PCR Quantitative en temps réel

Size: px
Start display at page:

Download "PCR Quantitative en temps réel"

Transcription

1 Quatitative PCR PCR Quatitative e temps réel Aspects méthodologiques al itesity) Log (Siga Sample 1 Sample 2 Sample 3 Sample Cycle umber Quatitative PCR Quatitative PCR al itesity) Log (Siga Sample 1 Sample 2 Sample 3 Sample 4 al itesity) Log (Siga Sample 1 Sample 2 Sample 3 Sample Cycle umber Cycle umber Fluorescece Mesure de fluorescece e format capillaires Roche 1

2 Mesure de fluorescece e format 96 Puits Mesure de fluorescece e format 96 Puits Stratagee Biorad Rotor gee The techology i the machies Illumiatio: Laser Haloge lamps, LED Detectio: PMT CCD camera Temperature cyclig: Block-Peltier Air: capillaries Advatages More sesitive Multiplexig. Idividual sample aalysis Cheaper. Higher throughput Faster, more sesitive, temperature more uiform Les évolutios: Roche 480 SYBR Gree Sample umbers: Blocks for either 96 or 384 samples, easily exchageable by user Reactio volumes: 3 µl - 20 µl (384 well), 20 µl -100 µl (96 well) Temperature cotrol: Peltier-based heatig/coolig from 40 C - 95 C Heated lid, PCR without ay overlay (e.g., wax or oil) Passive post-ru coolig to < 40 C Maximum ramp rates: Heatig: 6.3 C/s (average values for Coolig: 3.5 C/s stadard ru coditios Meltig: C/s Excitatio: 5 excitatio filters, high-itesity broad-spectrum xeo lamp Detectio: 6 detectio filters, sigals detected olie by CCD camera Ru time: < 60 miutes (96-well plate), < 40 miutes (384-well plate) 2

3 The problem with SYBRGree: primer dimers Properties of primers Pos. 287 Upper Primer: the most stable 3'-dimer: 2 bp, -3.6 kcal/mol Stadard Curve Upper Primer [287]: Td = 71.7 [earest eighbor method] Tm = 74.4 [%GC method] Tm = 66 [2 *(A+T) + 4 *(G+C) method] Mr = 6.3 k (oe strad) Mr = 12.4 k (two strads) µg/od = 45.6 (dsdna) Base Number ad % A 1 [5.0] C 4 [20.0] G 9 [45.0] T 6 [30.0] 5' CACTGGTGTGCGTGTGTGCG 3' :: 3' GCGTGTGTGCGTGTGGTCAC 5' Upper Primer: the most stable dimer: 2 bp, -3.6 kcal/mol 5' CACTGGTGTGCGTGTGTGCG 3' : : 3' GCGTGTGTGCGTGTGGTCAC 5' Hairpi: ²G = 0.9 kcal/mol, Loop = 8 t 5' CACTGGT G 3' GCGTGTGTGCGTG Pos. 454 Lower Primer: o 3'-termial dimer formatio No template cotrol (dimers) No template cotrol (dimers) A + T 7 [35.0] G + C 13 [65.0] Lower Primer: the most stable dimer: 4 bp, -9.8 kcal/mol 5' CTGCGGTCCGCTCTACACTAA 3' :::: 3' AATCACATCTCGCCTGGCGTC 5' Hairpi: ²G = -1.5 kcal/mol, Loop = 3 t, Tm = 48 5' CTGCGG T 3' AATCACATCTCGCC Error: 0,0115 Efficiecy: 1,996 Stadard Curve ²G Positio 287 Legth 20 t. ²G Positio 454 Legth 21 t CACTGGTGTGCGTGTGTGCG (5'-> 3') -5.0 CTGCGGTCCGCTCTACACTAA (5'-> 3') FRET Fluorescece Resoace Eergy Trasfer FRET Fluorescece Resoace Eergy Trasfer Distace-depedet iteractio betwee the electroic excited states of two dye molecules i which excitatio is trasferred from a door molecule to a acceptor molecule without emissio of a photo. The absorptio spectrum of the acceptor must overlap the fluorescece emissio spectrum of the door The efficiecy of FRET is depedet o the iverse sixth power of the itermolecular separatio: Door ad acceptor molecules must be i close proximity (typically Å) FRET Fluorescece Resoace Eergy Trasfer Quechers Dabcyl et Black Hole Quechers 3

4 Fluorophores utilisables Taqma probe Sodes d hybridatio Probe that hybridizes to the specific product Probe 1 Probe 2 3'ed door fluorophore 5'ed acceptor fluorophore Labels ad modificatios Fluorescei LightCycler Red 610, 640, 670 or 705 Sodes TaqMa, Beaco, Scorpio 5'ed reporter 6-FAM, HEX, TET, JOE, TAMRA, ROX, Fluorescei, Cy 3, Cy5, Cy5.5, Texas Red, Rhodamie, Rhodamie Red, Rhodamie Gree, 6-CarboxyRhodamie 6G, Orego Gree 488, Orego Gree 500 or Orego Gree 514 3'ed quecher TAMRA, DABCYL, BHQ -1 or BHQ-2 Molecular beacos Hybridizatio probe Probe that hybridizes to the specific product Scorpio probes Labelled primer cotais the probe that hybridizes to the specific product Scorpio probes Labeled primer cotais the probe that hybridizes to the specific product 4

5 Scorpio probes Labeled primer cotais the probe that hybridizes to the specific product Avec des sodes spécifiques: Possibilité d utiliser différets fluorophores pour différetes séqueces. Mais: Multiplexig très délicat à cause des iterféreces etre amorces LNA: locked ucleic acids LNA: locked ucleic acids Reduced coformatioal flexibility of the sugar icreases stability of the base pair A 2'-O, 4'-C methylee bridge locks the ribose moiety ito a C3'-edo coformatio. Bz-A-LNA 5-Me-Bz-C-LNA dmf-g-lna T-LNA The reduced coformatioal flexibility of the sugar icreases the stability of the base pair 8 to 9 ucleotide log base pair hybrid are stable at 60 C Most of the mrna sequeces of a higher orgaism ca be detected with a 90 probe Taqma set: Exiqo Uiversal probe library (Roche) Geotypage Sodes d hybridatio Aalyse de variatios alléliques avec la PCR quatitative Détectio de SNP (homozygote A/A, a/a et hétérozygote A/a) 5

6 Courbe de fusio Desig des sodes pour la détectio de mutatio perfect match Fluorescece (F1) mismatch Sode d acrage Sode de mutatio Le T m de la sode de mutatio est eviro 5 C plus bas que le T m de la sode d acrage Applicatio: détectio de mutatio Courbe de fusio Perfect match Mismatch ece (F1) Fluoresce ce -d (F1) / dt Fluorescec Température C Température basse moyee élevée Géotypage Applicatio: détectio de mutatio de l Apolipoproteie E M F V L H H Hétérozygote muté 6

7 Géotypage par courbe de fusio Sodes d Hydrolyses. Taqma LC- Apo B Mutatio Detectio Kit (codo 3500) Géotypage avec les sodes Taqma Géotypage avec les sodes Taqma Quatificatio Quatificatio umber Cycle Stadard curve Stadard 15-0,5 0 0,5 1 1,5 Log Cocetratio Cp= Slope x LogC + Itercept 7

8 The Maths behid MethylQuat Ct 1 = S. LogC 1 + I Ct 2 = S. LogC 2 + I If C 2 =(1+E). C 1 the Ct 2 =Ct 1-1 LogC 2 =Log (1+E) + Log C 1 S [Log (1+E) +Log C 1 ] + I = S. LogC 1 + I -1 Log (1+E) = -1/S 1+E = 10-1/S 100% S= % S= % S= sesitivity Proportio of aalysed species MethylQuat A sigle LNA at the 3 -ed of the primer provides superior discrimiatig ability ΔCt MIS-MAT Regular LNA U2 Umet A:C U3 Umet A:C L2 + Umet A:C L2 + Met N/A 11.7 G:T L3 Umet T:G L3 Met (56 C) C:A L3 Met (58 C) C:A MethylQuat A sigle LNA at the 3 -ed of the primer provides superior discrimiatig ability 8

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of

More information

Pitfalls in qpcr. Primer and probe design and synthesis. Mary Span Eurogentec S.A.

Pitfalls in qpcr. Primer and probe design and synthesis. Mary Span Eurogentec S.A. Pitfalls in qpcr Primer and probe design and synthesis Mary Span Eurogentec S.A. Steps in qpcr assay Set up experiment statistical relevant # samples/experimental group controls Design and synthesis primers

More information

QPCR Applications using Stratagene s Mx Real-Time PCR Platform

QPCR Applications using Stratagene s Mx Real-Time PCR Platform QPCR Applications using Stratagene s Mx Real-Time PCR Platform Dan Schoeffner, Ph.D Field Applications Scientist [email protected] Tech. Services 800-894-1304 Polymerase Chain Reaction Melt

More information

Introduction to Quantitative PCR

Introduction to Quantitative PCR Introduction to Quantitative PCR Methods and Applications Guide Introduction to Quantitative PCR Methods and Applications Guide IN 70200 D US and Canada Orders: 800-227-9770 x3 Technical Service: 800-227-9770

More information

LightCycler 480 Real-Time PCR System

LightCycler 480 Real-Time PCR System Roche Applied Science LightCycler 480 Real-Time PCR System Planned introduction of the LightCycler 480 System: September 2005 Rapid by nature, accurate by design The LightCycler 480 Real-Time PCR System

More information

Real-time qpcr Assay Design Software www.qpcrdesign.com

Real-time qpcr Assay Design Software www.qpcrdesign.com Real-time qpcr Assay Design Software www.qpcrdesign.com Your Blueprint For Success Informational Guide 2199 South McDowell Blvd Petaluma, CA 94954-6904 USA 1.800.GENOME.1(436.6631) 1.415.883.8400 1.415.883.8488

More information

Fluorescent dyes for use with the

Fluorescent dyes for use with the Detection of Multiple Reporter Dyes in Real-time, On-line PCR Analysis with the LightCycler System Gregor Sagner, Cornelia Goldstein, and Rob van Miltenburg Roche Molecular Biochemicals, Penzberg, Germany

More information

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

Technical Note. Roche Applied Science. No. LC 19/2004. Color Compensation

Technical Note. Roche Applied Science. No. LC 19/2004. Color Compensation Roche Applied Science Technical Note No. LC 19/2004 Purpose of this Note Color The LightCycler System is able to simultaneously detect and analyze more than one color in each capillary. Due to overlap

More information

DNA Detection. Chapter 13

DNA Detection. Chapter 13 DNA Detection Chapter 13 Detecting DNA molecules Once you have your DNA separated by size Now you need to be able to visualize the DNA on the gel somehow Original techniques: Radioactive label, silver

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

Co Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra

Co Extra (GM and non GM supply chains: Their CO EXistence and TRAceability) Outcomes of Co Extra GM and non GM supply chains: Their CO EXistence and TRAceability Outcomes of Co Extra Comparison of different real time PCR chemistries and their suitability for detection and quantification of genetically

More information

Bio-Plex Manager Software

Bio-Plex Manager Software Multiplex Suspesio Array Bio-Plex Maager Software Extract Kowledge Faster Move Your Research Forward Bio-Rad cotiues to iovate where it matters most. With Bio-Plex Maager 5.0 software, we offer valuable

More information

qpcr Technical Guide Detection Methods Primer and Probe Design Instrumentation Applications Guide

qpcr Technical Guide Detection Methods Primer and Probe Design Instrumentation Applications Guide qpcr Technical Guide Detection Methods Primer and Probe Design Instrumentation Applications Guide Table of Contents qpcr Technical Guide Introduction... 1 Quantitative PCR: How does it work?... 2 qpcr

More information

Applications Guide. Real-Time PCR Applications Guide

Applications Guide. Real-Time PCR Applications Guide Applications Guide Real-Time PCR Applications Guide table of contents Table of Contents 1. Overview of Real-Time PCR 2 1.1 Key Concepts of Real-Time PCR 2 1.1.1 What Is Real-Time PCR? 2 1.1.2 How Real-Time

More information

Methods and Application Guide. Introduction to Quantitative PCR

Methods and Application Guide. Introduction to Quantitative PCR Methods and Application Guide Introduction to Quantitative PCR Introduction to Quantitative PCR Methods and Application Guide Stratagene USA and Canada Order: 800-424-5444 x3 Technical Services: 800-894-1304

More information

RealStar HBV PCR Kit 1.0 11/2012

RealStar HBV PCR Kit 1.0 11/2012 RealStar HBV PCR Kit 1.0 11/2012 RealStar HBV PCR Kit 1.0 For research use only! (RUO) Product No.: 201003 96 rxns INS-201000-GB-02 Store at -25 C... -15 C November 2012 altona Diagnostics GmbH Mörkenstraße

More information

SYBR Green Realtime PCR Master Mix -Plus-

SYBR Green Realtime PCR Master Mix -Plus- Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction

More information

Eco TM 48 Real Time PCR System. Fastest block-based qpcr. Four colour multiplexing. Supports all chemistries. Fast cycling protocols

Eco TM 48 Real Time PCR System. Fastest block-based qpcr. Four colour multiplexing. Supports all chemistries. Fast cycling protocols A Bibby Scientific Company Eco TM 48 Real Time PCR System Fast cycling Fastest block-base HRM functionality Four colour multiplexing MIQE compliant Easy to use software Supports all chemistries Small footprint

More information

Quantitative PCR Systems

Quantitative PCR Systems QUANTITATIVE PCR Quantitative PCR Systems Our QPCR systems meet your current research needs, offer flexibility for future research goals, and match your budget. HIGH-PERFORMANCE FULL-FEATURED FLEXIBLE

More information

Non-life insurance mathematics. Nils F. Haavardsson, University of Oslo and DNB Skadeforsikring

Non-life insurance mathematics. Nils F. Haavardsson, University of Oslo and DNB Skadeforsikring No-life isurace mathematics Nils F. Haavardsso, Uiversity of Oslo ad DNB Skadeforsikrig Mai issues so far Why does isurace work? How is risk premium defied ad why is it importat? How ca claim frequecy

More information

JBS FUNDAMENT Thermofluor Screen

JBS FUNDAMENT Thermofluor Screen Cat. No. CS-330 Amount 1 Kit For in vitro use only. Quality guaranteed for 3 months. Store at 4 C. Application Screen for thermal stability of proteins as a function of the FUNDAMENTAL variables ph and

More information

Factors Influencing Multiplex Real-Time PCR

Factors Influencing Multiplex Real-Time PCR APPLICATION NOTE Multiplex Real-Time PCR Factors Influencing Multiplex Real-Time PCR Introduction Multiplex PCR is the simultaneous amplification of more than one target sequence in a single reaction [1].

More information

P 1 2 V V V T V V. AP Chemistry A. Allan Chapter 5 - Gases

P 1 2 V V V T V V. AP Chemistry A. Allan Chapter 5 - Gases A Chemistry A. Alla Chapter 5 - Gases 5. ressure A. roperties of gases. Gases uiformly fill ay cotaier. Gases are easily compressed 3. Gases mix completely with ay other gas 4. Gases exert pressure o their

More information

Semiconductor Devices

Semiconductor Devices emicoductor evices Prof. Zbigiew Lisik epartmet of emicoductor ad Optoelectroics evices room: 116 e-mail: [email protected] Uipolar devices IFE T&C JFET Trasistor Uipolar evices - Trasistors asic

More information

Quantitative Computer Architecture

Quantitative Computer Architecture Performace Measuremet ad Aalysis i Computer Quatitative Computer Measuremet Model Iovatio Proposed How to measure, aalyze, ad specify computer system performace or My computer is faster tha your computer!

More information

Creating a Color Compensation file for Roche LightCycler 480 vers.i & vers. II

Creating a Color Compensation file for Roche LightCycler 480 vers.i & vers. II Creating a Color Compensation file for Roche LightCycler 480 vers.i & vers. II Due to ROX and Cy5 dye emmision spectra overlap Roche LightCycler 480 can pick up signals from a dye measured by another channel.

More information

Highly specific and sensitive quantitation

Highly specific and sensitive quantitation PRODUCT ULLETIN SYR Select Master Mix SYR Select Master Mix Highly specific and sensitive quantitation SYR Select Master Mix offers advanced performance at an affordable price. SYR Select Master Mix is

More information

CHAPTER 7: Central Limit Theorem: CLT for Averages (Means)

CHAPTER 7: Central Limit Theorem: CLT for Averages (Means) CHAPTER 7: Cetral Limit Theorem: CLT for Averages (Meas) X = the umber obtaied whe rollig oe six sided die oce. If we roll a six sided die oce, the mea of the probability distributio is X P(X = x) Simulatio:

More information

REAL TIME PCR USING SYBR GREEN

REAL TIME PCR USING SYBR GREEN REAL TIME PCR USING SYBR GREEN 1 THE PROBLEM NEED TO QUANTITATE DIFFERENCES IN mrna EXPRESSION SMALL AMOUNTS OF mrna LASER CAPTURE SMALL AMOUNTS OF TISSUE PRIMARY CELLS PRECIOUS REAGENTS 2 THE PROBLEM

More information

Using Four Types Of Notches For Comparison Between Chezy s Constant(C) And Manning s Constant (N)

Using Four Types Of Notches For Comparison Between Chezy s Constant(C) And Manning s Constant (N) INTERNATIONAL JOURNAL OF SCIENTIFIC & TECHNOLOGY RESEARCH OLUME, ISSUE, OCTOBER ISSN - Usig Four Types Of Notches For Compariso Betwee Chezy s Costat(C) Ad Maig s Costat (N) Joyce Edwi Bategeleza, Deepak

More information

RNA Interference with Guaranteed Knockdown!

RNA Interference with Guaranteed Knockdown! RNA Iterferece with Guarateed Kockdow! microrna, shrna, & sirna microrna detectio with SYBR-Gree qpcr experimets microrna expressio microrna target validatio with 3'-UTR cloes shrna & sirna mediated kockdow

More information

RECIPROCATING COMPRESSORS

RECIPROCATING COMPRESSORS RECIPROCATING COMPRESSORS There are various compressor desigs: Rotary vae; Cetrifugal & Axial flow (typically used o gas turbies); Lobe (Roots blowers), ad Reciprocatig. The mai advatages of the reciprocatig

More information

Confidence Intervals for One Mean

Confidence Intervals for One Mean Chapter 420 Cofidece Itervals for Oe Mea Itroductio This routie calculates the sample size ecessary to achieve a specified distace from the mea to the cofidece limit(s) at a stated cofidece level for a

More information

The AB7900Fast and Principles of Real Time PCR

The AB7900Fast and Principles of Real Time PCR The AB7900Fast and Principles of Real Time PCR Michael Tavaria, PhD Scientific Applications Specialist, Applied Biosystems, Australia and New Zealand Outline Chemistries 7900Fast Real Time PCR System Applications

More information

Real Time PCR Kit for Human Herpes Virus Type 6 Cat No. TM-60027: Primer Set

Real Time PCR Kit for Human Herpes Virus Type 6 Cat No. TM-60027: Primer Set 780 Dubuque Avenue So. San Francisco, CA 94080, U.S.A. Tel: (800) 989-6296 / Fax:(650)871-2857 http://www.maximbio.com E-mail: [email protected] Real Time PCR Kit for Human Herpes Virus Type 6 Cat No. TM-60027:

More information

Real-time PCR: Understanding C t

Real-time PCR: Understanding C t APPLICATION NOTE Real-Time PCR Real-time PCR: Understanding C t Real-time PCR, also called quantitative PCR or qpcr, can provide a simple and elegant method for determining the amount of a target sequence

More information

Epstein Barr Virus (Human Herpes virus 4) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere...

Epstein Barr Virus (Human Herpes virus 4) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... TM Primerdesign Ltd TM Primerdesign Ltd Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere...

More information

Bond Valuation I. What is a bond? Cash Flows of A Typical Bond. Bond Valuation. Coupon Rate and Current Yield. Cash Flows of A Typical Bond

Bond Valuation I. What is a bond? Cash Flows of A Typical Bond. Bond Valuation. Coupon Rate and Current Yield. Cash Flows of A Typical Bond What is a bod? Bod Valuatio I Bod is a I.O.U. Bod is a borrowig agreemet Bod issuers borrow moey from bod holders Bod is a fixed-icome security that typically pays periodic coupo paymets, ad a pricipal

More information

Real time and Quantitative (RTAQ) PCR. so I have an outlier and I want to see if it really is changed

Real time and Quantitative (RTAQ) PCR. so I have an outlier and I want to see if it really is changed Real time and Quantitative (RTAQ) PCR or.. for this audience so I have an outlier and I want to see if it really is changed Nigel Walker, Ph.D. Laboratory of Computational Biology and Risk Analysis, Environmental

More information

Scott Reierstad. Field Applications Scientist

Scott Reierstad. Field Applications Scientist Real-time PCR Training Scott Reierstad Field Applications Scientist Topics we ll cover Quick introduction to real-time PCR ABI-supported real-time chemistries Instrumentation Quantitation via Standard

More information

Real Time PCR and the icycler iq Real Time PCR Detection System for Quantitative PCR

Real Time PCR and the icycler iq Real Time PCR Detection System for Quantitative PCR eal Time PC and the icycler iq eal Time PC Detection System for Quantitative PC PC FOMULA Correlazione tra la quantità di amplificato e la quantita iniziale Y = X (1 + E) n -1 Y = PC amplificato DNA quantità

More information

Human Herpes Virus 1 (Herpes simplex type 1) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere...

Human Herpes Virus 1 (Herpes simplex type 1) genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... TM Primerdesign Ltd TM Primerdesign Ltd Human Herpes Virus 1 (Herpes simplex type 1) Capsid assembly and DNA maturation gene genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere...

More information

CS100: Introduction to Computer Science

CS100: Introduction to Computer Science I-class Exercise: CS100: Itroductio to Computer Sciece What is a flip-flop? What are the properties of flip-flops? Draw a simple flip-flop circuit? Lecture 3: Data Storage -- Mass storage & represetig

More information

HCL Dynamic Spiking Protocol

HCL Dynamic Spiking Protocol ELI LILLY AND COMPANY TIPPECANOE LABORATORIES LAFAYETTE, IN Revisio 2.0 TABLE OF CONTENTS REVISION HISTORY... 2. REVISION.0... 2.2 REVISION 2.0... 2 2 OVERVIEW... 3 3 DEFINITIONS... 5 4 EQUIPMENT... 7

More information

Nuclear Energy, Stability, Fisson & Fusion

Nuclear Energy, Stability, Fisson & Fusion Nuclear Eergy, Stability, Fisso & Fusio Ordiary chemical reactios ivolve oly the valece electros. I a chemical reactio chemical bods are formed broke ad reformed. The differece i eergy is usually expressed

More information

B.E. COMPUTER SCIENCE AND ENGINEERING (PART-TIME)

B.E. COMPUTER SCIENCE AND ENGINEERING (PART-TIME) NA UNIVERSITY, CHENNAI - 600 5 Dated: -DEC-12 TIME TABLE - B.E.(PARTTIME)(R-20) DEGREE EXAMINATIONS -Nov/Dec - 22 for cadidates admitted i erstwhile Aa Uiversity of Techology, Tiruchirappalli i 20,2008,2009

More information

Output Analysis (2, Chapters 10 &11 Law)

Output Analysis (2, Chapters 10 &11 Law) B. Maddah ENMG 6 Simulatio 05/0/07 Output Aalysis (, Chapters 10 &11 Law) Comparig alterative system cofiguratio Sice the output of a simulatio is radom, the comparig differet systems via simulatio should

More information

Speed Matters - Fast ways from template to result

Speed Matters - Fast ways from template to result qpcr Symposium 2007 - Weihenstephan Speed Matters - Fast ways from template to result March 28, 2007 Dr. Thorsten Traeger Senior Scientist, Research and Development - 1 - Overview Ạgenda Fast PCR The Challenges

More information

Industrial Batteries Network Power Classic Solar Powerful energy storage for photovoltaic systems. Specifications

Industrial Batteries Network Power Classic Solar Powerful energy storage for photovoltaic systems. Specifications Idustrial Batteries Network Power Classic Solar Powerful eergy storage for photovoltaic systems. Specificatios Cost-effective eergy storage. Classic EerSol are robust flooded batteries for eergy storage

More information

Guide to using the Bio Rad CFX96 Real Time PCR Machine

Guide to using the Bio Rad CFX96 Real Time PCR Machine Guide to using the Bio Rad CFX96 Real Time PCR Machine Kyle Dobbs and Peter Hansen Table of Contents Overview..3 Setup Reaction Guidelines 4 Starting up the Software 5 Setup Protocol on Software 6 Setup

More information

High Quality Primary Antibodies with Extensive Validation

High Quality Primary Antibodies with Extensive Validation High Quality Primary Atibodies with Extesive Validatio Atibodies ad Immuoassays 10,000 primary atibodies with free positive cotrols Ati-tag atibodies for the detectios of recombiat proteis TrueMAB moocloal

More information

Dengue Virus subtypes 1,2 3 and 4. genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... 3 Untranslated Region (3 UTR) 150 tests

Dengue Virus subtypes 1,2 3 and 4. genesig Standard Kit. DNA testing. Everything... Everyone... Everywhere... 3 Untranslated Region (3 UTR) 150 tests TM Primerdesign Ltd TM Primerdesign Ltd Dengue Virus subtypes 1,2 3 and 4 3 Untranslated Region (3 UTR) genesig Standard Kit 150 tests DNA testing Everything... Everyone... Everywhere... For general laboratory

More information

MOLAR MASS of POLYMERS

MOLAR MASS of POLYMERS MOLR MSS of POLYMERS Recogize the ifluece of molar mass (molecular weight) o polymer properties. Uderstad the relatioship betwee molecular weight ad degree of polymerizatio. Uderstad the sigificace of

More information

SYSTEM INFO. MDK - Multifunctional Digital Communications System. Efficient Solutions for Information and Safety

SYSTEM INFO. MDK - Multifunctional Digital Communications System. Efficient Solutions for Information and Safety Commuicatios Systems for Itercom, PA, Emergecy Call ad Telecommuicatios MDK - Multifuctioal Digital Commuicatios System SYSTEM INFO ms NEUMANN ELEKTRONIK GmbH Efficiet Solutios for Iformatio ad Safety

More information

Descriptive Statistics

Descriptive Statistics Descriptive Statistics We leared to describe data sets graphically. We ca also describe a data set umerically. Measures of Locatio Defiitio The sample mea is the arithmetic average of values. We deote

More information

Real-time PCR handbook

Real-time PCR handbook Real-time PCR handbook Single-tube assays 96- and 384-well plates 384-well TaqMan Array cards OpenArray plates The image on this cover is of an OpenArray plate which is primarily used for mid-density real-time

More information

Fluorescence and Fluorescence Applications

Fluorescence and Fluorescence Applications Fluorescence and Fluorescence Applications Contents 1. Introduction... 1 2. Principles of Fluorescence... 1 3. Fluorescence Spectra... 3 4. Fluorescence Resonance Energy Transfer (FRET)... 5 5. Dark Quenchers...

More information

(VCP-310) 1-800-418-6789

(VCP-310) 1-800-418-6789 Maual VMware Lesso 1: Uderstadig the VMware Product Lie I this lesso, you will first lear what virtualizatio is. Next, you ll explore the products offered by VMware that provide virtualizatio services.

More information

Case Study. Normal and t Distributions. Density Plot. Normal Distributions

Case Study. Normal and t Distributions. Density Plot. Normal Distributions Case Study Normal ad t Distributios Bret Halo ad Bret Larget Departmet of Statistics Uiversity of Wiscosi Madiso October 11 13, 2011 Case Study Body temperature varies withi idividuals over time (it ca

More information

Procedures For DNA Sequencing

Procedures For DNA Sequencing Procedures For DNA Sequencing Plant-Microbe Genomics Facility (PMGF) Ohio State University 420 Biological Sciences Building 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204 FAX: 614/292-6337

More information

HPLC Solvents and mobile phases

HPLC Solvents and mobile phases HPLC Solvets ad mobile phases CARLO ERBA Reagets A ew reality for laboratory ad idustry CARLO ERBA Reagets, a emiet brad with a wellkow history, operates at a Iteratioal level i Aalytical ad Idustrial

More information

2.500 Threshold. 2.000 1000e - 001. Threshold. Exponential phase. Cycle Number

2.500 Threshold. 2.000 1000e - 001. Threshold. Exponential phase. Cycle Number application note Real-Time PCR: Understanding C T Real-Time PCR: Understanding C T 4.500 3.500 1000e + 001 4.000 3.000 1000e + 000 3.500 2.500 Threshold 3.000 2.000 1000e - 001 Rn 2500 Rn 1500 Rn 2000

More information

STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY REAL-TIME POLYMERASE CHAI REACTIO (PCR)

STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY REAL-TIME POLYMERASE CHAI REACTIO (PCR) STA DARD OPERATI G PROCEDURE FOR THE DETECTIO OF AFRICA SWI E FEVER VIRUS (ASFV) BY REAL-TIME POLYMERASE CHAI REACTIO (PCR) [email protected] Av/ Puerta de Hierro s/n. 28040 Madrid. Tel: (34) 913944082

More information

Genomic DNA detection assay

Genomic DNA detection assay Genomic DNA detection assay Detection of genomic DNA by real-time PCR Contents CTRL Internal controls and gdna detection Contents Kit Contents 3 Reagents and Equipment to Be Supplied by User 3 Kit Storage

More information

QuantiFast Multiplex PCR Handbook

QuantiFast Multiplex PCR Handbook May 2011 QuantiFast Multiplex PCR Handbook QuantiFast Multiplex PCR Kit with master mix containing ROX passive reference dye QuantiFast Multiplex PCR +R Kit with separate tube of ROX passive reference

More information

Ideate, Inc. Training Solutions to Give you the Leading Edge

Ideate, Inc. Training Solutions to Give you the Leading Edge Ideate, Ic. Traiig News 2014v1 Ideate, Ic. Traiig Solutios to Give you the Leadig Edge New Packages For All Your Traiig Needs! Bill Johso Seior MEP - Applicatio Specialist Revit MEP Fudametals Ad More!

More information

CHAPTER 3 The Simple Surface Area Measurement Module

CHAPTER 3 The Simple Surface Area Measurement Module CHAPTER 3 The Simple Surface Area Measuremet Module I chapter 2, the quality of charcoal i each batch might chage due to traditioal operatio. The quality test shall be performed before usig it as a adsorbet.

More information

Introduction. Preparation of Template DNA

Introduction. Preparation of Template DNA Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;

More information

DNA Sequencing Setup and Troubleshooting

DNA Sequencing Setup and Troubleshooting DNA Sequencing Setup and Troubleshooting Lara Cullen, PhD Scientific Applications Specialist Australia and New Zealand Reviewing Sequencing Data Review the Electropherogram Review the Raw Data (Signal

More information

Molecular Spectroscopy

Molecular Spectroscopy Molecular Spectroscopy UV-Vis Spectroscopy Absorption Characteristics of Some Common Chromophores UV-Vis Spectroscopy Absorption Characteristics of Aromatic Compounds UV-Vis Spectroscopy Effect of extended

More information

PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide

PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR Results Interpretation Guide Pathogen Detection Systems by Real Time PCR Microbial offers real time PCR based systems for the detection of pathogenic bacteria

More information

ADVANCES IN REAL TIME PCR: APPLICATION TO CLINICAL LABORATORY DIAGNOSTICS

ADVANCES IN REAL TIME PCR: APPLICATION TO CLINICAL LABORATORY DIAGNOSTICS ADVANCES IN CLINICAL CHEMISTRY, VOL. 40 ADVANCES IN REAL TIME PCR: APPLICATION TO CLINICAL LABORATORY DIAGNOSTICS Bernhard Kaltenboeck and Chengming Wang Department of Pathobiology, College of Veterinary

More information

Idaho Technology Food Security Systems. System Components. Idaho Technology. Food Security and Pathogen Detection

Idaho Technology Food Security Systems. System Components. Idaho Technology. Food Security and Pathogen Detection Incorporated in 1990, has years of experience developing exciting instruments, software at Inc. Part of s Incorporated in 1990, has years of experience developing exciting instruments, software at Inc.

More information

MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C

MystiCq microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C microrna cdna Synthesis Mix Catalog Number MIRRT Storage Temperature 20 C Product Description The microrna cdna Synthesis Mix has been designed to easily convert micrornas into cdna templates for qpcr

More information

Gene Expression Assays

Gene Expression Assays APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency

More information

DNA Sequencing Troubleshooting Guide.

DNA Sequencing Troubleshooting Guide. DNA Sequencing Troubleshooting Guide. There are a number of factors that can lead to less than perfect DNA sequencing results. In this guide, we explain some of the common problems encountered, and outline

More information

Quantification of Mycobacterium Tuberculosis. 150 tests

Quantification of Mycobacterium Tuberculosis. 150 tests Quantification of Mycobacterium Tuberculosis rep 13E12 For general laboratory and research use only 150 tests Introduction to Mycobacterium Tuberculosis Mycobacterium tuberculosis is the bacterium that

More information

This document contains a collection of formulas and constants useful for SPC chart construction. It assumes you are already familiar with SPC.

This document contains a collection of formulas and constants useful for SPC chart construction. It assumes you are already familiar with SPC. SPC Formulas ad Tables 1 This documet cotais a collectio of formulas ad costats useful for SPC chart costructio. It assumes you are already familiar with SPC. Termiology Geerally, a bar draw over a symbol

More information

Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene. genesig Advanced Kit. DNA testing

Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene. genesig Advanced Kit. DNA testing TM Primerdesign Ltd TM Primerdesign Ltd Epstein Barr Virus (Human Herpes virus 4) nonglycosylated membrane protein (BNRF1) gene genesig Advanced Kit 150 tests DNA testing Everything... Everyone... Everywhere...

More information

Next Generation Sequencing for DUMMIES

Next Generation Sequencing for DUMMIES Next Generation Sequencing for DUMMIES Looking at a presentation without the explanation from the author is sometimes difficult to understand. This document contains extra information for some slides that

More information

Baan Service Master Data Management

Baan Service Master Data Management Baa Service Master Data Maagemet Module Procedure UP069A US Documetiformatio Documet Documet code : UP069A US Documet group : User Documetatio Documet title : Master Data Maagemet Applicatio/Package :

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

Chapter 12 Filters for FISH Imaging

Chapter 12 Filters for FISH Imaging Chapter 12 Filters for FISH Imaging Dan Osborn The application of in situ hybridization (ISH) has advanced from short lived, non-specific isotopic methods, to very specific, long lived, multiple color

More information

Critical Factors for Successful Real-Time PCR

Critical Factors for Successful Real-Time PCR Critical Factors for Successful Real-Time PCR Sample & ssay Technologies Contents 1. Introduction 4 2. Detection of PCR products in real-time 5 2.1 SYR Green 5 2.2 Fluorescently labeled sequence-specific

More information

Confidence Intervals. CI for a population mean (σ is known and n > 30 or the variable is normally distributed in the.

Confidence Intervals. CI for a population mean (σ is known and n > 30 or the variable is normally distributed in the. Cofidece Itervals A cofidece iterval is a iterval whose purpose is to estimate a parameter (a umber that could, i theory, be calculated from the populatio, if measuremets were available for the whole populatio).

More information

Best of security and convenience

Best of security and convenience Get More with Additioal Cardholders. Importat iformatio. Add a co-applicat or authorized user to your accout ad you ca take advatage of the followig beefits: RBC Royal Bak Visa Customer Service Cosolidate

More information

CONTROL CHART BASED ON A MULTIPLICATIVE-BINOMIAL DISTRIBUTION

CONTROL CHART BASED ON A MULTIPLICATIVE-BINOMIAL DISTRIBUTION www.arpapress.com/volumes/vol8issue2/ijrras_8_2_04.pdf CONTROL CHART BASED ON A MULTIPLICATIVE-BINOMIAL DISTRIBUTION Elsayed A. E. Habib Departmet of Statistics ad Mathematics, Faculty of Commerce, Beha

More information

Center, Spread, and Shape in Inference: Claims, Caveats, and Insights

Center, Spread, and Shape in Inference: Claims, Caveats, and Insights Ceter, Spread, ad Shape i Iferece: Claims, Caveats, ad Isights Dr. Nacy Pfeig (Uiversity of Pittsburgh) AMATYC November 2008 Prelimiary Activities 1. I would like to produce a iterval estimate for the

More information

The following example will help us understand The Sampling Distribution of the Mean. C1 C2 C3 C4 C5 50 miles 84 miles 38 miles 120 miles 48 miles

The following example will help us understand The Sampling Distribution of the Mean. C1 C2 C3 C4 C5 50 miles 84 miles 38 miles 120 miles 48 miles The followig eample will help us uderstad The Samplig Distributio of the Mea Review: The populatio is the etire collectio of all idividuals or objects of iterest The sample is the portio of the populatio

More information

Automatic Tuning for FOREX Trading System Using Fuzzy Time Series

Automatic Tuning for FOREX Trading System Using Fuzzy Time Series utomatic Tuig for FOREX Tradig System Usig Fuzzy Time Series Kraimo Maeesilp ad Pitihate Soorasa bstract Efficiecy of the automatic currecy tradig system is time depedet due to usig fixed parameters which

More information

A Combined Continuous/Binary Genetic Algorithm for Microstrip Antenna Design

A Combined Continuous/Binary Genetic Algorithm for Microstrip Antenna Design A Combied Cotiuous/Biary Geetic Algorithm for Microstrip Atea Desig Rady L. Haupt The Pesylvaia State Uiversity Applied Research Laboratory P. O. Box 30 State College, PA 16804-0030 [email protected] Abstract:

More information

QuantStudio 6 and 7 Flex Real-Time PCR Systems

QuantStudio 6 and 7 Flex Real-Time PCR Systems USER GUIDE QuantStudio 6 and 7 Flex Real-Time PCR Systems MAINTENANCE AND ADMINISTRATION Publication Number 4489821 Revision A November 2013 For Research Use Only. Not for use in diagnostic procedures.

More information

1. C. The formula for the confidence interval for a population mean is: x t, which was

1. C. The formula for the confidence interval for a population mean is: x t, which was s 1. C. The formula for the cofidece iterval for a populatio mea is: x t, which was based o the sample Mea. So, x is guarateed to be i the iterval you form.. D. Use the rule : p-value

More information

KASP genotyping chemistry User guide and manual

KASP genotyping chemistry User guide and manual KASP genotyping chemistry User guide and manual KASP manual content 1. Introduction 3 2. Principal of the KASP genotyping assay 3 2.1 Mechanism of KASP chemistry 4 3. The KASP reaction component 5 3.1

More information

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of

More information

GenScript BloodReady TM Multiplex PCR System

GenScript BloodReady TM Multiplex PCR System GenScript BloodReady TM Multiplex PCR System Technical Manual No. 0174 Version 20040915 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI

More information

SmartFlare RNA Detection Probes: Principles, protocols and troubleshooting

SmartFlare RNA Detection Probes: Principles, protocols and troubleshooting Technical Guide SmartFlare RNA Detection Probes: Principles, protocols and troubleshooting Principles of SmartFlare technology RNA detection traditionally requires transfection, laborious sample prep,

More information