: Cancer typically involves a change in gene expression/function:
Cancer is a genetic disease: Inherited cancer Sporadic cancer What is Cancer? Cancer typically involves a change in gene expression/function: Qualitative change Quantitative change Any cancer causing genetic
Activity 7.21 Transcription factors
Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation
The world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
Answer Key. Vocabulary Practice
Answer Key Vocabulary Practice Copyright by McDougal Littell, a division of Houghton Mifflin Company A. Categorize Words 1. organism, L; cell, L; species, L; transgenic, B; biotechnology, T; molecular
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
RNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
Genetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
The role of IBV proteins in protection: cellular immune responses. COST meeting WG2 + WG3 Budapest, Hungary, 2015
The role of IBV proteins in protection: cellular immune responses COST meeting WG2 + WG3 Budapest, Hungary, 2015 1 Presentation include: Laboratory results Literature summary Role of T cells in response
AP Biology Essential Knowledge Student Diagnostic
AP Biology Essential Knowledge Student Diagnostic Background The Essential Knowledge statements provided in the AP Biology Curriculum Framework are scientific claims describing phenomenon occurring in
ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes
ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination
The Somatic Cell Cycle
The Somatic Cell Cycle Maternal chromosome Diploid Zygote Diploid Zygote Paternal chromosome MITOSIS MITOSIS Maternal chromosome Diploid organism Diploid organism Paternal chromosome Int terpha ase The
Sexual Reproduction. The specialized cells that are required for sexual reproduction are known as. And come from the process of: GAMETES
Sexual Reproduction Sexual Reproduction We know all about asexual reproduction 1. Only one parent required. 2. Offspring are identical to parents. 3. The cells that produce the offspring are not usually
Presentation by: Ahmad Alsahaf. Research collaborator at the Hydroinformatics lab - Politecnico di Milano MSc in Automation and Control Engineering
Johann Bernoulli Institute for Mathematics and Computer Science, University of Groningen 9-October 2015 Presentation by: Ahmad Alsahaf Research collaborator at the Hydroinformatics lab - Politecnico di
Arabidopsis. A Practical Approach. Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham
Arabidopsis A Practical Approach Edited by ZOE A. WILSON Plant Science Division, School of Biological Sciences, University of Nottingham OXPORD UNIVERSITY PRESS List of Contributors Abbreviations xv xvu
MetaMorph Software Basic Analysis Guide The use of measurements and journals
MetaMorph Software Basic Analysis Guide The use of measurements and journals Version 1.0.2 1 Section I: How Measure Functions Operate... 3 1. Selected images... 3 2. Thresholding... 3 3. Regions of interest...
Human Chromosomes lab 5
Human Chromosomes lab 5 Objectives Upon completion of this activity, you should be able to: describe the structure of human chromosomes with reference to size, centromere position, and presence or absence
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
Gene Therapy. The use of DNA as a drug. Edited by Gavin Brooks. BPharm, PhD, MRPharmS (PP) Pharmaceutical Press
Gene Therapy The use of DNA as a drug Edited by Gavin Brooks BPharm, PhD, MRPharmS (PP) Pharmaceutical Press Contents Preface xiii Acknowledgements xv About the editor xvi Contributors xvii An introduction
Real-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the
Chapter 5 Analysis of Prostate Cancer Association Study Data 5.1 Risk factors for Prostate Cancer Globally, about 9.7% of cancers in men are prostate cancers, and the risk of developing the disease has
