SUPPLEMENTARY MATERIAL
|
|
|
- Norah Flowers
- 8 years ago
- Views:
Transcription
1 SUPPLEMENTARY MATERIAL Discovery and molecular characterization of a new cryptovirus dsrna genome from Japanese persimmon through conventional cloning and high-throughput sequencing M. Morelli 1, M. Chiumenti 1, A. De Stradis 1, P. La Notte 1, A. Minafra 1 1 Istituto per la Protezione Sostenibile delle Piante (CNR-IPSP), UOS Bari, Via Amendola 122/D, Bari, Italy Corresponding author Dr. Massimiliano Morelli, Ph.D. Istituto per la Protezione Sostenibile delle Piante (CNR-IPSP), UOS Bari Via Amendola 122/D, Bari, Italy Tel Fax massimiliano.morelli@uniba.it
2 Tab. S1 List of oligonucleotide primers used in this study, with indication of sequence and genome position (when available) Primer Sequence 5-3 Genome nt position F090 AGTTTCGAGTCGTCTTCGGCGG dsrna R090 GTGTTGTTCACCGGTGTAGTAACT dsrna CryKaF ACGTCCACGACCGATTGTGC dsrna CryNeR ACGAAGACACGTAACACGCAGTGG dsrna ADPcm GAGAAGGATGCGGTT RLM-RACE universal primer M13F TTGTAAAACGACGGCCAGT Cloning universal primer M13R CAGGAAACAGCTATGACC Cloning universal primer DOP OHCCGACTCGAGNNNNNNATGTGGOH DOP-PCR universal primer
3 Tab. S2 Summary of statistical data retrieved from Illumina HiScan SQ deep-sequencing of SSPI accession and subsequent bioinformatics analysis Sequencing data size 5,190 Gb Raw reads 33,632,035 Unique reads 1,994,231 PeCV reads 586,451 Assembled contigs 1,829 Average read number Mean coverage index Assembled reads Persimmon cryptic virus dsrna-1 (PeCV, GenBank HE805113) Persimmon cryptic virus dsrna-2 (PeCV, GenBank HE805114) PeCV contigs 54,320 Other contigs 376 PeCV contigs Other contigs 22.9 Reads Count Fwd. Rev. 421, , , ,514 78,288 86,226 General statistics Reference Length (nt) % Total % Coverage Mean Coverage reads/pos. 1, ,489 1, ,563
4 Tab. S3 Persimmon accessions used in this study for RT-PCR detection of PeCV, with indication of their provenance and host Accession Provenance RT-PCR SSPI Santo Spirito (Bari, Italy) Private orchard + BOS1 Gioia del Colle (Bari, Italy) Private orchard + BOS2 Gioia del Colle (Bari, Italy) Private orchard - SAL Terlizzi (Bari, Italy) Private orchard + PAL Locorotondo (Bary, Italy) Private orchard + GIA1 Santeramo in Colle (Bari, Italy) Private orchard + GIA2 Santeramo in Colle (Bari, Italy) Private orchard + ORI1 Oria (Brindisi, Italy) Private orchard + ORI2 Oria (Brindisi, Italy) Private orchard - SEM1 Sammichele di Bari (Bari, Italy) Nursery seedling + SEM2 Sammichele di Bari (Bari, Italy) Nursery seedling + SEM3 Sammichele di Bari (Bari, Italy) Nursery seedling + SEM4 Sammichele di Bari (Bari, Italy) Nursery seedling + SEM5 Sammichele di Bari (Bari, Italy) Nursery seedling - SEM6 Sammichele di Bari (Bari, Italy) Nursery seedling +
5 Fig. S1 Illumina HiScan SQ deep-sequencing analysis of PeCV reads obtained from SSPI accession, showing graphical distribution of read matches at each nucleotide position of genomic dsrna-1 and dsrna- 2. Rectangular boxes below the graphs represents coding ORFs
6 Fig. S2 Secondary structure 2D view of PeCV dsrna-1 (A) and dsrna-2 (B) 5 -UTR plus-strand sequences, with the highlighting of putative hairpin-loop structures and indication of related free energy contribution
7 Fig. S3 Phylogenetic tree constructed on capsid protein (CP) of PeCV and members of the family Partitiviridae. Tree was generated using neighbor-joining-based bootstrap analysis with 1,000 replicates. Numbers on branches indicate bootstrap values above 600. Bar represents 0.2 amino-acid substitutions per site. AoV-1, ABV30675, Aspergillus ochraceous virus 1; BCV-1, ACA81389, Beet cryptic virus 1; BFV-1, YP_ , Botryotinia fuckeliana partitivirus 1; CaCV, ACL93278, Carrot cryptic virus; CCV, AET80948, Cannabis cryptic virus; CiLCV, AGH12859, Citrullus lanatus cryptic virus; CCCV-2, AGJ83769, Crimson clover cryptic virus 2; CrV-1, AAU26069, Ceratocystis resinifera virus 1; DCV-2, AGJ83771, Dill cryptic virus 2; DdV-1, NP_620301, Discula destructiva virus 1; FChCV, AAZ06131, Fragaria chiloensis cryptic virus; FCV, CBW77436, Fig cryptic virus; FpV-1, AAC98734, Fusarium poae virus 1; GaRV, AAM12240, Gremmeniella abietina RNA virus MS1; HTCV-2, YP_ , Hop trefoil cryptic virus 2; MCV-1, GU145316, Mulberry cryptic virus 1; PCV-1, AEJ07890, Pepper cryptic virus 1; PCV-2, AEJ07892; Pepper cryptic virus 2; PeCV, HE805113, Persimmon cryptic virus; PmV-1, ABW82141, Primula malacoides virus 1; PoV-1, ACX43952, Pleurotus ostreatus virus 1; PsV-S, YP_052856, Penicillium stoloniferum virus S; RCCV-2, YP_ , Red clover cryptic virus 2; RCV-1, YP_ , Rose cryptic virus 1; RnV-1, YP_392480, Rosellinia necatrix partitivirus 1; RsCV-1, YP_656506, Raphanus sativus cryptic virus 1; RsV-717, AF133290, Rhizoctonia solani virus 717; VCV, ABN71241, Vicia cryptic virus; WCCV-1, AAU14888, White clover cryptic virus 1
Typing in the NGS era: The way forward!
Typing in the NGS era: The way forward! Valeria Michelacci NGS course, June 2015 Typing from sequence data NGS-derived conventional Multi Locus Sequence Typing (University of Warwick, 7 housekeeping genes)
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
GenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
CLC Sequence Viewer USER MANUAL
CLC Sequence Viewer USER MANUAL Manual for CLC Sequence Viewer 7.6.1 Windows, Mac OS X and Linux September 3, 2015 This software is for research purposes only. QIAGEN Aarhus A/S Silkeborgvej 2 Prismet
How To Identify A Plant Cryptic Virus
THESIS OF DOCTORAL DISSERTATION DISTRIBUTION, PERSISTENCE AND MOLECULAR CHARACTERIZATION OF CRYPTIC AND ENDORNAVIRUSES ANITA SZEGŐ Supervisor: Noémi Lukács, PhD Corvinus University of Budapest Department
Module 1. Sequence Formats and Retrieval. Charles Steward
The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.
Multiple Sequence Alignment. Hot Topic 5/24/06 Kim Walker
Multiple Sequence Alignment Hot Topic 5/24/06 Kim Walker Outline Why are Multiple Sequence Alignments useful? What Tools are Available? Brief Introduction to ClustalX Tools to Edit and Add Features to
UGENE Quick Start Guide
Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website: http://ugene.unipro.ru.
Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011
Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear
Rapid DNA-based prediction of mycotoxin levels in food and feed
Rapid DNA-based prediction of mycotoxin levels in food and feed Ralf Kristensen Section of Feed and Food Microbiology Project 3 year Post.doc.(2007-2009) Financially supported by the Norwegian Research
Bioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
Clone Manager. Getting Started
Clone Manager for Windows Professional Edition Volume 2 Alignment, Primer Operations Version 9.5 Getting Started Copyright 1994-2015 Scientific & Educational Software. All rights reserved. The software
The CVN Development Programme a 4-month update
The CVN Development Programme a 4-month update Peter Simmonds Centre for Infectious Diseases University of Edinburgh Edinburgh CVN Development Programme Initiative announced in 2009 to focus development
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org
BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,
Biological Sequence Data Formats
Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless
Getting Started Guide
Primer Express Software Version 3.0 Getting Started Guide Before You Begin Designing Primers and Probes for Quantification Assays Designing Primers and Probes for Allelic Discrimination Assays Ordering
The Galaxy workflow. George Magklaras PhD RHCE
The Galaxy workflow George Magklaras PhD RHCE Biotechnology Center of Oslo & The Norwegian Center of Molecular Medicine University of Oslo, Norway http://www.biotek.uio.no http://www.ncmm.uio.no http://www.no.embnet.org
Protein Sequence Analysis - Overview -
Protein Sequence Analysis - Overview - UDEL Workshop Raja Mazumder Research Associate Professor, Department of Biochemistry and Molecular Biology Georgetown University Medical Center Topics Why do protein
Description: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
Scottish Qualifications Authority
National Unit specification: general information Unit code: FH2G 12 Superclass: RH Publication date: March 2011 Source: Scottish Qualifications Authority Version: 01 Summary This Unit is a mandatory Unit
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
GenBank: A Database of Genetic Sequence Data
GenBank: A Database of Genetic Sequence Data Computer Science 105 Boston University David G. Sullivan, Ph.D. An Explosion of Scientific Data Scientists are generating ever increasing amounts of data. Relevant
Vector NTI Advance 11 Quick Start Guide
Vector NTI Advance 11 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Version 11.0 December 15, 2008 12605022 Published by: Invitrogen Corporation 5791 Van Allen Way Carlsbad, CA 92008 U.S.A.
Genome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009
Genome and DNA Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Admin Reading: Chapters 1 & 2 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring09/bme110-calendar.html
Applying data integration into reconstruction of gene networks from micro
Applying data integration into reconstruction of gene networks from microarray data PhD Thesis Proposal Dipartimento di Informatica e Scienze dell Informazione Università degli Studi di Genova December
2011.008a-cB. Code assigned:
This form should be used for all taxonomic proposals. Please complete all those modules that are applicable (and then delete the unwanted sections). For guidance, see the notes written in blue and the
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe
Go where the biology takes you. Genome Analyzer IIx Genome Analyzer IIe Go where the biology takes you. To published results faster With proven scalability To the forefront of discovery To limitless applications
Supporting Online Material for
www.sciencemag.org/cgi/content/full/312/5781/1762/dc1 Supporting Online Material for Silk Genes Support the Single Origin of Orb Webs Jessica E. Garb,* Teresa DiMauro, Victoria Vo, Cheryl Y. Hayashi *To
FINANCIAL RISK EVALUATION BY THE TREE OF PROBABILITY DECISIONS METHOD Mariya Bruseva Varna Free University, Bulgaria mariya.bruseva@gmail.
FINANCIAL RISK EVALUATION BY THE TREE OF PROBABILITY DECISIONS METHOD Mariya Bruseva Varna Free University, Bulgaria mariya.bruseva@gmail.com Abstract: Any enterprise activity is inextricably linked to
Software review. Analysis for free: Comparing programs for sequence analysis
Analysis for free: Comparing programs for sequence analysis Keywords: sequence comparison tools, alignment, annotation, freeware, sequence analysis Abstract Programs to import, manage and align sequences
RAST Automated Analysis. What is RAST for?
RAST Automated Analysis Gordon D. Pusch Fellowship for Interpretation of Genomes What is RAST for? RAST is designed to rapidly call and annotate the genes of a complete or essentially complete prokaryotic
HENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT
HENIPAVIRUS ANTIBODY ESCAPE SEQUENCING REPORT Kimberly Bishop Lilly 1,2, Truong Luu 1,2, Regina Cer 1,2, and LT Vishwesh Mokashi 1 1 Naval Medical Research Center, NMRC Frederick, 8400 Research Plaza,
G E N OM I C S S E RV I C ES
GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E
Difficult DNA Templates Sequencing. Primer Walking Service
Difficult DNA Templates Sequencing Primer Walking Service Result 16/18s (ITS 5.8s) rrna Sequencing Phylogenetic tree 16s rrna Region ITS rrna Region ITS and 26s rrna Region Order and Result Cloning Service
Basic Course on Bioinformatics tools for Next Generation Sequencing data mining 11-12 June, 2015 Istituto Superiore di Sanità, SIDBAE Training Room
EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Basic Course on Bioinformatics tools for Next Generation Sequencing data mining 11-12
Basic Analysis of Microarray Data
Basic Analysis of Microarray Data A User Guide and Tutorial Scott A. Ness, Ph.D. Co-Director, Keck-UNM Genomics Resource and Dept. of Molecular Genetics and Microbiology University of New Mexico HSC Tel.
Searching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
Gruppi di lavoro Biologia Cellulare e Molecolare Biotecnologie e Differenziamento. Università degli Studi di Napoli Federico II BIOGEM.
Società Botanica Italiana Gruppi di lavoro Biologia Cellulare e Molecolare Biotecnologie e Differenziamento Università degli Studi di Napoli Federico II BIOGEM Organize the Summer School Challenges, methods
Fuld Skolerapport for Søhusskolen, i Odense kommune, for skoleår 2013/2014 for klassetrin(ene) 9. med reference Tilsvarende klassetrin i kommunen
Side 1 af 41 Side 2 af 41 Side 3 af 41 Side 4 af 41 Side 5 af 41 Side 6 af 41 Side 7 af 41 Side 8 af 41 Side 9 af 41 Side 10 af 41 Side 11 af 41 Side 12 af 41 Side 13 af 41 Side 14 af 41 Side 15 af 41
Fuld Skolerapport for Hunderupskolen, i Odense kommune, for skoleår 2013/2014 for klassetrin(ene) 7. med reference Tilsvarende klassetrin i kommunen
Side 1 af 43 Side 2 af 43 Side 3 af 43 Side 4 af 43 Side 5 af 43 Side 6 af 43 Side 7 af 43 Side 8 af 43 Side 9 af 43 Side 10 af 43 Side 11 af 43 Side 12 af 43 Side 13 af 43 Side 14 af 43 Side 15 af 43
CRAC: An integrated approach to analyse RNA-seq reads Additional File 3 Results on simulated RNA-seq data.
: An integrated approach to analyse RNA-seq reads Additional File 3 Results on simulated RNA-seq data. Nicolas Philippe and Mikael Salson and Thérèse Commes and Eric Rivals February 13, 2013 1 Results
UF EDGE brings the classroom to you with online, worldwide course delivery!
What is the University of Florida EDGE Program? EDGE enables engineering professional, military members, and students worldwide to participate in courses, certificates, and degree programs from the UF
1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.
Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,
Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms
Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).
Integration of Protein-protein Interaction Data in a Genomic and proteomic Data Warehouse
Integration of Protein-protein Interaction Data in a Genomic and proteomic Data Warehouse CANAKOGLU A, GHISALBERTI G, MASSEROLI M Dipartimentodi Elettronicae Informazione,Politecnicodi Milano, PiazzaLeonardoda
Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community
Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community Ntinos Krampis Asst. Professor J. Craig Venter Institute kkrampis@jcvi.org http://www.jcvi.org/cms/about/bios/kkrampis/
Outline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction
Outline MicroRNA Bioinformatics Rickard Sandberg Dept. of Cell and Molecular Biology (CMB) Karolinska Institutet! Introduction! microrna target site prediction! Useful resources 2 short non-coding RNAs
A Tutorial in Genetic Sequence Classification Tools and Techniques
A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University jakemdrew@gmail.com www.jakemdrew.com Sequence Characters IUPAC nucleotide
4.2.1. What is a contig? 4.2.2. What are the contig assembly programs?
Table of Contents 4.1. DNA Sequencing 4.1.1. Trace Viewer in GCG SeqLab Table. Box. Select the editor mode in the SeqLab main window. Import sequencer trace files from the File menu. Select the trace files
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
La capture de la fonction par des approches haut débit
Colloque Génomique Environnementale LYON 2011 La capture de la fonction par des approches haut débit Pierre PEYRET J. Denonfoux, N. Parisot, E. Dugat-Bony, C. Biderre-Petit, D. Boucher, G. Fonty, E. Peyretaillade
A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques
Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web
Multiple Losses of Flight and Recent Speciation in Steamer Ducks Tara L. Fulton, Brandon Letts, and Beth Shapiro
Supplementary Material for: Multiple Losses of Flight and Recent Speciation in Steamer Ducks Tara L. Fulton, Brandon Letts, and Beth Shapiro 1. Supplementary Tables Supplementary Table S1. Sample information.
PHYLOGENY AND EVOLUTION OF NEWCASTLE DISEASE VIRUS GENOTYPES
Eötvös Lóránd University Biology Doctorate School Classical and molecular genetics program Project leader: Dr. László Orosz, corresponding member of HAS PHYLOGENY AND EVOLUTION OF NEWCASTLE DISEASE VIRUS
Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at
Woods Hole Zebrafish Genetics and Development Bioinformatics/Genomics Lab Ian Woods Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at http://faculty.ithaca.edu/iwoods/docs/wh/
When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community
Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community Ntinos Krampis Asst. Professor J. Craig Venter Institute kkrampis@jcvi.org http://www.jcvi.org/cms/about/bios/kkrampis/
BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis
BIOL 3200 Spring 2015 DNA Subway and RNA-Seq Data Analysis By the end of this lab students should be able to: Describe the uses for each line of the DNA subway program (Red/Yellow/Blue/Green) Describe
Supplemental Information for
Supplemental Information for Mechanism of Retinoic acid-induced transcription: histone code, DNA oxidation and formation of chromatin loops Candida Zuchegna 1, Fabiana Aceto 2, Alessandra Bertoni 3, Antonella
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:
A data management framework for the Fungal Tree of Life
Web Accessible Sequence Analysis for Biological Inference A data management framework for the Fungal Tree of Life Kauff F, Cox CJ, Lutzoni F. 2007. WASABI: An automated sequence processing system for multi-gene
Visualization of Phylogenetic Trees and Metadata
Visualization of Phylogenetic Trees and Metadata November 27, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com
Usability in bioinformatics mobile applications
Usability in bioinformatics mobile applications what we are working on Noura Chelbah, Sergio Díaz, Óscar Torreño, and myself Juan Falgueras App name Performs Advantajes Dissatvantajes Link The problem
2 Short biographies and contact information of the workshop organizers
1 Title of the workshop from sequence to surveillance 2 Short biographies and contact information of the workshop organizers Dr Peter Durr - peter.durr@csiro.au Veterinary epidemiologist, Australian Animal
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
Bioinformatics Unit Department of Biological Services. Get to know us
Bioinformatics Unit Department of Biological Services Get to know us Domains of Activity IT & programming Microarray analysis Sequence analysis Bioinformatics Team Biostatistical support NGS data analysis
Services. Updated 05/31/2016
Updated 05/31/2016 Services 1. Whole exome sequencing... 2 2. Whole Genome Sequencing (WGS)... 3 3. 16S rrna sequencing... 4 4. Customized gene panels... 5 5. RNA-Seq... 6 6. qpcr... 7 7. HLA typing...
Serial Cloner 1.2. User Manual Part I -Basic functions -
Serial Cloner 1.2 User Manual Part I -Basic functions - I Built-In Help Window You will find in this manual the description of the different windows and functions of Serial Cloner as well as some useful
Becker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
Domain-Expert Users and their Needs of Software Development 1
Domain-Expert Users and their Needs of Software Development 1 M.F. Costabile, D. Fogli*, C. Letondal +, P. Mussio*, A. Piccinno DI - Università di Bari Via Orabona 4 Bari, Italy [costabile, piccinno]@di.uniba.it
The world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
Reading DNA Sequences:
Reading DNA Sequences: 18-th Century Mathematics for 21-st Century Technology Michael Waterman University of Southern California Tsinghua University DNA Genetic information of an organism Double helix,
Delivering the power of the world s most successful genomics platform
Delivering the power of the world s most successful genomics platform NextCODE Health is bringing the full power of the world s largest and most successful genomics platform to everyday clinical care NextCODE
Core Facility Genomics
Core Facility Genomics versatile genome or transcriptome analyses based on quantifiable highthroughput data ascertainment 1 Topics Collaboration with Harald Binder and Clemens Kreutz Project: Microarray
Gene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
IMCAS-BRC: toward better management and more efficient exploitation of microbial resources
IMCAS-BRC: toward better management and more efficient exploitation of microbial resources Xiuzhu Dong Biological Resources Center Institute of Microbiology, Chinese Academy of Sciences Challenges Global
Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company
Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just
17 July 2014 WEB-SERVER MANUAL. Contact: Michael Hackenberg (hackenberg@ugr.es)
WEB-SERVER MANUAL Contact: Michael Hackenberg (hackenberg@ugr.es) 1 1 Introduction srnabench is a free web-server tool and standalone application for processing small- RNA data obtained from next generation
THE EFFECT OF SOIL DISINFECTION WITH CHEMICAL AND ALTERNATIVE METHODS ON FUNGAL AND BACTERIAL POPULATIONS
THE EFFECT OF SOIL DISINFECTION WITH CHEMICAL AND ALTERNATIVE METHODS ON FUNGAL AND BACTERIAL POPULATIONS P. Sobiczewski1, H. Bryk1, B. Meszka1, C. Ślusarski1, E. Malusá2 1Institute 2 of Horticulture,
Analysis of ChIP-seq data in Galaxy
Analysis of ChIP-seq data in Galaxy November, 2012 Local copy: https://galaxy.wi.mit.edu/ Joint project between BaRC and IT Main site: http://main.g2.bx.psu.edu/ 1 Font Conventions Bold and blue refers
The NGS IT notes. George Magklaras PhD RHCE
The NGS IT notes George Magklaras PhD RHCE Biotechnology Center of Oslo & The Norwegian Center of Molecular Medicine University of Oslo, Norway http://www.biotek.uio.no http://www.ncmm.uio.no http://www.no.embnet.org
Bioinformatics, Sequences and Genomes
Bioinformatics, Sequences and Genomes BL4273 Bioinformatics for Biologists Week 1 Daniel Barker, School of Biology, University of St Andrews Email db60@st-andrews.ac.uk BL4273 and 4273π 4273π is a custom
Bioinformatica. Dr. Marco Fondi Lezione # 6. Corso di Laurea in Scienze Biologiche, AA 2012-2013
Bioinformatica Dr. Marco Fondi Lezione # 6 Corso di Laurea in Scienze Biologiche, AA 2012-2013 martedì 30 ottobre 2012 1 Sequenziamento ed analisi di genomi: la genomica 2 martedì 30 ottobre 2012 martedì
Analisi in silicoe relazione tra enterotossine stafilococciche e tossine ipotetiche
IZSTO Istituto Zooprofilattico Sperimentale del Piemonte, Liguria e Valle d Aosta VI WORKSHOP DEL LABORATORIO NAZIONALE DI RIFERIMENTO (NRL) PER GLI STAFILOCOCCHI COAGULASI POSITIVI COMPRESO S.AUREUS 12
RNA Viruses. A Practical Approac h. Alan J. Cann
RNA Viruses A Practical Approac h Alan J. Cann List of protocols page xiii Abbreviations xvii Investigation of RNA virus genome structure 1 A j. Easton, A.C. Marriott and C.R. Pringl e 1 Introduction-the
New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova
New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard
Outline. interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work?
Outline Outline interfering RNA - What is dat? Brief history of RNA interference. What does it do? How does it work? What is RNA interference? Recently discovered regulatory level. Genome immune system.
RNAseq analysis highlights specific transcriptome signatures of yeast and mycelial growth phases in the Dutch elm disease fungus Ophiostoma novo ulmi.
RNAseq analysis highlights specific transcriptome signatures of yeast and mycelial growth phases in the Dutch elm disease fungus Ophiostoma novo ulmi. Martha Nigg *, Ɨ, Jérôme Laroche *, ǂ, Christian R.
AS4.1 190509 Replaces 260806 Page 1 of 50 ATF. Software for. DNA Sequencing. Operators Manual. Assign-ATF is intended for Research Use Only (RUO):
Replaces 260806 Page 1 of 50 ATF Software for DNA Sequencing Operators Manual Replaces 260806 Page 2 of 50 1 About ATF...5 1.1 Compatibility...5 1.1.1 Computer Operator Systems...5 1.1.2 DNA Sequencing
Overview of Eukaryotic Gene Prediction
Overview of Eukaryotic Gene Prediction CBB 231 / COMPSCI 261 W.H. Majoros What is DNA? Nucleus Chromosome Telomere Centromere Cell Telomere base pairs histones DNA (double helix) DNA is a Double Helix
Geneious 8.1. Biomatters Ltd
Geneious 8.1 Biomatters Ltd August 10, 2015 2 Contents 1 Getting Started 5 1.1 Downloading & Installing Geneious.......................... 5 1.2 Geneious setup...................................... 6 1.3
Big Data Challenges. technology basics for data scientists. Spring - 2014. Jordi Torres, UPC - BSC www.jorditorres.
Big Data Challenges technology basics for data scientists Spring - 2014 Jordi Torres, UPC - BSC www.jorditorres.eu @JordiTorresBCN Data Deluge: Due to the changes in big data generation Example: Biomedicine
Cloud Computing Solutions for Genomics Across Geographic, Institutional and Economic Barriers
Cloud Computing Solutions for Genomics Across Geographic, Institutional and Economic Barriers Ntinos Krampis Asst. Professor J. Craig Venter Institute kkrampis@jcvi.org http://www.jcvi.org/cms/about/bios/kkrampis/
Next Generation Sequencing Technologies in Microbial Ecology. Frank Oliver Glöckner
Next Generation Sequencing Technologies in Microbial Ecology Frank Oliver Glöckner 1 Max Planck Institute for Marine Microbiology Investigation of the role, diversity and features of microorganisms Interactions
Annex 6: Nucleotide Sequence Information System BEETLE. Biological and Ecological Evaluation towards Long-Term Effects
Annex 6: Nucleotide Sequence Information System BEETLE Biological and Ecological Evaluation towards Long-Term Effects Long-term effects of genetically modified (GM) crops on health, biodiversity and the
Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment
Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249
Bioinformatics: course introduction
Bioinformatics: course introduction Filip Železný Czech Technical University in Prague Faculty of Electrical Engineering Department of Cybernetics Intelligent Data Analysis lab http://ida.felk.cvut.cz