La capture de la fonction par des approches haut débit

Size: px
Start display at page:

Download "La capture de la fonction par des approches haut débit"

Transcription

1 Colloque Génomique Environnementale LYON 2011 La capture de la fonction par des approches haut débit Pierre PEYRET J. Denonfoux, N. Parisot, E. Dugat-Bony, C. Biderre-Petit, D. Boucher, G. Fonty, E. Peyretaillade Laboratory Microorganisms Genome and Environment UMR CNRS 6023 Clermont-Ferrand, FRANCE

2 Microorganisms Background Represent the most important and diverse group of organisms Widely distributed in many environmental habitats Play major roles in ecosystems functioning But Microbial diversity Diversity and structure of complex microbial communities still poorly understood Less than 1% of Bacteria cultivated and characterized (Amann et al., 1995) Great challenge in microbial ecology to evaluate microbial diversity in complex environments

3 Background Complex environments survey Access to a much larger reservoir of genomic and metabolic information Link community structure and diversity to function How? ATATGCGATA TATACGCTAT What? Who?

4 Genomic tools - Microbial species or microbial consortia characterization using nucleic acidbased techniques Global approaches DNA Soil sample : nucleic acids extraction RNA active cells PCR DNA fingerprints ARDRA TRFLP DGGE TGGE RAPD sequencing Genomic library Metagenomic Systematic sequencing Hybridization screening Functional screening Microarrays PCR Taxonomic - Functional genomic 4 RT-PCR sequencing

5 III. Genomic tools 11 Selective extraction of individual microorganisms from native microbial communities sample SIP : stable isotope probing Flow cytometry cell sorting (Kalyuzhnaya et al, 2006) Microfluidic chips (DNA, RNA isolation) (Marcy et al, 2007) Shotgun libraries Sequencing (Kalyuzhnaya et al, 2008) Whole genome amplication (MDA) Targeted metagenome : link between structure - function Whole genome amplication (MDA) Immunomagnetic capture (Pernthaler et al, 2008) Pyrosequencing

6 Metagenomics Culture-independent tool Enrich the knowledge and understanding of the uncultured world Increase of the rate of novel genes and novel molecule discovery Direct Sequencing Direct sequencing allowed by next generation sequencing (NGS) platforms development 454 pyrosequencing Difficult to apply for a complete survey of complex environmental samples A promising alternative would be to reduce sample complexity Metagenomics by targeted capture methods

7 CH 4 Production MCRI et MCRII ANME (anaerobic methane-oxidizing archaea)

8 Lake Pavin [CH 4 ] [CH 4 ] [CH 4 ] Mixolimnion (0-60m) [CH 4 ] Chemocline Monimolimnion (63-92m) [Fe 2+ ] [CH 4 ] [CH 4 ] [NH 4+ ] [CH 4 ] Zone intermédiaire Sédiments

9 Method validation Targeting mcra gene on Methanosarcina acetivorans C2A strain qpcr analysis and enrichment calculation Based on the R=2 - Ct calculation (Livak and Schmittgen, 2001) Relative fold enrichment (R) 1 st cycle nd >200,000 cycle Tremendous increase of mcra enrichment with two cycles of capture Sequencing of DNA fragments retrieved from the second cycle mcra (1713 bp) M. acetivorans C2A 1800bp High potential to target desired sequence and its flanking region All sequences showed a perfect correspondance to the mcra gene Possibility to capture a 1800 bp sequence with a 200bp non-coding region

10 Different Strategies of Sequencing Lake Pavin 90m Metagenomic DNA Sample Targeted Gene (mcra) Amplicons (PCR) Metagenome Targeted Capture

11 Preprocessing Extract Data Split by Multiplex Identifier (MID) Extract Sequence and Quality Data Trim Ends Trim 5 (Key/MID/PCR Primer) and 3 (Adaptator B) Ends Trim Low Quality Ends Filter Sequences Filter Too Short and Too Long Reads (Mode ± 2SD) Filter Low Quality Reads Filter Reads with Ambiguous Bases N Filter Low Complexity Reads Filter Artificial Duplicates

12 >Seq1 ATGCACGTAGCT ACGAAATCA >Seq2 ATCGACTCAGAC AGCCACGAC >Seq3 ATCGACGACTCA GACCACAC.. >Seq1 ATGCACGTAGCT ACGAAATCA >Seq2 ATCGACTCAGAC AGCCACGAC >Seq3 ATCGACGACTCA GACCACAC.. >Seq1 ATGCACGTAGCT ACGAAATCA >Seq2 ATCGACTCAGAC AGCCACGAC >Seq3 ATCGACGACTCA GACCACAC.. mcra Sequences Database Find mcra sequences >Seq1 FTQYEAAALVAAR RDEAAL >Seq2 FTQYEAAALVAGR RDEAAL >Seq3 FTQYEAAALVGAR RDEAAL.. >Seq1034 FTQYEAAALVAAR RDEAAL >Seq5532 FTQYEGAALVALA RDEAW.. >Seq41 FTQYEAAALVAAR RDEAAL >Seq65 AAALVAARRDEAA LGLKDEAA >Seq193 FTQYEGAALVALA RDEAW.. Amplicons Metagenome Capture

13 Diversity >Seq1034 FTQYEAAALVAAR RDEAAL >Seq5532 FTQYEGAALVALA RDEAW.. Metagenome >Seq1 FTQYEAAALVAAR RDEAAL >Seq2 FTQYEAAALVAGR RDEAAL >Seq3 FTQYEAAALVGAR RDEAAL.. Amplicons Capture >Seq41 FTQYEAAALVAAR RDEAAL >Seq65 AAALVAARRDEAA LGLKDEAA >Seq193 FTQYEGAALVALA RDEAW..

14 Assembly Overlap Length : 60 nts Percent Identity Overlap : 95% Reads Assembled Singletons Contigs Large Contigs Average Contig Size N50 Contig Size Largest Contig Size Metagenome Capture mcr mcrb mcrc mcrd mcrg mcra Contigs

15 Diversity Strategy OTUs Amplicons 28 Capture 24 Metagenome 1 Published data 3

16 Percentage of Reads Diversity Capture Amplicons OTUs

17 Diversity Number of OTUs Amplicons Metagenome Capture Methanopyrales Methanobacteriales Methanococcales Novel Order Methanomicrobiales Methanocellales Methanosarcinales

18 Diversity 100% Highest diversity retrieved by targeted capture strategy Detection of a deeper diversity in Methanosarcinales and Methanobacteriales orders compared to a PCR based approach 90% 80% 70% 60% 50% 40% 30% Methanomicrobiales Methanosarcinales Methanobacteriales Novel Order 20% 10% 0% Capture Amplicons

19 Environmental application Targeting large mcra gene diversity on Lake Pavin (France) Background (3/3) Solution hybrid selection method Method validation Env. application 70m CH 4 90m Mixolimnion (oxic zone) Mesolimnion (interface) Monimolimnion (anoxic zone) Conclusions & Sediments 92m Perspectives Significant mcra enrichment and ability to recover large DNA fragments than PCR approach

20 Conclusions & Perspectives Background (3/3) Solution hybrid selection method Method validation Env. application Conclusion s & Perspective s Innovative strategy to trap desired targets in complex mixtures Recovery of larger DNA fragments than PCR approach Relevant method to enrich in targeted sequences Ability to use a large and explorative probe set Target simultaneous phylogenetic and functional markers Capture largest DNA fragments Complementary and beneficial approach to NGS Suitable tool to investigate genetic diversity in complex environments

21 Laboratory Microorganisms: Genome and Environment Acknowledgments GIIM team P. Peyret J. Denonfoux E. Dugat-Bony N. Parisot F. Jaziri S. ComtetC. Biderre-Petit D. Boucher S. Rimour E. Peyretaillade A. Moné B. Chebance I. Pinto Thank you for your attention! PhD Funder CNRS Région Auvergne

Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action

Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action Les Rencontres de L INRA Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action E Albina (CIRAD) / S Guyomard(Institut Pasteur) Guadeloupe The era

More information

Tribuna Académica. Overview of Metagenomics for Marine Biodiversity Research 1. Barton E. Slatko* Metagenomics defined

Tribuna Académica. Overview of Metagenomics for Marine Biodiversity Research 1. Barton E. Slatko* Metagenomics defined Tribuna Académica 117 Overview of Metagenomics for Marine Biodiversity Research 1 Barton E. Slatko* We are in the midst of the fastest growing revolution in molecular biology, perhaps in all of life science,

More information

Next Generation Sequencing Technologies in Microbial Ecology. Frank Oliver Glöckner

Next Generation Sequencing Technologies in Microbial Ecology. Frank Oliver Glöckner Next Generation Sequencing Technologies in Microbial Ecology Frank Oliver Glöckner 1 Max Planck Institute for Marine Microbiology Investigation of the role, diversity and features of microorganisms Interactions

More information

Data Analysis for Ion Torrent Sequencing

Data Analysis for Ion Torrent Sequencing IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

Genomics Services @ GENterprise

Genomics Services @ GENterprise Genomics Services @ GENterprise since 1998 Mainz University spin-off privately financed 6-10 employees since 2006 Genomics Services @ GENterprise Sequencing Service (Sanger/3730, 454) Genome Projects (Bacteria,

More information

A Primer of Genome Science THIRD

A Primer of Genome Science THIRD A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:

More information

How To Monitor Cyanohab

How To Monitor Cyanohab Application of molecular tools for routine water quality monitoring MWQI Technical Meeting May 27, 2015 Tim Otten, PhD, MPH Bend Genetics, LLC T: 541 600 4363 ottentim@bendgenetics.com www.bendgenetics.com

More information

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis

Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype

More information

AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data

AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data Csaba Kerepesi, Dániel Bánky, Vince Grolmusz: AmphoraNet: Taxonomic Composition Analysis of Metagenomic Shotgun Sequencing Data http://pitgroup.org/amphoranet/ PIT Bioinformatics Group, Department of Computer

More information

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls?

BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? BRCA1 / 2 testing by massive sequencing highlights, shadows or pitfalls? Giovanni Luca Scaglione, PhD ------------------------ Laboratory of Clinical Molecular Diagnostics and Personalized Medicine, Institute

More information

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources

Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources 1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools

More information

DNA Sequence Analysis

DNA Sequence Analysis DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide

More information

IN SITU IDENTIFICATION AND QUANTIFICATION OF BIOAUGMENTATION PRODUCTS IN WASTEWATER TREATMENT FACILITIES

IN SITU IDENTIFICATION AND QUANTIFICATION OF BIOAUGMENTATION PRODUCTS IN WASTEWATER TREATMENT FACILITIES IN SITU IDENTIFICATION AND QUANTIFICATION OF BIOAUGMENTATION PRODUCTS IN WASTEWATER TREATMENT FACILITIES Seth D Imperio, David J. Drahos, Matthew Livingston and Steve Leach Novozymes Biologicals, 5400

More information

NGS data analysis. Bernardo J. Clavijo

NGS data analysis. Bernardo J. Clavijo NGS data analysis Bernardo J. Clavijo 1 A brief history of DNA sequencing 1953 double helix structure, Watson & Crick! 1977 rapid DNA sequencing, Sanger! 1977 first full (5k) genome bacteriophage Phi X!

More information

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center

Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing

More information

Microbial Oceanomics using High-Throughput DNA Sequencing

Microbial Oceanomics using High-Throughput DNA Sequencing Microbial Oceanomics using High-Throughput DNA Sequencing Ramiro Logares Institute of Marine Sciences, CSIC, Barcelona 9th RES Users'Conference 23 September 2015 Importance of microbes in the sunlit ocean

More information

PreciseTM Whitepaper

PreciseTM Whitepaper Precise TM Whitepaper Introduction LIMITATIONS OF EXISTING RNA-SEQ METHODS Correctly designed gene expression studies require large numbers of samples, accurate results and low analysis costs. Analysis

More information

Influence of the skin mechanical and microbial properties on hair growth

Influence of the skin mechanical and microbial properties on hair growth Call for Interdisciplinary Projects Sevres 2014 A General Information Project title Influence of the skin mechanical and microbial properties on hair growth Acronym TADDEI: The Ambiguous Dupond and Dupont

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Next generation DNA sequencing technologies. theory & prac-ce

Next generation DNA sequencing technologies. theory & prac-ce Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing

More information

Nucleic Acid Techniques in Bacterial Systematics

Nucleic Acid Techniques in Bacterial Systematics Nucleic Acid Techniques in Bacterial Systematics Edited by Erko Stackebrandt Department of Microbiology University of Queensland St Lucia, Australia and Michael Goodfellow Department of Microbiology University

More information

Introduction To Real Time Quantitative PCR (qpcr)

Introduction To Real Time Quantitative PCR (qpcr) Introduction To Real Time Quantitative PCR (qpcr) SABiosciences, A QIAGEN Company www.sabiosciences.com The Seminar Topics The advantages of qpcr versus conventional PCR Work flow & applications Factors

More information

Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France

Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France Nicolas Pons INRA Ins(tut Micalis Plateforme MetaQuant Jouy- en- Josas, France Special Science Online Collec-on: Dealing with Data (feb 2011) DNA Protein TTGTGGATAACCTCAAAACTTTTCTCTTTCTGACCTGTGGAAAACTTTTTCGTTTTATGATAGAATCAGAGGACAAGAATAAAGA!

More information

Difficult DNA Templates Sequencing. Primer Walking Service

Difficult DNA Templates Sequencing. Primer Walking Service Difficult DNA Templates Sequencing Primer Walking Service Result 16/18s (ITS 5.8s) rrna Sequencing Phylogenetic tree 16s rrna Region ITS rrna Region ITS and 26s rrna Region Order and Result Cloning Service

More information

Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools.

Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Empowering microbial genomics. Extensive methods. Expansive possibilities. In microbiome studies

More information

Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: ignatius.tan@nyu.

Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: ignatius.tan@nyu. Molecular and Cell Biology Laboratory (BIOL-UA 223) Instructor: Ignatius Tan Phone: 212-998-8295 Office: 764 Brown Email: ignatius.tan@nyu.edu Course Hours: Section 1: Mon: 12:30-3:15 Section 2: Wed: 12:30-3:15

More information

MASTER OF SCIENCE IN BIOLOGY

MASTER OF SCIENCE IN BIOLOGY MASTER OF SCIENCE IN BIOLOGY The Master of Science in Biology program is designed to provide a strong foundation in concepts and principles of the life sciences, to develop appropriate skills and to inculcate

More information

Recombinant DNA and Biotechnology

Recombinant DNA and Biotechnology Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study

More information

PRACTICAL APPROACH TO ECOTOXICOGENOMICS

PRACTICAL APPROACH TO ECOTOXICOGENOMICS ANNOUNCEMENT PRACTICAL APPROACH TO ECOTOXICOGENOMICS Advanced Workshop Studies in Biology and Applied Biosciences Department of Biology University of Aveiro, 30 April- 4 May 2007 This one-week post-graduate

More information

Potential uses of genomic investigations for natural remediation of chlorinated pollutants

Potential uses of genomic investigations for natural remediation of chlorinated pollutants Potential uses of genomic investigations for natural remediation of chlorinated pollutants Equipe Adaptations et Interactions Microbiennes dans l Environnement Université de Strasbourg, UMR 7156 CNRS Permanent

More information

July 7th 2009 DNA sequencing

July 7th 2009 DNA sequencing July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer

More information

How To Get A Cell Print

How To Get A Cell Print QUICK CELL CAPTURE AND CHARACTERIZATION GUIDE FOR CELLSEARCH CUSTOMERS CellSave EDTA Blood sample Rare cell capture Enumeration Single protein marker Cell capture for molecular characterization CELLSEARCH

More information

Speed Matters - Fast ways from template to result

Speed Matters - Fast ways from template to result qpcr Symposium 2007 - Weihenstephan Speed Matters - Fast ways from template to result March 28, 2007 Dr. Thorsten Traeger Senior Scientist, Research and Development - 1 - Overview Ạgenda Fast PCR The Challenges

More information

The Use of Stable Isotope and Molecular Technologies to Monitor MNA and Enhance In-Situ Bioremediation

The Use of Stable Isotope and Molecular Technologies to Monitor MNA and Enhance In-Situ Bioremediation The Use of Stable Isotope and Molecular Technologies to Monitor MNA and Enhance In-Situ Bioremediation Eleanor M. Jennings, Ph.D. URS Corporation Introduction to Technologies Stable Isotope Techniques

More information

Twincore - Zentrum für Experimentelle und Klinische Infektionsforschung Institut für Molekulare Bakteriologie

Twincore - Zentrum für Experimentelle und Klinische Infektionsforschung Institut für Molekulare Bakteriologie Twincore - Zentrum für Experimentelle und Klinische Infektionsforschung Institut für Molekulare Bakteriologie 0 HELMHOLTZ I ZENTRUM FÜR INFEKTIONSFORSCHUNG Technische Universität Braunschweig Institut

More information

PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide

PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR Results Interpretation Guide Pathogen Detection Systems by Real Time PCR Microbial offers real time PCR based systems for the detection of pathogenic bacteria

More information

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics

The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The Power of Next-Generation Sequencing in Your Hands On the Path towards Diagnostics The GS Junior System The Power of Next-Generation Sequencing on Your Benchtop Proven technology: Uses the same long

More information

Overview of Next Generation Sequencing platform technologies

Overview of Next Generation Sequencing platform technologies Overview of Next Generation Sequencing platform technologies Dr. Bernd Timmermann Next Generation Sequencing Core Facility Max Planck Institute for Molecular Genetics Berlin, Germany Outline 1. Technologies

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Mir-X mirna First-Strand Synthesis Kit User Manual

Mir-X mirna First-Strand Synthesis Kit User Manual User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.

More information

Next Generation Sequencing for DUMMIES

Next Generation Sequencing for DUMMIES Next Generation Sequencing for DUMMIES Looking at a presentation without the explanation from the author is sometimes difficult to understand. This document contains extra information for some slides that

More information

Introduction to Bioinformatics 3. DNA editing and contig assembly

Introduction to Bioinformatics 3. DNA editing and contig assembly Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov

More information

restriction enzymes 350 Home R. Ward: Spring 2001

restriction enzymes 350 Home R. Ward: Spring 2001 restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually

More information

An introduction to bioinformatic tools for population genomic and metagenetic data analysis, 2.5 higher education credits Third Cycle

An introduction to bioinformatic tools for population genomic and metagenetic data analysis, 2.5 higher education credits Third Cycle An introduction to bioinformatic tools for population genomic and metagenetic data analysis, 2.5 higher education credits Third Cycle Faculty of Science; Department of Marine Sciences The Swedish Royal

More information

Description: Molecular Biology Services and DNA Sequencing

Description: Molecular Biology Services and DNA Sequencing Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:

More information

Methods for Analyzing Diversity of Microbial Communities in Natural Environments

Methods for Analyzing Diversity of Microbial Communities in Natural Environments Ceylon Journal of Science (Bio. Sci.) 42(1): 19-33, 2013 DOI: 10.4038/cjsbs.v42i1.5896 REVIEW PAPER Methods for Analyzing Diversity of Microbial Communities in Natural Environments Md. Fakruddin 1 * and

More information

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)

Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,

More information

NORTH PACIFIC RESEARCH BOARD SEMIANNUAL PROGRESS REPORT

NORTH PACIFIC RESEARCH BOARD SEMIANNUAL PROGRESS REPORT 1. PROJECT INFORMATION NPRB Project Number: 1303 Title: Assessing benthic meiofaunal community structure in the Alaskan Arctic: A high-throughput DNA sequencing approach Subaward period July 1, 2013 Jun

More information

Typing in the NGS era: The way forward!

Typing in the NGS era: The way forward! Typing in the NGS era: The way forward! Valeria Michelacci NGS course, June 2015 Typing from sequence data NGS-derived conventional Multi Locus Sequence Typing (University of Warwick, 7 housekeeping genes)

More information

Analysis of gene expression data. Ulf Leser and Philippe Thomas

Analysis of gene expression data. Ulf Leser and Philippe Thomas Analysis of gene expression data Ulf Leser and Philippe Thomas This Lecture Protein synthesis Microarray Idea Technologies Applications Problems Quality control Normalization Analysis next week! Ulf Leser:

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

MARY DOHERTY 1111 Holland Avenue Cambridge, MD 21613 Telephone: 413-887-8896 e-mail: mdoherty@umces.edu

MARY DOHERTY 1111 Holland Avenue Cambridge, MD 21613 Telephone: 413-887-8896 e-mail: mdoherty@umces.edu MARY DOHERTY 1111 Holland Avenue Cambridge, MD 21613 Telephone: 413-887-8896 e-mail: mdoherty@umces.edu PROFESSIONAL PREPARATION Postdoctoral: University of Maryland Center for Environmental Sciences Advisor:

More information

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation.

Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation. Introduction to SMRTbell Template Preparation 100 338 500 01 1. SMRTbell Template Preparation 1.1 Introduction to SMRTbell Template Preparation Welcome to Pacific Biosciences' Introduction to SMRTbell

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

Introduction to next-generation sequencing data

Introduction to next-generation sequencing data Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS

More information

ANALYSIS OF MICROBIAL DIVERSITY BY AMPLICON PYROSEQUENCING

ANALYSIS OF MICROBIAL DIVERSITY BY AMPLICON PYROSEQUENCING University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Dissertations & Theses in Food Science and Technology Food Science and Technology Department 8-10-2012 ANALYSIS OF MICROBIAL

More information

Non-invasive prenatal detection of chromosome aneuploidies using next generation sequencing: First steps towards clinical application

Non-invasive prenatal detection of chromosome aneuploidies using next generation sequencing: First steps towards clinical application Non-invasive prenatal detection of chromosome aneuploidies using next generation sequencing: First steps towards clinical application PD Dr. rer. nat. Markus Stumm Zentrum für Pränataldiagnostik Kudamm-199

More information

Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples

Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples Development of two Novel DNA Analysis methods to Improve Workflow Efficiency for Challenging Forensic Samples Sudhir K. Sinha, Ph.D.*, Anne H. Montgomery, M.S., Gina Pineda, M.S., and Hiromi Brown, Ph.D.

More information

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals

Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh

More information

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing

Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAAC GTGCAC GTGAAC Wouter Coppieters Head of the genomics core facility GIGA center, University of Liège Bioruptor NGS: Unbiased DNA

More information

How many of you have checked out the web site on protein-dna interactions?

How many of you have checked out the web site on protein-dna interactions? How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss

More information

Vector NTI Advance 11 Quick Start Guide

Vector NTI Advance 11 Quick Start Guide Vector NTI Advance 11 Quick Start Guide Catalog no. 12605050, 12605099, 12605103 Version 11.0 December 15, 2008 12605022 Published by: Invitrogen Corporation 5791 Van Allen Way Carlsbad, CA 92008 U.S.A.

More information

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,

More information

Denaturing Gradient Gel Electrophoresis (DGGE)

Denaturing Gradient Gel Electrophoresis (DGGE) Laboratory for Microbial Ecology Department of Earth, Ecological and Environmental Sciences University of Toledo Denaturing Gradient Gel Electrophoresis (DGGE) Background information Denaturing gradient

More information

IMCAS-BRC: toward better management and more efficient exploitation of microbial resources

IMCAS-BRC: toward better management and more efficient exploitation of microbial resources IMCAS-BRC: toward better management and more efficient exploitation of microbial resources Xiuzhu Dong Biological Resources Center Institute of Microbiology, Chinese Academy of Sciences Challenges Global

More information

History of DNA Sequencing & Current Applications

History of DNA Sequencing & Current Applications History of DNA Sequencing & Current Applications Christopher McLeod President & CEO, 454 Life Sciences, A Roche Company IMPORTANT NOTICE Intended Use Unless explicitly stated otherwise, all Roche Applied

More information

VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10

VLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10 Topic J10+11: Molecular-biological methods + Clinical virology I (hepatitis A, B & C, HIV) To study: PCR, ELISA, your own notes from serology reactions Task J10/1: DNA isolation of the etiological agent

More information

Recombinant DNA Technology

Recombinant DNA Technology Recombinant DNA Technology Dates in the Development of Gene Cloning: 1965 - plasmids 1967 - ligase 1970 - restriction endonucleases 1972 - first experiments in gene splicing 1974 - worldwide moratorium

More information

MoBEDAC -- Integrated data and analysis for the indoor and built environment. Folker Meyer Argonne National Laboratory GSC 13 Shenzhen, China

MoBEDAC -- Integrated data and analysis for the indoor and built environment. Folker Meyer Argonne National Laboratory GSC 13 Shenzhen, China MoBEDAC -- Integrated data and analysis for the indoor and built environment Folker Meyer Argonne National Laboratory GSC 13 Shenzhen, China NGS is causing paradigm shift Environmental clone libraries

More information

Overview sequence projects

Overview sequence projects Overview sequence projects Bioassist NGS meeting 15-01-2010 Barbera van Schaik KEBB - Bioinformatics Laboratory b.d.vanschaik@amc.uva.nl NGS at the Academic Medical Center Sequence facility Laboratory

More information

A rapid and low-cost method for assessing AD plant health through identification of functional microbial communities

A rapid and low-cost method for assessing AD plant health through identification of functional microbial communities Feasibility Report A rapid and low-cost method for assessing AD plant health through identification of functional microbial communities A feasibility report from the Driving Innovation in AD programme

More information

G E N OM I C S S E RV I C ES

G E N OM I C S S E RV I C ES GENOMICS SERVICES THE NEW YORK GENOME CENTER NYGC is an independent non-profit implementing advanced genomic research to improve diagnosis and treatment of serious diseases. capabilities. N E X T- G E

More information

Single Nucleotide Polymorphisms (SNPs)

Single Nucleotide Polymorphisms (SNPs) Single Nucleotide Polymorphisms (SNPs) Additional Markers 13 core STR loci Obtain further information from additional markers: Y STRs Separating male samples Mitochondrial DNA Working with extremely degraded

More information

An introduction to bioinformatic tools for metagenetic and population genomic data analysis, 2.0 higher education credits

An introduction to bioinformatic tools for metagenetic and population genomic data analysis, 2.0 higher education credits An introduction to bioinformatic tools for metagenetic and population genomic data analysis, 2.0 higher education credits Course period: 3-7 November 2014 Course leaders / Addresses for applications: Pierre

More information

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms

Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).

More information

Ten years ago marked the official end of the Human Genome Project, but really it was just the beginning

Ten years ago marked the official end of the Human Genome Project, but really it was just the beginning Ten years ago marked the official end of the Human Genome Project, but really it was just the beginning On April 24, 2003, the sequence of the human genetic code, or genome, was published, signifying the

More information

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova

New generation sequencing: current limits and future perspectives. Giorgio Valle CRIBI - Università di Padova New generation sequencing: current limits and future perspectives Giorgio Valle CRIBI Università di Padova Around 2004 the Race for the 1000$ Genome started A few questions... When? How? Why? Standard

More information

Bioprospecting. for. Microalgae

Bioprospecting. for. Microalgae Microalgae for Bioprospecting Dr. J. Polle Department of Biology Brooklyn College of CUNY 2900 Bedford Ave, 200NE Brooklyn, NY 11220 jpolle@brooklyn.cuny.edu http://www.dunaliella.org Presentation Outline

More information

Essentials of Real Time PCR. About Sequence Detection Chemistries

Essentials of Real Time PCR. About Sequence Detection Chemistries Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected

More information

bitter is de pil Linos Vandekerckhove, MD, PhD

bitter is de pil Linos Vandekerckhove, MD, PhD 4//24 Current HIV care HIV copies/ ml plasma Viral load Welcome to the Digital droplet PCR age! bitter is de pil Linos Vandekerckhove, MD, PhD Latent HIV reservoir Time at Ghent University Hospital 2 HIV

More information

Microarray Data Analysis Workshop. Custom arrays and Probe design Probe design in a pangenomic world. Carsten Friis. MedVetNet Workshop, DTU 2008

Microarray Data Analysis Workshop. Custom arrays and Probe design Probe design in a pangenomic world. Carsten Friis. MedVetNet Workshop, DTU 2008 Microarray Data Analysis Workshop MedVetNet Workshop, DTU 2008 Custom arrays and Probe design Probe design in a pangenomic world Carsten Friis Media glna tnra GlnA TnrA C2 glnr C3 C5 C6 K GlnR C1 C4 C7

More information

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want

When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want 1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very

More information

Clinical Research Infrastructure

Clinical Research Infrastructure Clinical Research Infrastructure Enhancing UK s Clinical Research Capabilities & Technologies At least 150m to establish /develop cutting-edge technological infrastructure, UK wide. to bring into practice

More information

An Overview of DNA Sequencing

An Overview of DNA Sequencing An Overview of DNA Sequencing Prokaryotic DNA Plasmid http://en.wikipedia.org/wiki/image:prokaryote_cell_diagram.svg Eukaryotic DNA http://en.wikipedia.org/wiki/image:plant_cell_structure_svg.svg DNA Structure

More information

Molecular Diagnostics in the Clinical Microbiology Laboratory

Molecular Diagnostics in the Clinical Microbiology Laboratory Molecular Diagnostics in the Clinical Microbiology Laboratory Patrick Tang, MD, PhD, FRCPC B.C. Centre for Disease Control University of British Columbia Molecular Diagnostics in the Clinical Microbiology

More information

SEQUENCING. From Sample to Sequence-Ready

SEQUENCING. From Sample to Sequence-Ready SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major

More information

Mitochondrial DNA Analysis

Mitochondrial DNA Analysis Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)

More information

Patent issues in Industrial Biotech:

Patent issues in Industrial Biotech: Patent issues in Industrial Biotech: Nucleic Acids, Life Forms & Natural Products Konrad Sechley PhD, Vancouver, Canada 18 April, 2016 OVERVIEW Gene patenting Life Forms & Natural Products Conclusions

More information

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476

quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of

More information

Next Generation Sequencing: Technology, Mapping, and Analysis

Next Generation Sequencing: Technology, Mapping, and Analysis Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat

Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat Bioinformatique et Séquençage Haut Débit, Discovery and Quantification of RNA with RNASeq Roderic Guigó Serra Centre de Regulació Genòmica (CRG) roderic.guigo@crg.cat 1 RNA Transcription to RNA and subsequent

More information

PrimePCR Assay Validation Report

PrimePCR Assay Validation Report Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene

More information

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità Identification and characterization of Verocytotoxin-producing Escherichia coli (VTEC) by Real Time PCR amplification of the main virulence genes and the genes associated with the serogroups mainly associated

More information

IKDT Laboratory. IKDT as Service Lab (CRO) for Molecular Diagnostics

IKDT Laboratory. IKDT as Service Lab (CRO) for Molecular Diagnostics Page 1 IKDT Laboratory IKDT as Service Lab (CRO) for Molecular Diagnostics IKDT lab offer is complete diagnostic service to all external customers. We could perform as well single procedures or complex

More information

Definition of Minimum Performance Requirements for Analytical Methods of GMO Testing European Network of GMO Laboratories (ENGL)

Definition of Minimum Performance Requirements for Analytical Methods of GMO Testing European Network of GMO Laboratories (ENGL) Definition of Minimum Performance Requirements for Analytical Methods of GMO Testing European Network of GMO Laboratories (ENGL) 13 October 2008 Date of application: 13 April 2009 INTRODUCTION The scope

More information

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR

Technical Note. Roche Applied Science. No. LC 18/2004. Assay Formats for Use in Real-Time PCR Roche Applied Science Technical Note No. LC 18/2004 Purpose of this Note Assay Formats for Use in Real-Time PCR The LightCycler Instrument uses several detection channels to monitor the amplification of

More information