Bioinformatica. Dr. Marco Fondi Lezione # 6. Corso di Laurea in Scienze Biologiche, AA
|
|
|
- Dayna Palmer
- 8 years ago
- Views:
Transcription
1 Bioinformatica Dr. Marco Fondi Lezione # 6 Corso di Laurea in Scienze Biologiche, AA martedì 30 ottobre
2 Sequenziamento ed analisi di genomi: la genomica 2 martedì 30 ottobre 2012
3 martedì 30 ottobre
4 martedì 30 ottobre
5 martedì 30 ottobre 2012
6 martedì 30 ottobre
7 Next Generation Sequencing 454, Roche ABI's SOLiD Method. Solexa, Illumina PACIFIC BIOSCIENCES Desktop Ion torrent 454 GS junior Illumina miseq martedì 30 ottobre 2012
8 martedì 30 ottobre 2012
9
10
11
12 3 Main Technologies Solid
13
14
15 Credit: Illumina
16
17
18
19
20
21
22
23
24
25
26 The development and impact of 454 sequencing Jonathan M Rothberg & John H Leamon Nature Biotechnology 26, (2008) Published online: 9 October 2008 doi: /nbt1485
27
28
29
30 Genome Biol. 2009; 10(3): R32. Published online 2009 March 27. doi: / gb r32. Evaluation of next generation sequencing platforms for population targeted sequencing studies
31
32 Sequencing technologies the next generation Michael L. Metzker Nature Reviews Genetics 11, (January 2010) doi: /nrg2626
33 Storage
34
35
36 Genome Biol. 2010;11(5):207. Epub 2010 May 5. The case for cloud computing in genome informatics.
37
38
39
40
41
42 FASTQ
43 @IL31_4368:1:1:996:8507/2 TCCCTTACCCCCAAGCTCCATACCCTCCTAATGCCCACACCTCTTACCTTAGGA + CAAAAACTTTCACTTTACCTGCCGGGTTTCCCAGTTTACATTCCACTGTTTGAC + GATCTTCTGTGACTGGAAGAAAATGTGTTACATATTACATTTCTGTCCCCATTG + CAGCCTCAGATTCAGCATTCTCAAATTCAGCTGCGGCTGAAACAGCAGCAGGAC + AATGTTCTGAAACCTCTGAGAAAGCAAATATTTATTTTAATGAAAAATCCTTAT + ACATTTACCAAGACCAAAGGAAACTTACCTTGCAAGAATTAGACAGTTCATTTG + CCCACCTCTCTCAATGTTTTCCATATGGCAGGGACTCAGCACAGGTGGATTAAT (...)
44 Solexa/Illumina Read Format The syntax of Solexa/Illumina read format is almost identical to the FASTQ format, but the qualities are scaled differently. Given a character $sq, the following Perl code gives the Phred quality $Q: $Q = 10 * log( ** (ord($sq) - 64) / 10.0)) / log(10);
45
46 martedì 30 ottobre strategy
47 Genomica: le 4 A Genomica: le 4 fasi 1. Assemblaggio 2. Assegnazione 3. Annotazione 4. Analisi (genomica comparativa) venerdì 17 dicembre 2010
48 Genomica: le 4 A Genomica: le 4 fasi 1. Assemblaggio 2. Assegnazione 3. Annotazione 4. Analisi (genomica comparativa) venerdì 17 dicembre 2010
49 genoma 454, Roche ABI's SOLiD Method. Solexa, Illumina venerdì 17 dicembre 2010
50 genoma 454, Roche ABI's SOLiD Method. Solexa, Illumina venerdì 17 dicembre 2010
51 genoma 454, Roche ABI's SOLiD Method. Solexa, Illumina campione venerdì 17 dicembre 2010
52 genoma 454, Roche ABI's SOLiD Method. Solexa, Illumina campione venerdì 17 dicembre 2010
53 454, Roche ABI's SOLiD Method. Solexa, Illumina sequenza genoma venerdì 17 dicembre 2010
54 454, Roche ABI's SOLiD Method. Solexa, Illumina sequenza genoma venerdì 17 dicembre 2010
55 454, Roche ABI's SOLiD Method. Solexa, Illumina reads sequenza genoma venerdì 17 dicembre 2010
56 genome venerdì 17 dicembre 2010
57 genome reads venerdì 17 dicembre 2010
58 genome reads reads assembly contigs A B C venerdì 17 dicembre 2010
59 contigs A B C GAP GAP venerdì 17 dicembre 2010
60 contigs A B C oppure GAP GAP contigs B A C GAP GAP venerdì 17 dicembre 2010
61 contigs A B C oppure GAP GAP contigs B A C GAP GAP oppure... venerdì 17 dicembre 2010
62 GAP closure 1 A B reads venerdì 17 dicembre 2010
63 GAP closure 1 A B reads no overlap? sì A B contig esteso venerdì 17 dicembre 2010
64 GAP closure 2 1. reference genome A B venerdì 17 dicembre 2010
65 GAP closure 2 1. reference genome A B 2. reference genome reads venerdì 17 dicembre 2010
66 GAP closure 2 1. reference genome A B 2. reference genome reads 3. reference genome A contig esteso B venerdì 17 dicembre 2010
67 giovedì 3 novembre 2011
68 draft genome giovedì 3 novembre 2011
69 complete genome draft genome giovedì 3 novembre 2011
70 giovedì 3 novembre 2011
71 giovedì 3 novembre 2011
72 giovedì 3 novembre 2011 Genoma completamente sequenziato
Next Generation Sequencing
Next Generation Sequencing Technology and applications 10/1/2015 Jeroen Van Houdt - Genomics Core - KU Leuven - UZ Leuven 1 Landmarks in DNA sequencing 1953 Discovery of DNA double helix structure 1977
Next Generation Sequencing: Technology, Mapping, and Analysis
Next Generation Sequencing: Technology, Mapping, and Analysis Gary Benson Computer Science, Biology, Bioinformatics Boston University gbenson@bu.edu http://tandem.bu.edu/ The Human Genome Project took
Analysis of ChIP-seq data in Galaxy
Analysis of ChIP-seq data in Galaxy November, 2012 Local copy: https://galaxy.wi.mit.edu/ Joint project between BaRC and IT Main site: http://main.g2.bx.psu.edu/ 1 Font Conventions Bold and blue refers
Dal proge*o genoma umano ad oggi: evoluzione delle tecniche di sequenziamento, analisi genomica e proteomica e prospe9ve future!
Dal proge*o genoma umano ad oggi: evoluzione delle tecniche di sequenziamento, analisi genomica e proteomica e prospe9ve future! David Horner Dipar.mento di Bioscienze Università degli Studi di Milano
Introduction to NGS data analysis
Introduction to NGS data analysis Jeroen F. J. Laros Leiden Genome Technology Center Department of Human Genetics Center for Human and Clinical Genetics Sequencing Illumina platforms Characteristics: High
Next Generation Sequencing; Technologies, applications and data analysis
; Technologies, applications and data analysis Course 2542 Dr. Martie C.M. Verschuren Research group Analysis techniques in Life Science, Breda Prof. dr. Johan T. den Dunnen Leiden Genome Technology Center,
Introduction to next-generation sequencing data
Introduction to next-generation sequencing data David Simpson Centre for Experimental Medicine Queens University Belfast http://www.qub.ac.uk/research-centres/cem/ Outline History of DNA sequencing NGS
Genetic Analysis. Phenotype analysis: biological-biochemical analysis. Genotype analysis: molecular and physical analysis
Genetic Analysis Phenotype analysis: biological-biochemical analysis Behaviour under specific environmental conditions Behaviour of specific genetic configurations Behaviour of progeny in crosses - Genotype
Nazneen Aziz, PhD. Director, Molecular Medicine Transformation Program Office
2013 Laboratory Accreditation Program Audioconferences and Webinars Implementing Next Generation Sequencing (NGS) as a Clinical Tool in the Laboratory Nazneen Aziz, PhD Director, Molecular Medicine Transformation
ITALIANO SCIENZE MOTORIE MATEMATICA ITALIANO STORIA+GEOGR MATEMATICA MATEMATICA REL+ALT. ARTE E IMMAGINE ARTE E IMMAGINE TECNOLOGIA
Scuola Secondaria di 1 grado "Giuseppe PESCETTI" Sesto Fiorentino 26/02/2007 10.18.11 Pag. 1 LUNEDI ITALIANO SCIENZE MOTORIE MATEMATICA ITALIANO STORIA+GEOGR MATEMATICA MATEMATICA REL+ALT. ARTE E IMMAGINE
July 7th 2009 DNA sequencing
July 7th 2009 DNA sequencing Overview Sequencing technologies Sequencing strategies Sample preparation Sequencing instruments at MPI EVA 2 x 5 x ABI 3730/3730xl 454 FLX Titanium Illumina Genome Analyzer
Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center
Computational Challenges in Storage, Analysis and Interpretation of Next-Generation Sequencing Data Shouguo Gao Ph. D Department of Physics and Comprehensive Diabetes Center Next Generation Sequencing
Next generation sequencing (NGS)
Next generation sequencing (NGS) Vijayachitra Modhukur BIIT modhukur@ut.ee 1 Bioinformatics course 11/13/12 Sequencing 2 Bioinformatics course 11/13/12 Microarrays vs NGS Sequences do not need to be known
Cloud Computing Solutions for Genomics Across Geographic, Institutional and Economic Barriers
Cloud Computing Solutions for Genomics Across Geographic, Institutional and Economic Barriers Ntinos Krampis Asst. Professor J. Craig Venter Institute kkrampis@jcvi.org http://www.jcvi.org/cms/about/bios/kkrampis/
Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community
Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community Ntinos Krampis Asst. Professor J. Craig Venter Institute kkrampis@jcvi.org http://www.jcvi.org/cms/about/bios/kkrampis/
Automated DNA sequencing 20/12/2009. Next Generation Sequencing
DNA sequencing the beginnings Ghent University (Fiers et al) pioneers sequencing first complete gene (1972) first complete genome (1976) Next Generation Sequencing Fred Sanger develops dideoxy sequencing
Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community
Cloud BioLinux: Pre-configured and On-demand Bioinformatics Computing for the Genomics Community Ntinos Krampis Asst. Professor J. Craig Venter Institute kkrampis@jcvi.org http://www.jcvi.org/cms/about/bios/kkrampis/
BIG DATA BIG DATA 8/1/12. Cool Informa+cs Tools and Services for Biomedical Research. David Ruau, PhD. August 1 st, 2012
Cool Informa+cs Tools and Services for Biomedical Research David Ruau, PhD. August 1 st, 2012 @druau Sponsored by the Office of Postdoctoral Affairs and the Lane Medical Library BIG DATA BIG DATA 1 Big
Tutorial for Windows and Macintosh. Preparing Your Data for NGS Alignment
Tutorial for Windows and Macintosh Preparing Your Data for NGS Alignment 2015 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) 1.734.769.7249
Next Generation Sequencing; Technologies, applications and data analysis
; Technologies, applications and data analysis Course 2542 Dr. Martie C.M. Verschuren Research group Analysis techniques in Life Science, Breda Prof. dr. Johan T. den Dunnen Leiden Genome Technology Center,
MiSeq: Imaging and Base Calling
MiSeq: Imaging and Page Welcome Navigation Presenter Introduction MiSeq Sequencing Workflow Narration Welcome to MiSeq: Imaging and. This course takes 35 minutes to complete. Click Next to continue. Please
NGS data analysis. Bernardo J. Clavijo
NGS data analysis Bernardo J. Clavijo 1 A brief history of DNA sequencing 1953 double helix structure, Watson & Crick! 1977 rapid DNA sequencing, Sanger! 1977 first full (5k) genome bacteriophage Phi X!
Computational Genomics. Next generation sequencing (NGS)
Computational Genomics Next generation sequencing (NGS) Sequencing technology defies Moore s law Nature Methods 2011 Log 10 (price) Sequencing the Human Genome 2001: Human Genome Project 2.7G$, 11 years
Curriculum Vitae et Studiorum
Curriculum Vitae et Studiorum Personal information Name and Surname: Marco Fondi Born in Pistoia, Italy, September 9 th 1980 Home Address: Via de Vanni 9a, 50142 Florence (FI) Home tel.: 055-0113824 Office
How Sequencing Experiments Fail
How Sequencing Experiments Fail v1.0 Simon Andrews simon.andrews@babraham.ac.uk Classes of Failure Technical Tracking Library Contamination Biological Interpretation Something went wrong with a machine
Deep Sequencing Data Analysis
Deep Sequencing Data Analysis Ross Whetten Professor Forestry & Environmental Resources Background Who am I, and why am I teaching this topic? I am not an expert in bioinformatics I started as a biologist
Lezione Xl-Xll giovedì 27-X-2011
Lezione Xl-Xll giovedì 27-X-2011 corso di genomica laurea magistrale Biotecnologia Industriale aula 8 orario : Martedì ore 14.00-16.00 Giovedì ore 13.00-15.00 non ci sarà lezione martedì 1 e giovedì 3
A Complete Example of Next- Gen DNA Sequencing Read Alignment. Presentation Title Goes Here
A Complete Example of Next- Gen DNA Sequencing Read Alignment Presentation Title Goes Here 1 FASTQ Format: The de- facto file format for sharing sequence read data Sequence and a per- base quality score
Next Generation Sequencing; Technologies, applications and data analysis
; Technologies, applications and data analysis Course 2542 Dr. Martie C.M. Verschuren Research group Analysis techniques in Life Science, Breda Prof. dr. Johan T. den Dunnen Leiden Genome Technology Center,
Concepts and methods in sequencing and genome assembly
BCM-2004 Concepts and methods in sequencing and genome assembly B. Franz LANG, Département de Biochimie Bureau: H307-15 Courrier électronique: Franz.Lang@Umontreal.ca Outline 1. Concepts in DNA and RNA
DNA Sequencing & The Human Genome Project
DNA Sequencing & The Human Genome Project An Endeavor Revolutionizing Modern Biology Jutta Marzillier, Ph.D Lehigh University Biological Sciences November 13 th, 2013 Guess, who turned 60 earlier this
Automated and Scalable Data Management System for Genome Sequencing Data
Automated and Scalable Data Management System for Genome Sequencing Data Michael Mueller NIHR Imperial BRC Informatics Facility Faculty of Medicine Hammersmith Hospital Campus Continuously falling costs
Putting Genomes in the Cloud with WOS TM. ddn.com. DDN Whitepaper. Making data sharing faster, easier and more scalable
DDN Whitepaper Putting Genomes in the Cloud with WOS TM Making data sharing faster, easier and more scalable Table of Contents Cloud Computing 3 Build vs. Rent 4 Why WOS Fits the Cloud 4 Storing Sequences
Statistics Jobs. La mia esperienza nell industria farmaceutica Silvia Barbi, Statistician at Novartis Vaccines Bologna, 9 Maggio 2014
Statistics Jobs La mia esperienza nell industria farmaceutica Silvia Barbi, Statistician at Novartis Vaccines Bologna, 9 Maggio 2014 Formazione ed esperienze accademiche Laurea triennale in Statistica
Laboratorio di Bioinformatica
Laboratorio di Bioinformatica Lezione #2 Dr. Marco Fondi Contact: marco.fondi@unifi.it www.unifi.it/dblemm/ tel. 0552288308 Dip.to di Biologia Evoluzionistica Laboratorio di Evoluzione Microbica e Molecolare,
NGS Technologies for Genomics and Transcriptomics
NGS Technologies for Genomics and Transcriptomics Massimo Delledonne Department of Biotechnologies - University of Verona http://profs.sci.univr.it/delledonne 13 years and $3 billion required for the Human
DNA Sequencing and Personalised Medicine
DNA Sequencing and Personalised Medicine Mick Watson Director of ARK-Genomics The Roslin Institute PERSONALISED MEDICINE What is personalised medicine? Personalized Medicine refers to the tailoring of
Next generation DNA sequencing technologies. theory & prac-ce
Next generation DNA sequencing technologies theory & prac-ce Outline Next- Genera-on sequencing (NGS) technologies overview NGS applica-ons NGS workflow: data collec-on and processing the exome sequencing
Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms
Data Processing of Nextera Mate Pair Reads on Illumina Sequencing Platforms Introduction Mate pair sequencing enables the generation of libraries with insert sizes in the range of several kilobases (Kb).
Submission Schedule for Descriptive/Raw Data
Research Domain Criteria Database (RDoCdb) Data Sharing Policy 8/7/2014 i. Data Sharing Overview All de-identified data resulting from this NIH-funded research involving human subjects are expected to
SRA File Formats Guide
SRA File Formats Guide Version 1.1 10 Mar 2010 National Center for Biotechnology Information National Library of Medicine EMBL European Bioinformatics Institute DNA Databank of Japan 1 Contents SRA File
Using Galaxy for NGS Analysis. Daniel Blankenberg Postdoctoral Research Associate The Galaxy Team http://usegalaxy.org
Using Galaxy for NGS Analysis Daniel Blankenberg Postdoctoral Research Associate The Galaxy Team http://usegalaxy.org Overview NGS Data Galaxy tools for NGS Data Galaxy for Sequencing Facilities Overview
STANFORD UNIVERSITY LANGUAGE CENTER ITALLANG 5C First Year Intensive Italian - 3rd Quarter - Summer 2012
STANFORD UNIVERSITY LANGUAGE CENTER ITALLANG 5C First Year Intensive Italian - 3rd Quarter - Summer 2012 Instructor: Katia Pansa E-mail: kpansa@stanford.edu Office Hours: TEXTBOOK AND ANCILLARY MATERIAL:
Genome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009
Genome and DNA Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Admin Reading: Chapters 1 & 2 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring09/bme110-calendar.html
Metodologie di sequenziamemento
Metodologie di sequenziamemento di DNA ed RNA Metzker et al. 2010. Sequencing technologies the next generation. Nature Reviews Genetics, vol. 11, p. 31 Stranneheim and Lundeberg 2012. Stepping stones in
STANFORD UNIVERSITY LANGUAGE CENTER ITALLANG 5A
STANFORD UNIVERSITY LANGUAGE CENTER ITALLANG 5A First Year Intensive Italian 1 st Quarter Summer 2012; June 25 / July 12 MTWThF 9:00am-12:50pm Instructor: Giovanni Tempesta Email: tempesta@stanford.edu
Workshop Rapid NGS for Public Health Microbiology
Medical Microbial Genomics Centre Workshop Rapid NGS for Public Health Microbiology March 4 th 8 th, 2013; Univ. Münster Sponsors In co-operation with MMGC 2013 1 Objectives and Organization Objectives
De Novo Assembly Using Illumina Reads
De Novo Assembly Using Illumina Reads High quality de novo sequence assembly using Illumina Genome Analyzer reads is possible today using publicly available short-read assemblers. Here we summarize the
Welcome to the Plant Breeding and Genomics Webinar Series
Welcome to the Plant Breeding and Genomics Webinar Series Today s Presenter: Dr. Candice Hansey Presentation: http://www.extension.org/pages/ 60428 Host: Heather Merk Technical Production: John McQueen
Prepare the environment Practical Part 1.1
Prepare the environment Practical Part 1.1 The first exercise should get you comfortable with the computer environment. I am going to assume that either you have some minimal experience with command line
Geospiza s Finch-Server: A Complete Data Management System for DNA Sequencing
KOO10 5/31/04 12:17 PM Page 131 10 Geospiza s Finch-Server: A Complete Data Management System for DNA Sequencing Sandra Porter, Joe Slagel, and Todd Smith Geospiza, Inc., Seattle, WA Introduction The increased
Master in Diagnostica avanzata per i Beni Culturali I livello Anno accademico:
There are no translations available. Master in Diagnostica avanzata per i Beni Culturali I livello Anno accademico: 2009-2010 Codice 8358 Livello Primo Sede Ravenna Facoltà/struttura Scienze Matematiche
Issues in Data Storage and Data Management in Large- Scale Next-Gen Sequencing
Issues in Data Storage and Data Management in Large- Scale Next-Gen Sequencing Matthew Trunnell Manager, Research Computing Broad Institute Overview The Broad Institute Major challenges Current data workflow
Comparison of Sequence Reads Obtained from Three Next-Generation Sequencing Platforms
Comparison of Sequence Reads Obtained from Three Next-Generation Sequencing latforms Shingo Suzuki 1., Naoaki Ono 1., Chikara Furusawa 1, Bei-Wen Ying 1, Tetsuya Yomo 1,2,3 * 1 Department of Bioinformatics
Addressing the Black Box Phenomenon of Genome Sequencing and Assembly
James Madison University JMU Scholarly Commons Senior Honors Projects Undergraduate Research Spring 2015 Addressing the Black Box Phenomenon of Genome Sequencing and Assembly Brandon Carter James Madison
Decode File Client User Guide
Contents Decode File Client User Guide Contents... 1 Notice... 2 Getting Started... 3 Workflow Overview... 3 Preliminary Steps... 3 Using the Decode File Client in Access by Account Mode... 3 Using the
SEQUENCING. From Sample to Sequence-Ready
SEQUENCING From Sample to Sequence-Ready ACCESS ARRAY SYSTEM HIGH-QUALITY LIBRARIES, NOT ONCE, BUT EVERY TIME The highest-quality amplicons more sensitive, accurate, and specific Full support for all major
High Performance Compu2ng Facility
High Performance Compu2ng Facility Center for Health Informa2cs and Bioinforma2cs Accelera2ng Scien2fic Discovery and Innova2on in Biomedical Research at NYULMC through Advanced Compu2ng Efstra'os Efstathiadis,
UCLA Team Sequences Cell Line, Puts Open Source Software Framework into Production
Page 1 of 6 UCLA Team Sequences Cell Line, Puts Open Source Software Framework into Production February 05, 2010 Newsletter: BioInform BioInform - February 5, 2010 By Vivien Marx Scientists at the department
Q&A: Kevin Shianna on Ramping up Sequencing for the New York Genome Center
Q&A: Kevin Shianna on Ramping up Sequencing for the New York Genome Center Name: Kevin Shianna Age: 39 Position: Senior vice president, sequencing operations, New York Genome Center, since July 2012 Experience
Version 5.0 Release Notes
Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com
A Hitchhiker s Guide to Next-Generation Sequencing
A Hitchhiker s Guide to Next-Generation Sequencing by Gabe Rudy, VP of Product Development If you have had any experience with Golden Helix, you know we are not a company to shy away from a challenge.
Working with AppleScript
Tutorial for Macintosh Working with AppleScript 2016 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074
Lectures 1 and 8 15. February 7, 2013. Genomics 2012: Repetitorium. Peter N Robinson. VL1: Next- Generation Sequencing. VL8 9: Variant Calling
Lectures 1 and 8 15 February 7, 2013 This is a review of the material from lectures 1 and 8 14. Note that the material from lecture 15 is not relevant for the final exam. Today we will go over the material
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
Searching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
RNAseq / ChipSeq / Methylseq and personalized genomics
RNAseq / ChipSeq / Methylseq and personalized genomics 7711 Lecture Subhajyo) De, PhD Division of Biomedical Informa)cs and Personalized Biomedicine, Department of Medicine University of Colorado School
Basic processing of next-generation sequencing (NGS) data
Basic processing of next-generation sequencing (NGS) data Getting from raw sequence data to expression analysis! 1 Reminder: we are measuring expression of protein coding genes by transcript abundance
NECC History. Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011
NECC History Karl V. Steiner 2011 Annual NECC Meeting, Orono, Maine March 15, 2011 EPSCoR Cyberinfrastructure Workshop First regional NENI (now NECC) Workshop held in Vermont in August 2007 Workshop heldinkentucky
The NGS IT notes. George Magklaras PhD RHCE
The NGS IT notes George Magklaras PhD RHCE Biotechnology Center of Oslo & The Norwegian Center of Molecular Medicine University of Oslo, Norway http://www.biotek.uio.no http://www.ncmm.uio.no http://www.no.embnet.org
Overview sequence projects
Overview sequence projects Bioassist NGS meeting 15-01-2010 Barbera van Schaik KEBB - Bioinformatics Laboratory b.d.vanschaik@amc.uva.nl NGS at the Academic Medical Center Sequence facility Laboratory
Bacterial Next Generation Sequencing - nur mehr Daten oder auch mehr Wissen? Dag Harmsen Univ. Münster, Germany dharmsen@uni-muenster.
Bacterial Next Generation Sequencing - nur mehr Daten oder auch mehr Wissen? Dag Harmsen Univ. Münster, Germany dharmsen@uni-muenster.de Commercial Disclosure Dag Harmsen is co-founder and partial owner
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
Lezione 10 Introduzione a OPNET
Corso di A.A. 2007-2008 Lezione 10 Introduzione a OPNET Ing. Marco GALEAZZI 1 What is OPNET? Con il nome OPNET viene indicata una suite di prodotti software sviluppati e commercializzati da OPNET Technologies,
How To Understand The Science Of Genomics
Curs Bioinformática. Grau Genética GENÓMICA INTRODUCTION TO GENOME SCIENCE Antonio Barbadilla Group Genomics, Bioinformatics & Evolution Institut Biotecnologia I Biomedicina Departament de Genètica i Microbiologia
Microbial Oceanomics using High-Throughput DNA Sequencing
Microbial Oceanomics using High-Throughput DNA Sequencing Ramiro Logares Institute of Marine Sciences, CSIC, Barcelona 9th RES Users'Conference 23 September 2015 Importance of microbes in the sunlit ocean
Worldwide Collaborations in Molecular Profiling
Worldwide Collaborations in Molecular Profiling Lillian L. Siu, MD Director, Phase I Program and Cancer Genomics Program Princess Margaret Cancer Centre Lillian Siu, MD Contracted Research: Novartis, Pfizer,
Roberto Ciccone, Orsetta Zuffardi Università di Pavia
Roberto Ciccone, Orsetta Zuffardi Università di Pavia XIII Corso di Formazione Malformazioni Congenite dalla Diagnosi Prenatale alla Terapia Postnatale unipv.eu Carrara, 24 ottobre 2014 Legend:Bluebars
Importance of Statistics in creating high dimensional data
Importance of Statistics in creating high dimensional data Hemant K. Tiwari, PhD Section on Statistical Genetics Department of Biostatistics University of Alabama at Birmingham History of Genomic Data
Analysis of NGS Data
Analysis of NGS Data Introduction and Basics Folie: 1 Overview of Analysis Workflow Images Basecalling Sequences denovo - Sequencing Assembly Annotation Resequencing Alignments Comparison to reference
Genotyping by sequencing and data analysis. Ross Whetten North Carolina State University
Genotyping by sequencing and data analysis Ross Whetten North Carolina State University Stein (2010) Genome Biology 11:207 More New Technology on the Horizon Genotyping By Sequencing Timeline 2007 Complexity
Mattia Casotti CURRICULUM VITAE
Mattia Casotti CURRICULUM VITAE 09/03/1987 Via Tago 8, Reggio Emilia 328/3096327 mattiaimba@gmail.com cargocollective.com/mattiacasotti vimeo.com/mattiacasotti EDUCATION AND TRAINING 10/2012-10/2014 MA
MSc on Applied Computer Science
MSc on Applied Computer Science (Majors in Security and Computational Biology) Amílcar Sernadas, Ana Teresa Freitas, Arlindo Oliveira, Isabel Sá Correia May 18, 2006 1 Context The new model for high education
ITL 101-2C Introductory Italian I Fall 2015
UNIVERSITY OF ALABAMA AT BIRMINGHAM College of Arts and Sciences Department of Foreign Languages and Literatures ITL 101-2C Introductory Italian I Fall 2015 Instructor: Giuliana Russo Skinner, MAE Office
Big data in cancer research : DNA sequencing and personalised medicine
Big in cancer research : DNA sequencing and personalised medicine Philippe Hupé Conférence BIGDATA 04/04/2013 1 - Titre de la présentation - nom du département émetteur et/ ou rédacteur - 00/00/2005 Deciphering
4.2.1. What is a contig? 4.2.2. What are the contig assembly programs?
Table of Contents 4.1. DNA Sequencing 4.1.1. Trace Viewer in GCG SeqLab Table. Box. Select the editor mode in the SeqLab main window. Import sequencer trace files from the File menu. Select the trace files
Bioruptor NGS: Unbiased DNA shearing for Next-Generation Sequencing
STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAACT GTGCACT GTGAACT STGAAC STGAAC GTGCAC GTGAAC Wouter Coppieters Head of the genomics core facility GIGA center, University of Liège Bioruptor NGS: Unbiased DNA
Computational infrastructure for NGS data analysis. José Carbonell Caballero Pablo Escobar
Computational infrastructure for NGS data analysis José Carbonell Caballero Pablo Escobar Computational infrastructure for NGS Cluster definition: A computer cluster is a group of linked computers, working
Keeping up with DNA technologies
Keeping up with DNA technologies Mihai Pop Department of Computer Science Center for Bioinformatics and Computational Biology University of Maryland, College Park The evolution of DNA sequencing Since
DAY 1 THURSDAY 25 JUNE I GIORNATA GIOVEDÌ 25 GIUGNO
OUT SPIN WEDNESDAY 24 JUNE, EVENING OUT SPIN MERCOLEDÌ 24 GIUGNO, SERA WELCOME COCKTAIL ON THE BEACH OF THE SHERATON HOTEL & CONFERENCE CENTER COCKTAIL DI BENVENUTO SULLA SPIAGGIA DELLO SHERATON DAY 1
HPC-MAQ : A PARALLEL SHORT-READ REFERENCE ASSEMBLER
HPC-MAQ : A PARALLEL SHORT-READ REFERENCE ASSEMBLER Veeram Venkata Siva Prasad 1 and Gunisetti Loshma 2 1 M.Tech(CSE), Sri Vasavi Engineering college, Tadepalligudem, West Godavari District, Andhra Pradesh,
PROGRAMME SPECIFICATION
PROGRAMME SPECIFICATION 1 Awarding Institution: University of Exeter 2 School(s)/Teaching Institution: School of Biosciences 3 Programme accredited/validated by: 4 Final Award(s): MSc Medical Informatics
High Throughput Sequencing Data Analysis using Cloud Computing
High Throughput Sequencing Data Analysis using Cloud Computing Stéphane Le Crom (stephane.le_crom@upmc.fr) LBD - Université Pierre et Marie Curie (UPMC) Institut de Biologie de l École normale supérieure
Nota: Test campione in vigore dalla sessione d'esami giugno- luglio 2012
Nota: Test campione in vigore dalla sessione d'esami giugno- luglio 2012 UNIVERSITA DEGLI STUDI DI URBINO CARLO BO Centro Linguistico d'ateneo Facoltà di Scienze Motorie Test Campione N 1 Accertamento
Bioinformatics and its applications
Bioinformatics and its applications Alla L Lapidus, Ph.D. SPbAU, SPbSU, St. Petersburg Term Bioinformatics Term Bioinformatics was invented by Paulien Hogeweg (Полина Хогевег) and Ben Hesper in 1970 as
Specialty Lab Informatics and its role in a large academic medical center
Specialty Lab Informatics and its role in a large academic medical center Zoltan N. Oltvai, M.D. Associate Professor Department of Pathology University of Pittsburgh Disclosures I have no financial interest,
How long is long enough?
How long is long enough? - Modeling to predict genome assembly performance - Hayan Lee@Schatz Lab Feb 26, 2014 Quantitative Biology Seminar 1 Outline Background Assembly history Recent sequencing technology
Practical Guideline for Whole Genome Sequencing
Practical Guideline for Whole Genome Sequencing Disclosure Kwangsik Nho Assistant Professor Center for Neuroimaging Department of Radiology and Imaging Sciences Center for Computational Biology and Bioinformatics
NEXT GENERATION SEQUENCING
NEXT GENERATION SEQUENCING Dr. R. Piazza SANGER SEQUENCING + DNA NEXT GENERATION SEQUENCING Flowcell NEXT GENERATION SEQUENCING Library di DNA Genomic DNA NEXT GENERATION SEQUENCING NEXT GENERATION SEQUENCING
How To Write An Open Source Software Project
Tecnologie open-source Docente: Dott. Ing. Luigi Bellio E-mail: bellio@math.unipd.it Web: http://www.math.unipd.it/~bellio/ Crediti: 6 crediti formativi 40 ore di lezione, 16 ore di laboratorio Orario: