AS Replaces Page 1 of 50 ATF. Software for. DNA Sequencing. Operators Manual. Assign-ATF is intended for Research Use Only (RUO):

Save this PDF as:
 WORD  PNG  TXT  JPG

Size: px
Start display at page:

Download "AS4.1 190509 Replaces 260806 Page 1 of 50 ATF. Software for. DNA Sequencing. Operators Manual. Assign-ATF is intended for Research Use Only (RUO):"

Transcription

1 Replaces Page 1 of 50 ATF Software for DNA Sequencing Operators Manual

2 Replaces Page 2 of 50 1 About ATF Compatibility Computer Operator Systems DNA Sequencing Chemistry and DNA Sequencers Overview Getting Started Installation Quick Guide Login Create Reference Sequence Create a Reference Sequence from a GenBank Entry Creating a Reference Sequence from a fasta file Creating Analysis Settings Entering your sequence file-naming convention Creating the Sequence Analysis Settings Import your Sequences Sequence Analysis and Editing Producing a Report Saving and Opening Layouts Detailed Users Guide and Description of Functions Logging On Adding New Operators Changing the password Additional Functions of the Login Page Default Settings System Files Operator Levels Setting up ATF for Analysis Setting the Analysis Parameters Creating new settings files in Edit Setting General Setting the Electropherogram Display: Colours, fonts and line widths Setting the sequence-file naming convention in Edit Settings Naming Set the Naming convention by defining the Sample Delimiters Setting the Naming convention by defining the Sample Name, Library alias positions and word length Setting the data analysis parameters in Settings Engine BCS Limits Matching Mode Basecaller Apply Height Maps Update Maps Apply Auto Editing (Not recommended for variant detection applications)...20

3 Replaces Page 3 of Suggested Applications for Picket Fence Analysis (Check Apply Maps and / or Update Maps) Suggested Applications for Non-Picket Fence Analysis (Do NOT Check Apply Maps and / or Update Maps) Suggested Applications for Autoediting Summary: Sequencing Application and Analysis Parameters Creating Reference Sequences in Setting References Creating a new reference from a GenBank files Saving GenBank Files Creating the references sequence file in Assign Creating a new reference from text files in Fasta format Annotating the Reference Sequence: Editing or Adding Reference sequence information Creating Coding Groups Adding the location of known variants to the reference sequence Removing primer site sequence from analysis using Trim Haplotype specific of diploid template using haplotype specific sequencing primers Additional Reference Sequence Functions Settings Appendix Picket Fences (See Basecaller) Sequence Electropherogram Quality: The Base Call Score (BCS)31 6 Importing Sequences into Assign for Analysis Importing sequences is performed by selecting File Import Importing Sequences by Directory Importing Sequences Individually Importing Sequences Using the Filter Function Sequence Analysis and Editing The Analysis Screen The Sample Pane The Electropherogram (EPG) Pane Migrating through the sequence EPG is performed The Navigator Editing using the Navigator Keypad Priority Editing Additional Sample and Sequence Editing Functions Editing in the Sample Pane Editing in the EPG pane Additional Functions Zooming the EPG Hiding the EPG Expanding the EPG Window Sequence View Options Select Consensus to view the sample text sequences Select Dots after selecting consensus to view only those sequences that differ from the reference sequence...41

4 Replaces Page 4 of Select Quality to view the sample text sequences and BCS Suggested Applications for Consensus sequence and Quality view Select Alignment to view the sequences of the best matched alleles Reports Variant Report Genotype Report HARPs Report FASTA Report Quality Report Saving, Opening and Printing Layouts FAQ Contact Us...50

5 Replaces Page 5 of 50 1 About ATF ATF is a sophisticated, yet simple to use software program for the analysis of DNA sequence electropherograms from automated DNA sequencers. ATF can be used for an extensive range of sequencing applications as well as producing quality control information in a unique and informative manner Compatibility Computer Operator Systems ATF is compatible with Windows NT, Windows 2000, Windows XP and Windows Vista operating systems. Microsoft Excel 97 or above is required for the creation of enhanced reports DNA Sequencing Chemistry and DNA Sequencers ATF requires.ab1 or.abd sequence files from automated DNA sequencers. The files should be run through the Applied Biosystems Sequence Analysis software or similar. Automated DNA sequencers from Applied Biosystems TM, Beckman, and Amersham have been used successfully with ATF. 1.2 Overview Developed by laboratory scientists and expert computer programmers with extensive experience in DNA sequencing ATF is a sequencing enabling software designed to handle any DNA sequencing application. Removes data analysis as a bottleneck for high throughput sequencing based genotyping, SNP discovery, mutation and variant detection and contig assembly User friendly with minimum hands on

6 Replaces Page 6 of 50 Includes a patented approach to electropherogram analysis that normalises the data and enables the quantitative nature of DNA sequencing to be exploited. This approach, nicknamed Picket Fence analysis, improves heterozygous base calling and accurate detection of low level mutants Performs a dynamic assessment of background noise and compensates to perform accurate base calling on data with background Enables genotyping and variant analysis of heterozygous insertions and deletions Strong focus on data quality with quality indicators for each sequenced position, each sequencing primer and each sample Enables analysis of critical quality parameters such as peak quality, signal intensities and base call accuracy (sequence edits) Unique approach to quality control that enables automatic generation of longitudinal quality control data. This enables the effect of reagent change on sequence data quality to be assessed and enables performance criteria to be established. Different levels of access are possible to control release of results to appropriate personnel and provide an analysis audit trail 2 Getting Started 2.1 Installation ATF is a single user application. It has been encrypted to prevent copying to other computers. You can obtain ATF by contacting Conexio Genomics o You will be provided with a link to enable the installer to be downloaded The file you will receive is called Setup.msi. Save this onto the hard disk of your computer. Once saved, double click on the Setup.msi icon and follow the installation instructions. During installation you will be asked to send you computer hardware number before being granted access to the software. The installer provides you with this number. Copy and Paste it into an message and it to for licence registration.

7 Replaces Page 7 of 50 3 Quick Guide This section describes the basic functions of ATF and provides sufficient information for basic analysis: How to login How to create a reference sequence to which unknown sequences are compared How to create analysis settings for automated analysis of data How to perform sequence data editing How to generate a report How to Save a Layout How to Open a saved layout 3.1 Login 1. Open an ATF layout by clicking on the shortcut created during installation or the ATF.exe icon 2. Login using the Admin username and the default password cg01. See Section 4 Additional users can be added with unique passwords and varying levels of access. See 3.2 Create Reference Sequence A reference sequence is required for Genotyping and Variant Detection. In Genotyping the reference sequence represents a library of genotypes. Reference sequences are not required for de novo contig assembly or analysis of unknown sequences Create a Reference Sequence from a GenBank Entry 1. Go to the GenBank web page that contains the reference sequence 2. Save the web page as a text file. 3. In ATF go Edit Settings References 4. Click on the Import GenBank button See section 5.4 ATF will create an annotated reference sequence based on information in GenBank. Additional information, such as known variants can be

8 Replaces Page 8 of Browse to the GenBank text file 6. Import 7. Edit or enter the reference sequence information. This includes the reference sequence name, the reference sequence filename and the version are required added manually. Regions within the sequence that contain coding groups can also be added to enable reporting of putative amino acids 8. Click Save Reference Creating a Reference Sequence from a fasta file 1. Save the reference sequence as a text file in fasta format 2. Change the.txt extension to.fasta 3. In ATF go to Edit Settings References 4. Click the Fasta button 5. Browse to the fasta file fasta files containing sequences of multiple alleles can be imported to create a reference sequence library for Genotyping The reference can be annotated to include the location of exons and other genetic information. 6. Import 7. Edit or enter the reference sequence information. This includes the reference sequence name, the reference sequence filename and the reference version. 8. Click on Save Reference 3.3 Creating Analysis Settings Entering your sequence file-naming convention

9 Replaces Page 9 of Go to Edit Settings Naming 2. Define the location of the sample ID within the sequence filename by either: defining how the sample name relates to delimiters within the filename, or defining the position of the start of the filename and the number of characters used See section 5 Defining your sequence file naming convention will automatically group different.ab1 files for a sample and analyse the consensus sequence against the appropriate reference sequence. 3. In Reference Aliases Select the reference sequence and enter the alias used in the sequence filename that defines the reference 4. Click Update to save changes Creating the Sequence Analysis Settings 1. Go to Edit Settings Engine 2. Select the appropriate matching mode. Genotyping when comparing a sequence against a reference library (eg HLA typing) and Variant Detection when comparing a sequence with a single reference sequence 3. Ensure Auto-editing is not checked for variant detection. 4. Click Update to save changes ATF operates in 2 x modes. Variant Detection and Genotyping. Genotyping is used when analyzing against a Library of sequences. In Engine the peak normalization algorithm can be engaged (Apply Maps and Update Maps) and the cutoff for heterozygous detection can also be set (Detection Limits) 3.4 Import your Sequences 1. Go to File Import Electropherograms to import.ab1 data 2. Select either Browse to import the contents of a directory, or Select Files Manually to import See Section 6 Text files in fasta format can also be imported

10 Replaces Page 10 of 50 files manually 3.5 Sequence Analysis and Editing 1. Base call changes can be made using the key pad on the Navigator. Additional editing functions are available by right clicking with the cursor on the electropherogram 2. Electropherograms can be trimmed (Set Start Position/Set End Position in the right click menu) de-activated and removed from the analysis or removed from the layout by right clicking on the electropherogram. 3. Base call errors can be located by dragging the blue scroll box or clicking either side of the scroll box. 4. Alternatively, base calls with a low quality score, positions mismatched with the reference, user defined variant positions and edited positions can be located by checking either/or the BCS/Edits/MM boxes on the Navigator and clicking the double green arrow (>>) button in the Navigator or by clicking the red cross button. See section 7 Base call errors are usually at positions of poor quality. Each base call has a shaded box above it according to peak quality to enable easy identification of poor quality regions. Base call editing changes the consensus sequence only. Mismatches v the reference sequence are indicated in the results pane to the right of the electropherograms 3.6 Producing a Report 1. Once base calls have been confirmed or edited reports can be created in Reports Report Generator 2. Select the appropriate report. 3. Tailor the report to your requirements by checking the appropriate report functions See section 8 Ensure that variant reports are selected for variant detection applications. In addition to producing sequence reports, quality control reports and text sequences can also be reported.

11 Replaces Page 11 of Saving and Opening Layouts 1. Save by going to File Save 2. Saved layouts must be opened by File Open and browsing to the saved layout See section 9 ATF saves the layout information including edits and links to electropherograms as an xml file. ATF layouts cannot be opened by clicking on the layout xml file. 4 Detailed Users Guide and Description of Functions 4.1 Logging On Log on by double clicking the ATF shortcut icon or by double clicking on the ATF.exe file located in C:\\Program Files\Conexio Genomics\ATF Double-clicking the ATF.exe or on an ATF.exe shortcut icon file results in the Login screen. The default Operator is admin and the default Current Password is cg01 Click Submit to login or press the Enter button

12 Replaces Page 12 of Adding New Operators Login using the default operator and password Before pressing enter or submit to login click The Window will expand as shown above Type in the new operators name in Edit Operator Type in a password in New Password Re-type the new password in Retype Password Select the Operator Level (See 4.4.3) Click 4.3 Changing the password Login using your username and password Enter the new password in New Password

13 Replaces Page 13 of 50 Retype to confirm in Retype Password Click Re-enter the new information to log in 4.4 Additional Functions of the Login Page Default Settings This dialogue enables the operator to select the settings files at the login stage (See Settings, section 5, create setting files) System Files The system files are installed to C:\Program Files\Conexio Genomics\ATF. This location can be changed. If the file location is changed the new information needs to be entered in System File dialogue Operator Levels Different levels of access have been created to ensure that reports are not created without the appropriate level of authority First reviewer (edit only) Cannot change settings Can edit sequences that have not been signed off by a final reviewer CANNOT edit sequences that have been signed off by a final reviewer CANNOT sign on or off second check box First reviewer (with access to settings) Can change settings Can edit sequences that have not been signed off by a final reviewer CANNOT edit sequences that have been signed off by a final reviewer CANNOT sign on or off second check box Final reviewer (with full access) Can change settings Can edit sequences that have not been signed off by a final reviewer CANNOT edit sequences that have been signed off by a final reviewer Can sign on or off second check box Signing off means an editor is satisfied with a result. If a sample is signed off by a Final Reviewer it can no longer be edited. If a sample is signed on again by a Final Reviewer it may be edited further. All changes in status are recorded.

14 Replaces Page 14 of 50 5 Setting up ATF for Analysis Once logged in, an ATF layout is opened. 5.1 Setting the Analysis Parameters Explanation This section describes how to optimize sequence analysis using ATF by creating the sequence analysis parameters. This section also includes instructions on how to create reference sequences. Sequence analysis parameters are saved in Settings files. A number of settings files for different experiments and users can be stored. The settings box contains functions that enable the setting of sequence analysis parameters including 1) Display options (General) 2) File Naming conventions (Naming) 3) Analysis parameters (Engine) 4) Setting up reference sequences (References)

15 Replaces Page 15 of Creating new settings files in Edit Setting General The default Settings file contains parameters for analysis. These settings can be edited and new settings files can be created. Several Settings files can be created for different users or applications. Eg. A Variant Detection experiment requires that Variant Detection is selected in Engine (Described in more detail below). The operator can create a Settings File called Variant Detection. By loading this settings file all settings for this application will be recovered. To open an existing settings file select the drop down menu, select the settings file and click on Load To create a new settings file, type in a new settings file name and proceed to the other settings tabs to create the settings file for this file name (there is no need to click any of the other buttons in this window) Setting the Electropherogram Display: Colours, fonts and line widths Go to Settings General

16 Replaces Page 16 of 50 To change the individual nucleotide peak colours within the electropherogram, the display text font and the layout background colours select Display To change the nucleotide peak colours: Select the Base, choose the colour, click on Set Colour Click on Done in the Display dialogue when the colours have been selected. This returns you to the Settings General Click on Update Click Done To change the font size and the line width select the appropriate parameters in the Text Size: and Line Width: boxes. Click Done when complete Important: To log changes in Settings General click Update and Done

17 Replaces Page 17 of Setting the sequence-file naming convention in Edit Settings Naming Explanation Using a standard sequence-file naming convention enables ATF to link all EPG for a sample and to analyse the test sequence against the appropriate reference sequence. This section describes how to set the sequence-file naming convention. Delimiter symbols can be used to define the location of the sample name. Example This is an example of a sequence filename: A01[12345_C4_ex2F Delimiters have been used to separate the components of the sequence-file name [ has been used to separate the PCR number (A01) and the sample name (12345) _ has been used to separate the sample name and the locus (C4) _ has also been used to separate the locus and the primer name (ex2f) Set the Naming convention by defining the Sample Delimiters In the example above; The sample name begins with [ The sample name ends with _ Enter [ in the Start : String box Enter _ in the End : String box HLAB has been used as the code to indicate that all sequence filenames with HLAB in them must be analyzed against the HLA-B gene reference sequence. In Library Aliases --- select B from the Library drop down menu Enter HLAB in the Alias box

18 Replaces Page 18 of 50 Click Update Click OK Setting the Naming convention by defining the Sample Name, Library alias positions and word length Note: This method of defining the sequence-file naming convention should only be used if the sample name always starts at the same position within the sequence-file name and is the same length for all samples Using the same example as above ie A01[12345_HLAB_ex2F. The sample name starts at position 5 of the sequence-file name and is 5 characters long. In Sample Delimiters enter 5 in Start:Position and 5 in Length:Position The Library name to be analysed is located at position 11 and is 4 characters long In Library Delimiters enter 11 in Start:Position and 4 in Length:Position Click Update followed by clicking Done 5.3 Setting the data analysis parameters in Settings Engine Explanation Settings Engine. Allows parameters to be created to optimize sequence analysis.

19 Replaces Page 19 of BCS Limits BCS is Assign-ATFs quality scoring system. A sequence peak can have a BCS quality score between The higher the number the better the sequence quality and the more confidence that the base call is correct. The mean BCS for all positions within an EPG provides an EPG quality score. If a sample is sequenced in both directions a sample can have a mean BCS of The BCS Limits box filters base calling. Positions within a sequence, an EPG or samples will not be analysed unless they have a value above the value entered in the BCS Limits boxes. Enter the appropriate number into each box. Using the default of 0 will result in all data being included. Setting a Base limit value will result in all bases with a score lower than this value not being called and will be assigned a * Setting an EPG limit value will result in the exclusion of an electropherogram if the mean BCS of all positions falls below the value used. Setting a Sample limit will result in the exclusion of a sample if the mean BCS of the sample falls below the value used. After entering the appropriate values click Update and Done Matching Mode Explanation: Two of the main functions of Assign-400ATF are Variant Detection (eg BRCA testing) and Genotyping (eg HepC genotyping). Variant Detection identifies sequence differences between a reference sequence and test sequence. Genotyping compares the test sequence against a library of sequences of alleles to determine to which alleles or combination of alleles the test sequence is best matched. Specifying the application optimizes the analysis. Selecting No Mixed Bases will base call a signal peak either A, C, G or T. This is useful for base calling poor quality hemizygous data Basecaller Explanation: Assign-400ATF has a unique base caller that also includes a normalisation algorithm (Picket Fences) that improves base call accuracy for re-sequencing projects. The Basecaller box enables activation of the Picket Fences algorithm. See 10.1 for a more detailed description of the Picket Fence analysis

20 Replaces Page 20 of Apply Height Maps Checking this box instructs the software to use existing information including information within the current layout to normalise the EPG data Update Maps Checking this box instructs the software to update the normalisation maps with the new data Apply Auto Editing (Not recommended for variant detection applications) Autoediting is an intuitive base call algorithm that is applied when the quality of a sequence peak is poor. The software uses prior base calling information at this position as a guide to the most likely base. This should not be used for variant detection or SNP discovery applications Suggested Applications for Picket Fence Analysis (Check Apply Maps and / or Update Maps) Picket Fence Analysis: High throughput genotyping on optimized data Comparing SNP frequencies on pooled DNA Accurate detection of low level mutations Quality Control of reagents-ensuring equivalent amplification of alleles Genotyping of alleles defined by insertion/deletion polymorphisms Suggested Applications for Non-Picket Fence Analysis (Do NOT Check Apply Maps and / or Update Maps) Non Picket Fence analysis: High throughput SNP screening on non-optimized data, or data of variable quality. Non re-sequencing applications Contig assembly from cloned data Suggested Applications for Autoediting Sequence based genotyping when comparing an unknown sequence against a sequence library.

21 Replaces Page 21 of 50 DO NOT USE AUTO-EDITING FOR VARIANT DETECTION OR FOR STUDIES WHERE THE TEST SEQUENCE IS COMPARED WITH A SINGLE REFERENCE SEQUENCE Summary: Sequencing Application and Analysis Parameters ATF Analysis Parameters Matching Mode Base Caller Variant Detection Genotyping No Mixed Bases Apply Height Maps Update Height Maps Apply Autoediting Application* Genotyping Variant Clone Anonymous Detection Sequencing Yes Yes Yes Yes Yes Yes Yes Yes Yes Yes *Applications Definitions Genotyping applications include the comparison of a test sequence with a library of sequences of variants (alleles) for the locus being sequenced. Variant Detection applications include SNP discovery, variants in genes associated with genetic disorders and can also be used for viral variants associated with drug resistance. Clone sequencing and contig assembly Anonymous sequencing can include sequencing clones or PCR products where a reference sequence does not exist

22 Replaces Page 22 of Creating Reference Sequences in Setting References Explanation Reference Sequence: The reference sequence is the sequence to which test sequences are aligned. Reference sequences in Assign can be made by importing GenBank information or text sequence in Fasta format. A Fasta file containing sequences of variants or alleles can be imported also. The reference sequence contains the sequence annotation information including the location of various genetic structures such as exons, untranslated regions etc Creating a new reference from a GenBank files Saving GenBank Files Access the GenBank file from and retrieve the reference sequence file from the NCBI website Save the GenBank reference sequence file as a text file (.txt) to your computer Creating the references sequence file in Assign Go to Edit Settings References Click Import GenBank and browse to the saved GenBank text file Enter a sequence Reference Name (This describes the sequence. The default will be Unknown ) Enter a file name in File (This will be the name of the reference sequence file. The default will be Unknown )

23 Replaces Page 23 of 50 In this example we have imported the GenBank sequence AF (Full genome HIV sequence) The Reference Name and File name have been entered manually. The accession number has been entered as a Comment and the Version have been entered automatically The main window contains the sequence regions as defined by the GenBank entry. These regions will be shown in the main window of ATF Reference sequence Region information After importing the GenBank reference click Update Reference to save the information and Done to exit Creating a new reference from text files in Fasta format A reference sequence can be created from a single sequence or multiple sequence variants from of the same gene in Fasta format. Fasta format is

24 Replaces Page 24 of 50 characterised by a > sign followed by the sequence name on the first line and the sequence on the next line Eg. >Sequence 1 ACGTCGATCAGTACAGCTTTCTGACGATCCAGTTAGGGATCACCCAG ACCC.. >Sequence 2 ACGTCGATCCGTACAGCTTTCTGACGATCCAGTTAGGGATCACCCAG ACCC..etc Important Notes: The sequence file must have a.fsta extension If you have sequences for multiple variants and you wish to compare test sequences against the sequences of the variants (genotyping), ensure all sequences are in a single file in and all sequences in this file are in FASTA format Go to Settings References Enter the name of the reference sequence in the Reference Name box. This is usually descriptive and can contain detailed information about the reference sequence. Enter the name of the file that you wish to save this reference sequence in File. This is usually a short name. Click on the FASTA file button. This will launch a file search dialogue. Browse to the FASTA file that contains your reference sequence. Additional information regarding the reference sequence can be entered in Comments The Version box can be used to distinguish between multiple versions of a reference sequence or allele library Once imported Click Update References to save and Done to exit Additional Functions of the Reference Window Annotating the Reference Sequence: Editing or Adding Reference sequence information Explanation: A reference sequence can include a gene or genes consisting of a number of exons and other important genetic regions. Each of these is a region. Annotating the sequence to include these regions is performed in Settings Reference.

25 Replaces Page 25 of 50 Go to Edit Settings References Click Load browse to C:\Program Files\Conexio Genomics\Assign400\Data\References and select the reference file Annotation Details Annotation editor Annotation Menu The main window contains the sequence annotation details for the item selected in the annotation menu Reference sequence details can be edited or entered in the Annotation Editor The Annotation Window Selecting Regions enables the different regions within the reference sequence to be annotated. These can be overlapping Selecting Trim enables sequencing or PCR primer locations at the beginning of Regions to be excluded from the analysis Selecting Coding Groups enables coding regions to be annotated. A Coding Group can be a single region or consist of several linked regions. Selecting Primers enables sequencing primers that enable haplotype specific sequencing from a diploid PCR product to be defined Selecting Variants enables known sequence variants to be added to the reference. This is helpful for checking base calling at important regions and allows the sequence at these positions to be reported

26 Replaces Page 26 of 50 To add regions, choose Regions from the Show drop down menu Enter the name of the region in the box above the Show drop down menu eg 5UTR Enter the Region Start position in Start box and the Region end position in the End box. (Number the regions so that base 1 is the first base of the reference sequence) Click on Add/Update. Perform this process for all regions. Importing GenBank entries may result in many redundant and unrequired regions. Several regions can be removed by typing the first few letters of the coding regions to be deleted in the left hand box in the Annotation Editor and clicking all. Once all regions have been edited click Update Reference to save the information and Done to exit the window To annotate 5 UTR as minus numbers before the start codon enter the appropriate Start Base and Update Reference. To view the alternative numbering systems select between With Offset and No Offset in Numbering Creating Coding Groups Explanation: Once the regions (eg Exons) have been annotated in the reference sequence, common regions can be grouped to create a continuous string of sequence. For example exons can be grouped to form the coding sequence. This information is incorporated into variant reports to identify if variants result in amino acid changes

27 Replaces Page 27 of 50 Select Coding Groups from the Show drop down menu Enter the name of a new coding group. CDS is used in the example above. Enter the start base (1). Select the regions to be added from the Members drop down menu (exon1) If this is a coding region, select Yes from the Coding drop down menu If the coding region is in the 3-5 (reverse) orientation of the sequence select Yes from the Reverse drop down menu. Click Add/Update to register the changes To add more regions to the CDS Coding Group. Select CDS from the drop down menu, select exon2 from the Members drop down menu. Click Add/Update. Continue until all members of the coding group have been added Click Update Reference to save the changes to disk Click Done to exit Adding the location of known variants to the reference sequence Explanation: The sequence of known variants can be included in the reference sequence. The positions are highlighted on the electropherograms and also the sequences at these positions are highlighted on the reports. Select Variants from the Show drop down menu. Enter the Position of the variant in the reference sequence (28) Enter the Variant nucleotide from the drop down menu under Variant (G)

28 Replaces Page 28 of 50 Enter the Length of the variant (if insertion or deletion variants are >1) 1 Enter the Class of the variant. Click Add/Update. Add additional variants if required. Click Update Reference to save Removing primer site sequence from analysis using Trim Explanation: The operator can choose not to analyse sequences at amplification primer sites if these sequences are included in the reference sequence. Currently this function only allows removing sequence at the beginning or ends of regions. In this example the 5 PCR amplification primer is 23bases in length and is located at the beginning of the 5 UTR. This region is excluded from analysis by Trimming the length of the PCR amplification primer region Select Trim from the Show drop down menu Select the required region to be Trimmed in the Trim region drop down menu (5UTR) Enter the number of bases required to be Trimmed from the Start (23) Click Add/Update to register the changes Click Update Reference to save the changes to disk

29 Replaces Page 29 of Haplotype specific sequencing of diploid template using haplotype specific sequencing primers Explanation: Assign-ATF contains a unique feature that enables DNA sequencing to be used to identify the haplotypes on which two or more polymorphisms are located. This function works best for genotyping applications where a test sequence is compared with a library of sequences of known variants. This process requires an additional haplotype specific sequencing primer (HSP) with specificity for one of the nucleotides at a heterozygous position. The HSP must then sequence through a neighbouring heterozygous position. Identification of the nucleotide at the neighbouring heterozygous position(s) enables the haplotype to be identified. The operator is required to enter the haploid sequencing primer information in Primers in the Show drop down menu. Select the reference sequence to be edited by clicking Load and browsing to the appropriate reference.xml (usually located in C:\Program Files\Conexio Genomics\Assign\Reference Enter a name for the haploid sequencing primer in the Primer Name drop down menu (ABCD_hap) Select the location of the polymorphism according to location within the reference sequence to which the sequencing primer has specificity and enter in the Start and End boxes. A single nucleotide can be used in which case the start and end position will be the same. In the example above 3 nucleotides at the 3 end of the sequencing primer has been used (Start: 195, End: 197) Enter the sequence that is located between the allocated Start and End positions (CGC) Select Master to indicate that haploid sequencing is being performed on the primary diploid PCR product.

30 Replaces Page 30 of 50 Enter an Alias. This is a name that is included in the sequence filename to enable the software to recognize the sequence file as being an haploid sequencing primer (hap1) The Limit box is required to indicate the limit of the sequencing reaction. This is useful because ATF enables the prediction of the appropriate haplosequencing primer for prospective haplo sequencing. The Limit acts as a filter that will not predict a primer if the other polymorphism is too far away from the sequencing primer THIS FUNCTION IS NOT YET AVAILABLE. Once complete click Add/Update Click Update Reference Click Done Additional Reference Sequence Functions The Max Deletion trims EPG of heterozygous insertion/deletion EPG after the entered number of positions. Indel sequence is particularly hard to base call as the quality deteriorates. Mis-base calls of indel sequence make accurate analysis of indel sequence difficult. Subreference can be used to create a new reference sequence from a region within the reference sequence. For example a subreference that includes a single exon can be created from an existing reference if the exon is nominated as a region within the existing sequence. Trim by Regions only allows analysis of EPG in defined regions. This enables efficient analysis of sequence where the amplification and sequencing primers are located in introns but the reference sequence is a cdna sequence with defined exons (regions). 5.5 Settings Appendix Picket Fences (See Picket Fence analysis is a novel approach to sequence analysis that improves heterozygous base calling and increases the number of applications of DNA sequencing. PF analysis can only be performed on re-sequencing data. Ideally, homozygous peak heights are the same height as each other and heterozygous peaks are 50% of homozygous peak heights. However this is not the case as a result of the variable incorporation rates of di-deoxynucleotide nucleotides. Despite the variable di-deoxynucleotide incorporation rates between positions within a sequence, the incorporation rate at any one position within a sequence is highly reproducible between different samples. As a result a homozygous base at any position within a sequence has a predicted peak height. PF analysis

31 Replaces Page 31 of 50 presents the sequence the peak heights of an electropherogram relative to the expected homozygous peak height. As a result, homozygous peaks are usually the same height and heterozygous peak heights are 50% of homozygous peaks. Base calling is then performed on this data resulting in an increase in heterozygous base calling accuracy. Conventional Electropherogram Analysis Picket Fence Analysis Sequence Electropherogram Quality: The Base Call Score (BCS) The BCS or Base Call Score is the basic unit of Assigns quality assessment system. The BCS reflects the integrity of the peak shape, the background and the separation from neighbouring peaks. The perfect peak will have a BCS of 50. The BCS of a consensus sequence is an accumulation of the BCS that constitute the consensus sequence. The BCS does not discriminate against heterozygous base calls as a result the mean BCS and the degree of variability of BCS between positions are markers of sequence quality for a sequence electropherogram or a sample. Assign uses shades of white to red to indicate the BCS for sequence position, an electropherogram or a sample. Boxes above sequence base calls indicate the BCS of the base call. Shading of the sample ID indicates the mean BCS of the sample and shading of the electropherogram map above the sequence indicates the mean BCS of the electropherogram.

32 Replaces Page 32 of 50 6 Importing Sequences into Assign for Analysis 6.1 Importing sequences is performed by selecting File Import Explanation. Text sequences and electropherogram sequence can be imported into Assign-ATF. Sequence can be imported as individual files or by directory, including subdirectories. Importing sequences by directories enables high throughput analysis. Filters can be applied for specific importing of sequences. eg all sequences with the same sample name can be imported if they exist within the selected folders. This is useful for comparing sequences from the same individual over time or importing sequences from different loci for the same patient. 6.2 Importing Sequences by Directory Browse to the directory (directories) Check the Import All Subdirectories box of all subdirectories are to be imported. Click on Go

33 Replaces Page 33 of Importing Sequences Individually This function also enables multiple sequences from a directory to be imported Click Select Files Manually Browse to the directory that contains the sequences Select the sequence you wish to import by double clicking. To import multiple sequences use the Shift or Alt keys and click to select the sequences, then double click to import. 6.4 Importing Sequences Using the Filter Function Proceed as described for importing sequences by directory (See above) To filter by name, enter the sample name in Filters:Name (the sample names must be identical in the region defined by the naming settings as the sample identifier To filter by locus, enter the locus code in Filters:Code To filter by Primer select the primer name Only sequences with the appropriate filter will be imported 7 Sequence Analysis and Editing 7.1 The Analysis Screen Explanation The Analysis Screen comprises 3 main panes that include the sample ID s, the electropherogram data and the mismatches with the reference sequence. Sequence electropherograms can be viewed and edited. Edits result in real time updates of the result screen.

34 Replaces Page 34 of The Sample Pane Each box is a different sample. The sample highlighted in blue is the active sample. The active electropherogram and the genotype result relate to this sample. Moving between the samples is performed using the up down arrows on the keyboard, the up down arrows on the Navigator (see below) or by clicking the appropriate sample Moving between samples simultaneously updates the electropherogram and the genotype panes The white to red shading is an indicator of quality of all sequences for the sample. The more red shading the box the poorer the quality of the sequences for this sample The green boxes enable report selecting. Checking the green boxes will remove the sample from the report and turn the box orange in colour The orange and yellow boxes alert the operator to samples with QC warnings. Orange boxes have a QC warning whereas yellow boxes don t have a QC warning Boxes headed 1, 2 and R refer to the operator level review. Checking the boxes indicates sign off by the reviewers of different levels of authority. Box 1 is for the first reviewer, Box 2 is for the second reviewer The Electropherogram (EPG) Pane Highlighted positions Positions that differ between the test sequence and the reference sequence Autoedited positions Manually edited positions Confirmed base calls Manually selected variant positions Sequenced regions Differences v reference Position within the references sequence Annotation Consensus sequence and quality indicator Electropherogram Includes sequence filename and signal intensity Active sequence position Electropherogram sequence and quality indicator

35 Replaces Page 35 of Migrating through the sequence EPG is performed clicking on the EPG pane and using the arrows on the key pad Using the Navigator (See below) Clicking on the Bus and dragging it across the sequence The Navigator The Navigator enables sequence editing, moving between samples and moving between positions within a sequence Editing using the Navigator Keypad Base calls are edited on the keypad. The bases present at the active sequence position is highlighted on the keypad. Editing is performed by selecting non highlighted bases or unselecting the highlighted bases. In this example, if A was the correct base, clicking C (unselecting the C base call) would also unselect M. The + and keys allow including or removing insertions (+) or deletions (-) Priority Editing Priority Editing enables examination of base calls at positions: that have a low BCS by selecting the BCS box that have been edited by selecting the Edits box that are mismatched with any of the allele combinations in the results table by selecting the MM box that are nominated as variants (to the right of MM)

36 Replaces Page 36 of 50 Moving to positions for Priority Editing is performed by selecting the or buttons Selecting either button moves the Bus either left or right by one position. Selecting either button the bus to the beginning of the sequence or to the end Selecting either button moves to the sample above or below The Master drop down menu enables the operator to move between the diploid sequence to haploid sequences when haplotype specific sequences are used The Exon 3 (example only) drop down menu enables to operator to move to different regions within the sequence. This menu will include all regions annotated for the reference sequence Moving to specific codons and positions within the sequence that are mismatched with the library or reference sequence Typing and clicking the arrow button results in moving the active position to codon 163, position 1. Selecting the drop down menu containing 487 will list the positions that are mismatched with the reference sequence or library. Selecting any of these positions will move the active position to this location to confirm the base call. Clicking OK confirms the base call and moves to the next priority editing position

37 Replaces Page 37 of Additional Sample and Sequence Editing Functions Editing in the Sample Pane Explanation. Right clicking the mouse on a sample provides additional editing functions Show Comments selecting Show Comments provides a quality report of a sample with poor consensus quality in the format show below Edit Comments enables comments regarding the sample to be entered Reanalyse Removes all sequence edits for all samples and reanalyses the data. Used if the analysis settings have been changed after EPG have been imported Add New Samples enables the addition of new samples Remove Sample enables the removal of samples Remove All- enables all samples to be removed Autoedit Selecting auto-edits runs the Autoedit function if this function has not already been selected in Settings Add Sequences Enables the addition of the test sequence to the library of allele sequences Add All Sequence Enables the addition of all sequences in the layout to the sequence library Update Reference Enables the sequence of the active sample to be used as the reference sequence and all samples within the layout to be reanalysed against the new reference sequence.

38 Replaces Page 38 of Editing in the EPG pane Explanation Right clicking on the mouse in the EPG field enables additional editing functions of the EPG Selecting: Set Start Base trims sequence from the EPG to the left of the cursor Set End Base trims sequence from the EPG to the right of the cursor Show Warnings results in the issuing of a quality warning Autoedit results in autoediting of the sequence Less sensitivity results in a reanalysis of an EPG after reducing the detection limit. This function is very effective for improving base call accuracy of data with high background Reanalyse results in the reimporting and reanalysis of the EPG. Can also be used to replace an incorrectly trimmed EPG. This function is useful for data free of background to accurately detect low level mutations More sensitivity results in a reanalysis of an EPG after increasing the detection limit Remove EPG results in the complete removal of an EPG Add Variant results in the addition of a variant to a report Add All Variants results in the addition of all variants for an EPG to a report Add Sequences results in the addition of the sequence to the library 7.3 Additional Functions

39 Replaces Page 39 of Zooming the EPG The EPG can be enlarged by pressing the Shift key and the up/down or left/right arrows on the computer keyboard Hiding the EPG Simultaneously pressing the computer keyboard Shift key and one of the letters representing the 4 bases will remove the trace of this base from the EPG. Repeating this procedure will return the trace. This function is useful if heterozygous peaks are perfectly overlaid and the base call requires confirmation Expanding the EPG Window Pane Boundaries Clicking the Pane Boundaries and holding the mouse key enables the movement of the Pane Boundaries to expand or contract the EPG view 7.4 Sequence View Options

40 Replaces Page 40 of 50 Explanation The View option allows switching between EPG and aligned text sequence of each sample. Viewing the sample text sequence enables high throughput SNP. Select Consensus to view the sample text sequences Select Consensus to view the sample text sequences Each text sequence corresponds to the sample in the Sample Pane Sequences that are different from the reference sequences are highlighted

41 Replaces Page 41 of Select Dots after selecting consensus to view only those sequences that differ from the reference sequence Select Quality to view the sample text sequences and BCS Each text sequence corresponds to the sample in the Sample Pane Colour coding indicates quality and the BCS. White is good quality and high BCS, red is poor quality and low BCS Suggested Applications for Consensus sequence and Quality view Assign s ability to import thousands of sequence, its accurate and novel approach to base calling and the simple switch between EPG and sample text sequence simplifies high throughput SNP screening

42 Replaces Page 42 of Select Alignment to view the sequences of the best matched alleles The sequence of the selected sample (blue in the sample pane) is always at the top of the list and contains highlighted sequence that differs from the reference sequence All sequences below the sample sequence are the sequences of the corresponding allele combinations in the results pane Highlighted allele combination sequences are sequence differences between the allele combination and the selected sample sequence 8 Reports Explanation Assign enables 4 possible report formats 1) A variant report for applications where test sequence is compared with a single reference sequence 2) A genotype report for genotyping applications when matching a sample sequence against a library of known sequences. 3) A FASTA report that provides a fasta file of sequences from all samples in the Assign layout 4) A Quality (BCS) report that enables a quality control analysis of samples within the Assign layout and for all layouts within a specific directory Contact us regarding custom reports

43 Replaces Page 43 of Variant Report Selecting: Output Filters and Numbering: enables selection of Samples, Locus, Layer (Haploid or diploid), sequence Group or sequence Region Nuc or Codon: enables variants to be reported as nucleotides or codons. Flanking Sequence 3 : lists the nominated number of nucleotides that lay 3 to the variant sequence Flanking Sequence 5 : lists the nominated number of nucleotides that lay 5 to the variant sequence Select Variants: User Defined reports sequence at positions defined by the operator Select Variants: Observed reports any sequence differences between the sample sequence and the reference sequence. Select Variants: All alleles reports the variants between the test sequence and the sequence of all alleles in the database Options: BCS enables the BCS quality control values to be included Options Audit: Includes a detailed reviewer audit report Output Type: enables vertical or horizontal listing of variants Output Formats: Excel produces a report in an excel worksheet Output Format: XML produces a report in xml format Output Format: Text produces a text file report

44 Replaces Page 44 of Genotype Report Selecting: Filters: Sample enables specific samples to be selected Filters: Locus enables samples from specific loci within a layout to be reported (Note: ATF can analyse sequences from more than one locus) Sort by: Locus lists the reports by locus Sort by: Name lists the reports by sample name Full Report: Sample: Match Summary lists the best matched alleles Sample: Auditing reports the edit auditing function Layers: Electropherogram List lists the EPG sequence files analysed for the sample Layers: Sequences Produces a sequence report Layers: Edits includes the manual and autoedits performed during analysis

45 Replaces Page 45 of 50 Layers: Mismatch List shows the mismatch nucleotide information of the closest matched sequences with the libraries in a list Summary Options: NMDP lists the NMDP code associated with the genotype Summary Options: HARPS lists heterozygous ambiguity resolving primers which can be used to resolve the reported ambiguity Summary Options: Full+Part lists the proportions of the full and partially complete library sequence Summary Options: Differences indicates where the differences lie in the match summary Audit Options: Save indicates the date and user whom saved the reported layout (Auditing must be selected from the Sample Summary drop down menu) Audit Options: Confirm lists the confirmed edits by the user Mismatch Limits enables alleles to be reported up to the nominated number of mismatches between the sample sequence and the library sequences. Simple List: lists the alleles as a string of text without the summary information Table: Alleles lists the alleles only without summary information Output Formats: Excel produces a report in an excel worksheet Output Format: XML produces a report in xml format Output Format: Text produces a text file report Output Format: Japanese generates the report in Japanese Output Formats: Page Breaks includes a page break between samples Additional Information enables additional comments to be added to the report

46 Replaces Page 46 of HARPS report Selecting: Output Filters and Numbering: enables selection of Samples and Locus Output Format: Text produces a text file report Output Formats: Excel produces a report in an excel worksheet Output Format: XML produces a report in xml format

47 Replaces Page 47 of FASTA Report Selecting: Output Filters and Numbering: enables selection of Samples, Locus, Layer (Haploid or diploid), sequence Group or sequence Region Sort by: Locus enables reports to list be locus Sort by: Name enables reports to list by sample name Options: Pad Ends results in inclusion of dashes (---) at the end of a sequence to enable all sequences to be the same length. Options: Separate Files by sample name or locus

48 Replaces Page 48 of Quality Report The Quality Report section enables the generation of longitudinal quality control plots. The mean BCS and standard deviation for an EPG is a quality score for that EPG. Similarly the mean BCS and standard deviation for a sample is a quality score for a sample. Plotting the BCS for all samples is an effective way of performing sequencing quality control. Assign will perform a quality analysis on all saved layouts within a Selected Folder or specific saved projects by using Get Projects. This enables Assign to be used solely as a Sequencing Quality Control software. The quality report produces an excel file containing worksheets with quality data.

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications

SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each

More information

SeqScape Software Version 2.1

SeqScape Software Version 2.1 ABI PRISM SeqScape Software A Sequence Comparison Tool SeqScape Software Version 2.1 ABI PRISM SeqScape Software Version 2.1 is a sequence comparison tool designed for nucleotide and amino acid variant

More information

Tour Guide for Windows and Macintosh

Tour Guide for Windows and Macintosh Tour Guide for Windows and Macintosh 2007 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Suite 100A, Ann Arbor, MI 48108 USA phone 1.800.497.4939 or 1.734.769.7249 (fax) 1.734.769.7074

More information

Manual for Demo Data

Manual for Demo Data Manual for Demo Data SEQUENCE Pilot module SeqPatient developed by JSI medical systems GmbH JSI medical systems Corp. Tullastr. 18 One Boston Place, Suite 2600 77975 Ettenheim Boston, MA 02108 GERMANY

More information

HOW TO USE THE File Transfer Protocol SERVER ftp.architekturaibiznes.com.pl

HOW TO USE THE File Transfer Protocol SERVER ftp.architekturaibiznes.com.pl HOW TO USE THE File Transfer Protocol SERVER ftp.architekturaibiznes.com.pl In order to access the A&B server with a view to uploading or downloading materials, any FTP client software can be used. If

More information

Appendix A How to create a data-sharing lab

Appendix A How to create a data-sharing lab Appendix A How to create a data-sharing lab Creating a lab involves completing five major steps: creating lists, then graphs, then the page for lab instructions, then adding forms to the lab instructions,

More information

Version 5.0 Release Notes

Version 5.0 Release Notes Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com

More information

Microsoft Access 2010 handout

Microsoft Access 2010 handout Microsoft Access 2010 handout Access 2010 is a relational database program you can use to create and manage large quantities of data. You can use Access to manage anything from a home inventory to a giant

More information

Sequencing Analysis Software Version 5.1

Sequencing Analysis Software Version 5.1 Applied Biosystems DNA Sequencing Analysis Software Sequencing Analysis Software Version 5.1 The Applied Biosystems DNA Sequencing Analysis Software v5.1 is designed to analyze, display, edit, save, and

More information

Secure Website and Reader Application User Guide

Secure Website and Reader Application User Guide Secure Website and Reader Application User Guide February 2005 IMPORTANT NOTICE Copyright Medibank Private Limited All rights reserved. No part of this document (including its appendices and Schedules)

More information

Generative Drafting. Page 1 1997 2001 DASSAULT SYSTEMES. IBM Product Lifecycle Management Solutions / Dassault Systemes

Generative Drafting. Page 1 1997 2001 DASSAULT SYSTEMES. IBM Product Lifecycle Management Solutions / Dassault Systemes Generative Drafting Page 1 Tutorial Objectives Description This Tutorial is an introduction to Generative Drafting. Message To show how CATIA V5 allows the user to automatically generate associative drafting

More information

EBOX Digital Content Management System (CMS) User Guide For Site Owners & Administrators

EBOX Digital Content Management System (CMS) User Guide For Site Owners & Administrators EBOX Digital Content Management System (CMS) User Guide For Site Owners & Administrators Version 1.0 Last Updated on 15 th October 2011 Table of Contents Introduction... 3 File Manager... 5 Site Log...

More information

Surveyor. DNA Variant Analysis Software. Mutation. SoftGenetics LLC. v 3.1. 200 Innovation Blvd, Suite 235 State College PA 16803 USA 814/237/9340

Surveyor. DNA Variant Analysis Software. Mutation. SoftGenetics LLC. v 3.1. 200 Innovation Blvd, Suite 235 State College PA 16803 USA 814/237/9340 Mutation Surveyor DNA Variant Analysis Software v 3.1 SoftGenetics LLC 200 Innovation Blvd, Suite 235 State College PA 16803 USA 814/237/9340 email: info@softgenetics.com technical service: tech_support@softgenetics.com

More information

Appendix 1 Install RightNow on your PC

Appendix 1 Install RightNow on your PC Appendix 1 Install RightNow on your PC Please do not install the live site unless you have been instructed to do so. 1 Open Internet Explorer and navigate to; http://student.ask.adelaide.edu.au/cgi-bin/adelaide.cfg/php/admin/launch.php

More information

Education Solutions Development, Inc. APECS Navigation: Business Systems Getting Started Reference Guide

Education Solutions Development, Inc. APECS Navigation: Business Systems Getting Started Reference Guide Education Solutions Development, Inc. APECS Navigation: Business Systems Getting Started Reference Guide March 2013 Education Solutions Development, Inc. What s Inside The information in this reference

More information

Virtual Communities Operations Manual

Virtual Communities Operations Manual Virtual Communities Operations Manual The Chapter Virtual Communities (VC) have been developed to improve communication among chapter leaders and members, to facilitate networking and communication among

More information

Vector NTI Advance 11 Quick Start Guide

Vector NTI Advance 11 Quick Start Guide Vector NTI Advance 11 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Version 11.0 December 15, 2008 12605022 Published by: Invitrogen Corporation 5791 Van Allen Way Carlsbad, CA 92008 U.S.A.

More information

User Manual V1.3. NCB File Converter. @alahlincb. /alahlincb. 9 2000 1000 www.alahli.com

User Manual V1.3. NCB File Converter. @alahlincb. /alahlincb. 9 2000 1000 www.alahli.com User Manual V1.3 NCB File Converter @alahlincb /alahlincb 9 2000 1000 www.alahli.com The National Commercial Bank File Converter User Manual Copyright 2013 The National Commercial Bank Page 2 of 44 Table

More information

Sequencing Analysis Software Version 5.4

Sequencing Analysis Software Version 5.4 Applied Biosystems Sequencing Analysis Software Quick Reference Card Sequencing Analysis Software Version 5.4 Applied Biosystems Sequencing Analysis Software v5.4 analyzes, displays, edits, saves, and

More information

owncloud Configuration and Usage Guide

owncloud Configuration and Usage Guide owncloud Configuration and Usage Guide This guide will assist you with configuring and using YSUʼs Cloud Data storage solution (owncloud). The setup instructions will include how to navigate the web interface,

More information

Information Systems Services. Getting Started with Enterprise Vault Email Archiving A guide for Outlook/Exchange users March 2008

Information Systems Services. Getting Started with Enterprise Vault Email Archiving A guide for Outlook/Exchange users March 2008 Information Systems Services Getting Started with Enterprise Vault Email Archiving March 2008 Contents 1. Introduction... 3 2. Supported operating systems, email clients and browsers... 3 3. Getting started

More information

OPTAC Fleet Viewer. Instruction Manual

OPTAC Fleet Viewer. Instruction Manual OPTAC Fleet Viewer Instruction Manual Stoneridge Limited Claverhouse Industrial Park Dundee DD4 9UB Help-line Telephone Number: 0870 887 9256 E-Mail: optac@stoneridge.com Document version 4.0 Part Number:

More information

T08-003A. Figure 1: The Results Editor home screen.

T08-003A. Figure 1: The Results Editor home screen. Technical Note Dissociation Curve Analysis T08-003A General Introduction to Data Analysis The aim of this Technical Note is to explain the principle of dissociation curve analysis and to guide you through

More information

SUBJECT: New Features in Version 5.3

SUBJECT: New Features in Version 5.3 User Bulletin Sequencing Analysis Software v5.3 July 2007 SUBJECT: New Features in Version 5.3 This user bulletin includes the following topics: New Features in v5.3.....................................

More information

Baylor Secure Messaging. For Non-Baylor Users

Baylor Secure Messaging. For Non-Baylor Users Baylor Secure Messaging For Non-Baylor Users TABLE OF CONTENTS SECTION ONE: GETTING STARTED...4 Receiving a Secure Message for the First Time...4 Password Configuration...5 Logging into Baylor Secure Messaging...7

More information

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long

More information

OPTAC Fleet Viewer. Instruction Manual

OPTAC Fleet Viewer. Instruction Manual OPTAC Fleet Viewer Instruction Manual Stoneridge Limited Claverhouse Industrial Park Dundee DD4 9UB Help-line Telephone Number: 0870 887 9256 E-Mail: optac@stoneridge.com Document version 3.0 Part Number:

More information

SOS SO S O n O lin n e lin e Bac Ba kup cku ck p u USER MANUAL

SOS SO S O n O lin n e lin e Bac Ba kup cku ck p u USER MANUAL SOS Online Backup USER MANUAL HOW TO INSTALL THE SOFTWARE 1. Download the software from the website: http://www.sosonlinebackup.com/download_the_software.htm 2. Click Run to install when promoted, or alternatively,

More information

Office of History. Using Code ZH Document Management System

Office of History. Using Code ZH Document Management System Office of History Document Management System Using Code ZH Document The ZH Document (ZH DMS) uses a set of integrated tools to satisfy the requirements for managing its archive of electronic documents.

More information

MICROSOFT ACCESS 2007 BOOK 2

MICROSOFT ACCESS 2007 BOOK 2 MICROSOFT ACCESS 2007 BOOK 2 4.1 INTRODUCTION TO ACCESS FIRST ENCOUNTER WITH ACCESS 2007 P 205 Access is activated by means of Start, Programs, Microsoft Access or clicking on the icon. The window opened

More information

Introduction to MS WINDOWS XP

Introduction to MS WINDOWS XP Introduction to MS WINDOWS XP Mouse Desktop Windows Applications File handling Introduction to MS Windows XP 2 Table of Contents What is Windows XP?... 3 Windows within Windows... 3 The Desktop... 3 The

More information

Bioinformatics Resources at a Glance

Bioinformatics Resources at a Glance Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences

More information

MindGenius 1.5 User Guide

MindGenius 1.5 User Guide MindGenius 1.5 User Guide Introduction to Mind Mapping with Mind Genius 2 1. The Mind Genius Screen Layout Before you begin to work with MindGenius it is important to understand the screen layout. Menus

More information

Editing your Website User Guide

Editing your Website User Guide User Guide Adding content to your Website To add or replace content on your website you will need to log in to your Content Management System (Joomla) using your username and password. If you do not already

More information

Legal Notes. Regarding Trademarks. 2012 KYOCERA Document Solutions Inc.

Legal Notes. Regarding Trademarks. 2012 KYOCERA Document Solutions Inc. Legal Notes Unauthorized reproduction of all or part of this guide is prohibited. The information in this guide is subject to change without notice. We cannot be held liable for any problems arising from

More information

Using Avaya Flare Experience for Windows

Using Avaya Flare Experience for Windows Using Avaya Flare Experience for Windows Release 9.0 Issue 02.01 September 2013 Contents Chapter 1: About Flare Experience... 5 About Flare Experience... 5 Main window... 6 Button descriptions... 10 Chapter

More information

QUICK START GUIDE EDI Claims Link for Windows version 3.5

QUICK START GUIDE EDI Claims Link for Windows version 3.5 QUICK START GUIDE EDI Claims Link for Windows version 3.5 System Requirements - Operating system: Windows XP or later - Computer/Processor: Pentium 2, 233 MHz or greater - Memory: 64MB Ram - Minimum Screen

More information

Task Force on Technology / EXCEL

Task Force on Technology / EXCEL Task Force on Technology EXCEL Basic terminology Spreadsheet A spreadsheet is an electronic document that stores various types of data. There are vertical columns and horizontal rows. A cell is where the

More information

Table of Contents Advanced ID Creator User Guide

Table of Contents Advanced ID Creator User Guide Advanced ID Creator User Guide Revision 8.0.3 Table of Contents Chapter 1 Introduction... 1-5 Special Features... 1-5 What s New?... 1-5 Chapter 2 Installing Advanced ID Creator... 2-7 Minimum System Requirements...

More information

Hosting Users Guide 2011

Hosting Users Guide 2011 Hosting Users Guide 2011 eofficemgr technology support for small business Celebrating a decade of providing innovative cloud computing services to small business. Table of Contents Overview... 3 Configure

More information

QIAsymphony Management Console User Manual

QIAsymphony Management Console User Manual April 2012 QIAsymphony Management Console User Manual For use with software version 4.0 Sample & Assay Technologies Trademarks QIAGEN, QIAsymphony, Rotor-Gene (QIAGEN Group). InstallShield (Informer Technologies,

More information

Creating Personal Web Sites Using SharePoint Designer 2007

Creating Personal Web Sites Using SharePoint Designer 2007 Creating Personal Web Sites Using SharePoint Designer 2007 Faculty Workshop May 12 th & 13 th, 2009 Overview Create Pictures Home Page: INDEX.htm Other Pages Links from Home Page to Other Pages Prepare

More information

Endnote Web: Beginners Guide to Using Endnote Web and the Cite While You Write Function

Endnote Web: Beginners Guide to Using Endnote Web and the Cite While You Write Function 1 Endnote Web: Beginners Guide to Using Endnote Web and the Cite While You Write Function 1 Endnote Web User Guide Version 3.4 Created: June 2012 Author: Jessica Eustace-Cook 1 Table of Contents 1. About

More information

Sequence Analysis Instructions

Sequence Analysis Instructions Sequence Analysis Instructions In order to predict your drug metabolizing phenotype from your CYP2D6 gene sequence, you must determine: 1) The assembled sequence from your two opposing sequencing reactions

More information

USER MANUAL FOR. autocue.com

USER MANUAL FOR. autocue.com USER MANUAL FOR WINDOWS autocue.com Contents Install the QStart software Registering QStart Using your Starter Series Prompter Prompt output Dual screens Enable a prompt monitor Change the size Change

More information

NETWORK PRINT MONITOR User Guide

NETWORK PRINT MONITOR User Guide NETWORK PRINT MONITOR User Guide Legal Notes Unauthorized reproduction of all or part of this guide is prohibited. The information in this guide is subject to change without notice. We cannot be held liable

More information

Personal Call Manager User Guide. BCM Business Communications Manager

Personal Call Manager User Guide. BCM Business Communications Manager Personal Call Manager User Guide BCM Business Communications Manager Document Status: Standard Document Version: 04.01 Document Number: NN40010-104 Date: August 2008 Copyright Nortel Networks 2005 2008

More information

Using SSH Secure Shell Client for FTP

Using SSH Secure Shell Client for FTP Using SSH Secure Shell Client for FTP The SSH Secure Shell for Workstations Windows client application features this secure file transfer protocol that s easy to use. Access the SSH Secure FTP by double-clicking

More information

BUSINESS OBJECTS XI WEB INTELLIGENCE

BUSINESS OBJECTS XI WEB INTELLIGENCE BUSINESS OBJECTS XI WEB INTELLIGENCE SKW USER GUIDE (Skilled Knowledge Worker) North Carolina Community College Data Warehouse Last Saved: 3/31/10 9:40 AM Page 1 of 78 Contact Information Helpdesk If you

More information

Create a Simple Website. Intel Easy Steps 1 2012 Intel Corporation All rights reserved.

Create a Simple Website. Intel Easy Steps 1 2012 Intel Corporation All rights reserved. Create a Simple Website Intel Easy Steps 1 2012 Intel Corporation Website Creating a Simple Website As more and more people are using the Internet to get information, it has become very important for businesses

More information

LOREX CLIENT Remote Software 4.0

LOREX CLIENT Remote Software 4.0 LOREX CLIENT Remote Software 4.0 Instruction Manual English Version 2.0 MODEL: L20WD800 Series www.lorexcctv.com Copyright 2008 LOREX Technology Inc. Table of Contents Table of Contents Software Installation...

More information

Microsoft Office Access 2007 Basics

Microsoft Office Access 2007 Basics Access(ing) A Database Project PRESENTED BY THE TECHNOLOGY TRAINERS OF THE MONROE COUNTY LIBRARY SYSTEM EMAIL: TRAININGLAB@MONROE.LIB.MI.US MONROE COUNTY LIBRARY SYSTEM 734-241-5770 1 840 SOUTH ROESSLER

More information

Sage Accountants Business Cloud EasyEditor Quick Start Guide

Sage Accountants Business Cloud EasyEditor Quick Start Guide Sage Accountants Business Cloud EasyEditor Quick Start Guide VERSION 1.0 September 2013 Contents Introduction 3 Overview of the interface 4 Working with elements 6 Adding and moving elements 7 Resizing

More information

Centran Version 4 Getting Started Guide KABA MAS. Table Of Contents

Centran Version 4 Getting Started Guide KABA MAS. Table Of Contents Page 1 Centran Version 4 Getting Started Guide KABA MAS Kaba Mas Welcome Kaba Mas, part of the world-wide Kaba group, is the world's leading manufacturer and supplier of high security, electronic safe

More information

Hermes.Net IVR Designer Page 2 36

Hermes.Net IVR Designer Page 2 36 Hermes.Net IVR Designer Page 2 36 Summary 1. Introduction 4 1.1 IVR Features 4 2. The interface 5 2.1 Description of the Interface 6 2.1.1 Menus. Provides 6 2.1.2 Commands for IVR editions. 6 2.1.3 Commands

More information

DVR4C Remote Viewer Operation Manual Table of Contents EN 3 1. OVERVIEW...5 1.1 MINIMUM PC REQUIREMENTS...5 2. INSTALLING THE PROGRAM...

DVR4C Remote Viewer Operation Manual Table of Contents EN 3 1. OVERVIEW...5 1.1 MINIMUM PC REQUIREMENTS...5 2. INSTALLING THE PROGRAM... DVR4x4RemoteViewer.book Page 3 Tuesday, February 15, 2005 9:19 AM DVR4C Remote Viewer Operation Manual Table of Contents EN 3 1. OVERVIEW...5 1.1 MINIMUM PC REQUIREMENTS...5 2. INSTALLING THE PROGRAM...5

More information

OEMS PRE-HOSPITAL PATIENT DATA REPORT (PPDR) PROGRAM. Installation Instructions

OEMS PRE-HOSPITAL PATIENT DATA REPORT (PPDR) PROGRAM. Installation Instructions OEMS PRE-HOSPITAL PATIENT DATA REPORT (PPDR) PROGRAM Installation Instructions This is the ninth release of the PPDR program (Version 3.0). This program is for use on Windows XP and Vista Systems. A CD

More information

Basic Introduction. GMFX MetaTrader 4.0. Basic Introduction

Basic Introduction. GMFX MetaTrader 4.0. Basic Introduction GMFX GMFX About Got Money FX Got Money FX is an Australian owned and operated foreign exchange brokerage firm. We pride ourselves in offering our clients an honest and ethical trading environment. Clients

More information

WINDOWS 7 & HOMEGROUP

WINDOWS 7 & HOMEGROUP WINDOWS 7 & HOMEGROUP SHARING WITH WINDOWS XP, WINDOWS VISTA & OTHER OPERATING SYSTEMS Abstract The purpose of this white paper is to explain how your computers that are running previous versions of Windows

More information

Installation and Operation Manual Portable Device Manager, Windows version

Installation and Operation Manual Portable Device Manager, Windows version Installation and Operation Manual version version About this document This document is intended as a guide for installation, maintenance and troubleshooting of Portable Device Manager (PDM) and is relevant

More information

Vector NTI Advance 11.5 Quick Start Guide Catalog no , ,

Vector NTI Advance 11.5 Quick Start Guide Catalog no , , Vector NTI Advance 11.5 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Part no. 12605-022 Revision date: 10 October 2010 MAN0000419 User Manual 2010 Life Technologies Corporation. All rights

More information

StrikeRisk v6.0 IEC/EN 62305-2 Risk Management Software Getting Started

StrikeRisk v6.0 IEC/EN 62305-2 Risk Management Software Getting Started StrikeRisk v6.0 IEC/EN 62305-2 Risk Management Software Getting Started Contents StrikeRisk v6.0 Introduction 1/1 1 Installing StrikeRisk System requirements Installing StrikeRisk Installation troubleshooting

More information

How to Add Users 1. 2.

How to Add Users 1. 2. Administrator Guide Contents How to Add Users... 2 How to Delete a User... 9 How to Create Sub-groups... 12 How to Edit the Email Sent Out to New Users... 14 How to Edit and Add a Logo to Your Group's

More information

Installation and Operation Manual Unite Log Analyser

Installation and Operation Manual Unite Log Analyser Installation and Operation Manual Unite Log Analyser Contents 1 Introduction... 3 1.1 Abbreviations and Glossary... 4 2 Technical Solution... 4 2.1 Requirements... 5 2.1.1 Hardware... 5 2.1.2 Software...

More information

ToolBook 9.5. Getting Started with ToolBook

ToolBook 9.5. Getting Started with ToolBook Getting Started with ToolBook ToolBook 9.5 Copyright 2007-2008 SumTotal Systems, Inc. and its licensors. All Rights Reserved. SumTotal, SumTotal Systems, the SumTotal logo, ToolBook, ToolBook Instructor

More information

Microsoft Access 2010 Part 1: Introduction to Access

Microsoft Access 2010 Part 1: Introduction to Access CALIFORNIA STATE UNIVERSITY, LOS ANGELES INFORMATION TECHNOLOGY SERVICES Microsoft Access 2010 Part 1: Introduction to Access Fall 2014, Version 1.2 Table of Contents Introduction...3 Starting Access...3

More information

Charter Business Phone. Online Control Panel Getting Started Guide. Document Version 1.0

Charter Business Phone. Online Control Panel Getting Started Guide. Document Version 1.0 Charter Business Phone Online Control Panel Getting Started Guide Document Version 1.0 Table of Contents 1 About This Guide...4 2 Overview...5 2.1 Online Control Panel and Call Manager... 5 3 Manual and

More information

Most of your tasks in Windows XP will involve working with information

Most of your tasks in Windows XP will involve working with information OFFICE 1 File Management Files and Folders Most of your tasks in Windows XP will involve working with information stored on your computer. This material briefly explains how information is stored in Windows

More information

Password Memory 6 User s Guide

Password Memory 6 User s Guide C O D E : A E R O T E C H N O L O G I E S Password Memory 6 User s Guide 2007-2015 by code:aero technologies Phone: +1 (321) 285.7447 E-mail: info@codeaero.com Table of Contents Password Memory 6... 1

More information

MICROSOFT OUTLOOK 2010 WORK WITH CONTACTS

MICROSOFT OUTLOOK 2010 WORK WITH CONTACTS MICROSOFT OUTLOOK 2010 WORK WITH CONTACTS Last Edited: 2012-07-09 1 Access to Outlook contacts area... 4 Manage Outlook contacts view... 5 Change the view of Contacts area... 5 Business Cards view... 6

More information

Connecting to LUA s webmail

Connecting to LUA s webmail Connecting to LUA s webmail Effective immediately, the Company has enhanced employee remote access to email (Outlook). By utilizing almost any browser you will have access to your Company e-mail as well

More information

OPERATION MANUAL. MV-410RGB Layout Editor. Version 2.1- higher

OPERATION MANUAL. MV-410RGB Layout Editor. Version 2.1- higher OPERATION MANUAL MV-410RGB Layout Editor Version 2.1- higher Table of Contents 1. Setup... 1 1-1. Overview... 1 1-2. System Requirements... 1 1-3. Operation Flow... 1 1-4. Installing MV-410RGB Layout

More information

Getting Started Guide

Getting Started Guide Primer Express Software Version 3.0 Getting Started Guide Before You Begin Designing Primers and Probes for Quantification Assays Designing Primers and Probes for Allelic Discrimination Assays Ordering

More information

ACS CLIENT SOFTWARE USER MANUAL

ACS CLIENT SOFTWARE USER MANUAL ACS CLIENT SOFTWARE USER MANUAL 1 ACS USER GUIDE 1.1 System Requirement Recommended System Requirement OS CPU VGA RAM HDD WindowXP, Vista Pentium 4, 2Ghz 1024*768, 64MB 24bit color graphic card 1GB 20MB

More information

Instructions for Use. CyAn ADP. High-speed Analyzer. Summit 4.3. 0000050G June 2008. Beckman Coulter, Inc. 4300 N. Harbor Blvd. Fullerton, CA 92835

Instructions for Use. CyAn ADP. High-speed Analyzer. Summit 4.3. 0000050G June 2008. Beckman Coulter, Inc. 4300 N. Harbor Blvd. Fullerton, CA 92835 Instructions for Use CyAn ADP High-speed Analyzer Summit 4.3 0000050G June 2008 Beckman Coulter, Inc. 4300 N. Harbor Blvd. Fullerton, CA 92835 Overview Summit software is a Windows based application that

More information

MCCG PowerChart. Message Center Complete Manual. Hold the Ctrl key down & then left click on a link below to navigate to it:

MCCG PowerChart. Message Center Complete Manual. Hold the Ctrl key down & then left click on a link below to navigate to it: Hold the Ctrl key down & then left click on a link below to navigate to it: Table of Contents Overview of the Message Center Message Center Basics Working with the Message Journal Working with Documents

More information

Chapter 1. Macintosh Basics

Chapter 1. Macintosh Basics Chapter 1 Macintosh Basics The purpose of the this chapter is to help introduce students to the Macintosh environment. Although we will be dealing with Macintosh computers exclusively in this class, students

More information

Outlook Web Access. PRECEDED by v\

Outlook Web Access. PRECEDED by v\ Outlook Web Access Logging in to OWA (Outlook Web Access) from Home 1. Login page http://mail.vernonct.org/exchange 2. To avoid these steps each time you login, you can add the login page to your favorites.

More information

O UTLOOK 2003 HELP SHEET MAIL. Opening the program. Mail

O UTLOOK 2003 HELP SHEET MAIL. Opening the program. Mail O UTLOOK 2003 HELP SHEET MAIL Opening the program At Work Double-click the icon on your desktop. Or click the Start button. If this icon is displayed, click on it. If it is not displayed, click Start,

More information

MassARRAY Typer 3.4 Software User s Guide for iplex and hme

MassARRAY Typer 3.4 Software User s Guide for iplex and hme MassARRAY Typer 3.4 Software User s Guide for iplex and hme Document Number: 11546 Doc 11546, R03 CO 060094 Dear Customer, Thank you for purchasing MassARRAY from SEQUENOM. This software was created specifically

More information

Fleet Maintenance Software

Fleet Maintenance Software Fleet Maintenance Software Welcome Thank you for taking time to review FleetWise VB Maintenance Management Made Simple. This guide is intended to provide a quick overview of installing the software and

More information

Central Management Software CV3-M1024

Central Management Software CV3-M1024 Table of Contents Chapter 1. User Interface Overview...5 Chapter 2. Installation...6 2.1 Beginning Installation...6 2.2 Starting the CMS software...10 2.3 Starting it from the Start menu...10 2.4 Starting

More information

Create a Poster Using Publisher

Create a Poster Using Publisher Contents 1. Introduction 1. Starting Publisher 2. Create a Poster Template 5. Aligning your images and text 7. Apply a background 12. Add text to your poster 14. Add pictures to your poster 17. Add graphs

More information

State of Ohio DMS Solution for Personnel Records Training

State of Ohio DMS Solution for Personnel Records Training State of Ohio DMS Solution for Personnel Records Training 1 Contents LOGGING IN AND THE BASICS... 3 LOGGING INTO THE DMS... 3 NAVIGATING THE UNITY CLIENT... 4 CREATING PERSONAL PAGES... 6 ADDING WEB LINKS

More information

LEARNING RESOURCE CENTRE GUIDE TO OFFICE 365

LEARNING RESOURCE CENTRE GUIDE TO OFFICE 365 LEARNING RESOURCE CENTRE GUIDE TO OFFICE 365 LEARNING RESOURCE CENTRE OCTOBER 2014/2015 Table of Contents Explanation of One Drive and Microsoft Office Online... 3 How to create a document and folder...

More information

Custom TaqMan Assays For New SNP Genotyping and Gene Expression Assays. Design and Ordering Guide

Custom TaqMan Assays For New SNP Genotyping and Gene Expression Assays. Design and Ordering Guide Custom TaqMan Assays For New SNP Genotyping and Gene Expression Assays Design and Ordering Guide For Research Use Only. Not intended for any animal or human therapeutic or diagnostic use. Information in

More information

Hosted VoIP Phone System. Desktop Toolbar User Guide

Hosted VoIP Phone System. Desktop Toolbar User Guide Hosted VoIP Phone System Desktop Toolbar User Guide Contents 1 Introduction... 3 1.1 System Requirements... 3 2 Installing the Telesystem Hosted VoIP Toolbar... 4 3 Accessing the Hosted VoIP Toolbar...

More information

webkpi SaaS ETL Connector Installation & Configuration Guide

webkpi SaaS ETL Connector Installation & Configuration Guide webkpi SaaS ETL Connector Installation & Configuration Guide SaaS ETL Version 2.5.0.12 Version 1.6 September 2013 webkpi SaaS ETL Connector Version 2.5.0.12 V 1.6 Page 1 Table of Contents Table of Contents

More information

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison

RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the

More information

Pro Surveillance System 4.0. Quick Start Reference Guide

Pro Surveillance System 4.0. Quick Start Reference Guide Pro Surveillance System 4.0 Quick Start Reference Guide 1 Table of Contents 1) Overview 3 2) Initial Setup Adding a Connection..4 3) Viewing Live Cameras...6 4) Single or Multi Channel Playback..8 5) Predetermined

More information

Software User's Guide

Software User's Guide Software User's Guide Brother QL-series The contents of this guide and the specifications of this product are subject to change without notice. Brother reserves the right to make changes without notice

More information

DESIGN A WEB SITE USING PUBLISHER Before you begin, plan your Web site

DESIGN A WEB SITE USING PUBLISHER Before you begin, plan your Web site Page 1 of 22 DESIGN A WEB SITE USING PUBLISHER Before you begin, plan your Web site Before you create your Web site, ask yourself these questions: What do I want the site to do? Whom do I want to visit

More information

Legal Notes. Regarding Trademarks. Model supported by the KX printer driver. 2010 KYOCERA MITA Corporation

Legal Notes. Regarding Trademarks. Model supported by the KX printer driver. 2010 KYOCERA MITA Corporation Legal Notes Unauthorized reproduction of all or part of this guide is prohibited. The information in this guide is subject to change for improvement without notice. We cannot be held liable for any problems

More information

Creating a Website with Publisher 2013

Creating a Website with Publisher 2013 Creating a Website with Publisher 2013 University Information Technology Services Training, Outreach, Learning Technologies & Video Production Copyright 2015 KSU Division of University Information Technology

More information

SonicWALL SSL VPN 3.5: Virtual Assist

SonicWALL SSL VPN 3.5: Virtual Assist SonicWALL SSL VPN 3.5: Virtual Assist Document Scope This document describes how to use the SonicWALL Virtual Assist add-on for SonicWALL SSL VPN security appliances. This document contains the following

More information

SSH Secure Client (Telnet & SFTP) Installing & Using SSH Secure Shell for Windows Operation Systems

SSH Secure Client (Telnet & SFTP) Installing & Using SSH Secure Shell for Windows Operation Systems SSH Secure Client (Telnet & SFTP) Installing & Using SSH Secure Shell for Windows Operation Systems What is SSH?: SSH is an application that protects the TCP/IP connections between two computers. The software

More information

Smart Web. User Guide. Amcom Software, Inc.

Smart Web. User Guide. Amcom Software, Inc. Smart Web User Guide Amcom Software, Inc. Copyright Version 4.0 Copyright 2003-2005 Amcom Software, Inc. All Rights Reserved. Information in this document is subject to change without notice. The software

More information

Software Installation & Quick Start Usage Guide

Software Installation & Quick Start Usage Guide LightScribe Duplicator rev 1.3 Software Installation & Quick Start Usage Guide Minimum Hardware Requirements 5. During the installation process, you will be prompted for a Product Key. Such product key

More information

Business Objects Version 5 : Introduction

Business Objects Version 5 : Introduction Business Objects Version 5 : Introduction Page 1 TABLE OF CONTENTS Introduction About Business Objects Changing Your Password Retrieving Pre-Defined Reports Formatting Your Report Using the Slice and Dice

More information

3. Common Spreadsheet Usability Features

3. Common Spreadsheet Usability Features Spreadsheet Methods 5N1977 3. Common Spreadsheet Usability Features Contents 1. Save the Spreadsheet, Load an existing Spreadsheet and Exit from the Application... 1 Save a Spreadsheet... 1 Load or Open

More information