Standard DNA Sequencing Services Standard DNA Sequencing Services Standard DNA Sequencing Services BIO BASIC INC.
|
|
|
- Noah Lawson
- 9 years ago
- Views:
Transcription
1 1 344 BIO BASIC INC.
2 BBI STANDARD DNA SEQUENCING SERVICES Catalogue With over 10 years of experience, Bio Basic Inc. is a leader in offering single and high-throughput DNA sequencing services. All DNA sequencing is performed within our own facility using state-of-the-art technologies and informatics. Key Features Incoming sample QC Fluorescent dye-terminator sequencing ABI Prism 3730xl DNA sequencers >650bp Q20 read lengths typical Universal primers provided at no additional charge (complete list below) Template preparation and primer synthesis available Services & Prices Samples Quantity Price USD Additional charge (USD) Purified Plasmids Purified PCR Products Bacterial Stabs Culture Crude PCR Products Primer synthesis 1-9 reactions > reactions > reactions > 500 $ 5.00 $ 4.80 $ 4.50 Inquire $ 5.00 $ 4.80 $ 4.50 Inquire $ 5.00 $ 4.80 $ 4.50 Inquire $ 0.19/base Purification: $0.60 Purification: $0.60 Purification: $0.60 Purification: $0.60 Purification: $1.00 Purification: $1.00 Purification: $1.00 Purification: $1.00 For long term or bulk project, please inquire about our bulk pricing. Purified plasmid DNA: Purified plasmid DNA: Plasmids should be purified usinga qualified Plasmid DNA Purification Kit. Quantity:The sample volume should be at least 20 μl in dd-water, at a desired concentration of 100 ng/μl to 200 ng/μl. TE is not recommended to dissolve the DNA samples. Bacterial: (1) LB stabs (2) 1 ml of overnight culture containing 15% glycerol te: A. Low copy bacteria stabs or culture are not acceptable. Please send 10 μg of purified plasmid DNA. B. Please provide all necessary information including insert size, antibiotic resistance. Purified PCR products: PCR products should be purified by qualified PCR Products Purification Kits. Purity: one band should appear on agarose gel. Sample volume should be around μl in dd-water at a desired concentration of 30 ng/μl or higher. Crude PCR products: at least 50 μl of non-purified PCR product must be provided for purification at a desired concentration of 30 ng/μl or higher. Primers: We provide many universal primers at no additional charge (see list as below). If the primers for your sequencing reactions are not included in the list, you will need to provide the primer. Alternatively, Bio Basic Inc. can synthesize the primer for you at an additional cost. Concentration of primers: >5 pmole/μl (20-50 μl). Chain length of the primer should be more than 15 bases, but no longer than 50 bases. Random primers are not accepted as sequencing primers. DNA sequence and annealing temperature should be provided by the customer for primer. Results: Sequence chromatogram files will be sent to customer electronically as well as the.txt file of the DNA sequence. We also provide PDF alignment file upon request. Turnaround: ~24 hr to 48 hr. For bulk orders, please inquire. 345
3 Placing Your Order ONLINE: You may order Bio Basic Inc's DNA Sequencing Service online through our website, by filling out the Online Order Form. Options are available for submitting one to hundreds of samples. DOWNLOAD and You may download an excel Sequencing Order Form from and it to and We offer easy payments options via purchase order number and/or credit card (Visa and MasterCard only). After your order is approved, please send samples to Bio Basic Inc. or our distributor in your country. Bio Basic Inc. offers FREE pick ups for > 100 samples within Canada/USA. If there is no distributor in your country, you may contact a distributor near your country or Bio Basic Inc. directly. 1Contact Us Phone or Fax Web Mail Samples Universal Primers Universal Primer M13 Forward [email protected] [email protected] 20 Konrad Crescent, Markham, ON, L3R 8T4 Canada Free Shipping if >100 Samples (Canada/USA only) Sequence GTAAAACGACGGCCAGT M13 Reverse pgex 3' pgex 5' SP6 T3 T7 (short) T7 (long) T7 terminator CAGGAAACAGCTATGAC CCGGGAGCTGCATGTGTCAGAGG GGGCTGGCAAGCCACGTTTGGTG ATTTAGGTGACACTATA ATTAACCCTCACTAAAG AATACGACTCACTATAG AATACGACTCACTATAGgg GCTAGTTATTGCTCAGCGGT 346 BIO BASIC INC.
4 Sequencing Reports BBI Catalogue 1.Sequencing report Format (1) Original ABI format of ~700 bp sequencing chromatogram (2) Text file of the DNA Sequence (3) Summary of Report (4) All results are sent electronically 2. View results (1) Download Chromas from (2) Double click Chromas and open ABI file from Chromas (3) Export text file from Chromas (4) Sequences between 60 bp to 500 bp are most reliable region. To obtain reliable reads, it is highly recommended to perform double stranded sequencing using reverse primers as a good laboratory practice. 3. report (1) Samples fail to pass incoming QC (2) Sample with no readable signal 4.Charges on sequences with structures Standard charge applies even if sequences are not clear due to known structures including Poly N,GC,inverted repeats direct repeats etc. 5.Charges on mixed peaks Most mixed peaks are results from mixed templates (see below Q&A). Standard charge applies. 6.Sample Storage All samples are kept at Bio Basic Inc. for 2 months. During this period, customer may request additional sequencing service. After 2 months, the samples are automatically destroyed without further notification. 347
5 Check List Before Sending Samples Template Requirements Crude PCR Products 1. PCR product > 200 bp 2. Concentration of PCR product should be >30 ng/μl and volume 1 μg-2 μg. 3. Take 2-3 μl samples, a single band of final PCR product should be detected on gel. 4. Specific primers are to be provided by customer. 5. To avoid cross contaminations during shipment, please make sure you use a tight-fit lid when shipping samples in 96-well format. Alternatively, samples can be delivered in 8-strip PCR tubes. 1 Purified PCR Product Purified Plasmid DNA Bacteria 1. Dissolve final PCR product in ddh 2 O ( Please do not use TE). 2. Concentration of PCR product should be >30 ng/μl and volume >10 μl. For PCR product >2 kb, more DNA may be required for sequencing. 3. A single distinct band of final PCR product should be detected on gel. If smearing or multiple bands are seen, you may receive poor or no readable sequencing data. 4. Specific primers are to be provided by customer. 5. To avoid cross contaminations during shipment, please make sure you use a tight-fit lid when shipping samples in 96-well format. Alternatively, samples can be delivered in 8-strip PCR tubes. 1. Dissolve purified plasmid DNA in 30~50 μl ddh 2 O (Please do not use TE). 2. Concentration of plasmid should be > ng/μl; 3. It is recommended to use molecular biology kit to purify plasmid DNA rather than ethanol precipitation. 4. Specific primers are to be provided by customer. 5. To avoid cross contaminations during shipment, please make sure you use a tight-fit lid when shipping samples in 96-well format. Alternatively, samples can be delivered in 8-strip PCR tubes. 1. Please indicate antibiotic resistance for desired bacteria strain. Bio Basic Inc. offers services of DNA extraction from Amp, Kan, Tet and Chl. All other antibiotics are to be provided by customer with instruction manuals. 2. Bio Basic Inc offers DNA extraction from high copy plasmid. For low copy plasmid bacteria, please send ~10 μg purified DNA. 3. Please provide 1 ml overnight culture or 15% glycerol stock. Please send bacterial samples in individual Eppendorft tubes with openings securely sealed. 4. For large sample size, we recommend Ecoli stab in 96-well plate. This is to avoid cross contamination between samples during shipment. Specific Primers 1. Concentration of primers should be >5 pmol/μl( or 5 μmol/l) and volume > μl. Please mark primer concentration clearly. 2. Random primers and/or primers <15 bases cannot be used for sequencing. 3. Please provide sequences of primers so that Tm could be known for condition optimization. Universal Primers M13 Forward, M13 Reverse, pgex 3, pgex 5, T7promoter, T7 terminator, SP6, T3 are primers provided at FREE of charge. If your primers are not in the above list, please ship primers along with your sample(s). Alternatively, Bio Basic Inc. can synthesize the oligos for you at $0.19 per base. Please refer to Oligo Synthesis. 348 BIO BASIC INC.
6 What is DNA Sequencing BBI Catalogue The term DNA sequencing encompasses biochemical methods for determining the order of the nucleotide bases, adenine, guanine, cytosine, and thymine, in a DNA oligonucleotide. The sequence of DNA constitutes the heritable genetic information in nuclei, plasmids, mitochondria, and chloroplasts that forms the basis for the developmental programs of all living organisms. Determining the DNA sequence is therefore useful in basic research for studying fundamental biological processes, as well as in applied fields such as diagnostic or forensic research. The advent of DNA sequencing has significantly accelerated biological research and discovery. The rapid speed of sequencing attained with modern DNA sequencing technology has been instrumental in the large-scale sequencing of the human genome, in the Human Genome Project. Related projects, often by scientific collaboration across continents, have generated the complete DNA sequences of many animal, plant, and microbial genomes. Frequent Questions and Answers A:We would need you to first clearly tell us at which position is unclear to you and then we would go case by case. If it is from Bio Basic Inc. s processing Q:In one of the region, the sequencing was not clear. Could I request Bio Basic Inc. to sequence again? problem, we will initiate a no-charge repeat immediately. Q:I lost all data, could you send me another copy? A:Yes. However, please note, all sequencing results are kept for a period of 6 months. Samples are kept at Bio Basic Inc. for 1-2months. Q:I have a 4kb PCR fragments, can Bio Basic Inc. sequence through the full length? A:For PCR >2 kb, we recommend to first sub-clone it into a vector. The insert is more stable in a vector and sequencing results will be easier to achieve. Q:I have a mixed base pair in a position, how come I do not see the mixed base in the report? A:When preparing the report, Bio Basic Inc. assumes sequencing sample is from a pure single population rather than mixed. Based on this assumption, the higher/stronger peak is being reported and lower/weaker peak being treated as background. If your sample contains a mixed population, please kindly notify us. Q:The bands are present and strong, but irregularly spaced, or with mixed colors. The technician may have reported "superimposed sequences" or used the phrase "peaks on peaks"? A: If you see this, you usually have two sequences superimposed on other. There are several common causes: The sequencing primer binds to two (or more) sites on the template. There are two (or more) templates present. This was a PCR reaction, and you didn't remove the original primers. This was a PCR reaction, and one primer generated *both* ends. This was a PCR reaction, and there is more than one amplified species present. Here's an example of 'mixed peaks' such as might arise from two or more unrelated templates: 349
7 Another example, this time with templates that might be related. te the alignment of the peaks: 1Q:Your sequence proceeds normally, then the bands abruptly become much smaller Secondary structure in the template is the most likely cause of this problem. The polymerase is presumably unable to progress through some stem-loop form. A couple possible solutions: (i) try re-sequencing by selecting 'sirna construct' as your DNA type, (ii) try to sequence from another primer at a different position (closer or further); (iii) sequence the other strand. We maybe able to use special cycling conditions and/or special reagents that help the polymerase to push through this region. We cannot do this routinely, as it involves extensive optimizations. Here's an example of a secondary structure effect: Q: Your sequence proceeds normally, then the bands abruptly vanish. This usually happens when the template DNA has simply stopped, for example if it was restricted at a downstream site or if the template was a PCR product. This may also be caused by an extremely stable secondary structure. Q: The sequence looks great until it hits a polya (or polyt), and then the bands rise and fall in waves. This is called "polymerase slip". It happens when the growing strand temporarily dissociates from the template, then re-associates at a different spot - say, one nucleotide forward or back from where it started. If this happens often enough (as it will on polya or polyt templates), every individual band becomes a family of closely-spaced peaks giving a 'roller coaster' look to the chromatogram. Try sequencing in the other direction from the opposite strand, or try another primer either closer or further from the homopolymer region. The following is an excellent example of 'polymerase slip' on a homopolymeric tract: Q:You offer 24hr to 48hr service, but it has been 2 days and I still have not received data? A:24 hr to 48 hr is AFTER we receive the samples at Bio Basic Inc. If you have more than 5 plates, longer turnaround is expected. 350 BIO BASIC INC.
8 BBI Catalogue Terms and Conditions Terms Bio Basic Inc. will send electronically DNA sequencing results to customers. All results will be kept in Bio Basic Inc. s data base for 6 months. During this period, customer may request sequencing results. After 6 months, DNA sequencing results are automatically destroyed without further notification. DNA sequencing tests are not considered confirmed without the customer providing a P.O. number or credit card number. Bio Basic Inc. accepts credit card (Visa or MasterCard), cheque or wire for payment. Turnaround Bio Basic Inc. will make its best effort to send DNA sequencing results within 48 hours. For Larger projects, time will vary depending on the size of the project. We try our best to accommodate special time constraints whenever possible, and projects of more than one hundred reactions may still get hours turn around. Mail-in samples need to be received before noon time to catch the same day run (results available the next day). If you are using FedEX, priority overnight arrives here day at around :00 am. Cancellations Buyer may not cancel any order or return any samples without Bio Basic Inc. s consent. Cancellation and return charges may be charged. Buyer must contact Bio Basic Inc. to obtain a return material authorization number. Warranty Bio Basic Inc. guarantees > 650 bp Q20 read length and more than 90%successful rate. Bio Basic Inc. does not guarantee any downstream application(s) or usage of the DNA sequencing results. Any claims or dispute must be submitted within 2 weeks of the results being sent. At the time of shipment, Bio Basic Inc. keeps a database for unexpected incidents and/or disputes. Bio Basic Inc. reserves the right to refuse handling disputes after a period of 3 months. Prices Bio Basic Inc. unit prices for DNA sequencing tests apply only to the specific quantity, sample purification and primer synthesis. All prices are subject to correction of errors; Bio Basic Inc. reserves the right to adjust prices on orders during production due to changes in cost of materials, transportation or wages. Any tax, customs, surcharge or duty, howsoever denominated, imposed upon the sale, importation, delivery or use of products shall be the responsibility of the Buyer. 351
SEQUENCING SERVICES. McGill University and Génome Québec Innovation Centre JANUARY 21, 2016. Version 3.4
JANUARY 21, 2016 SEQUENCING SERVICES McGill University and Génome Québec Innovation Centre Sanger Sequencing User Guide Version 3.4 Copyright 2010 McGill University and Génome Québec Innovation Centre
Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website
Biomolecular Core Facility AI Dupont Hospital for Children, Rockland Center One, Room 214 Core: (302) 651-6712, Office: (302) 651-6707, [email protected] Katia Sol-Church, Ph.D., Director Jennifer Frenck
Introduction. Preparation of Template DNA
Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;
For information regarding shipping specifications, please refer to the following link: http://dna.macrogen.com/eng/help/orderg.jsp
Macrogen Sample Submission Guide Macrogen has served over 10 years in sequencing field using the cutting edge technology and delivering fast and reliable results. We use high throughput Applied Biosystems
First Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
DNA Core Facility: DNA Sequencing Guide
DNA Core Facility: DNA Sequencing Guide University of Missouri-Columbia 216 Life Sciences Center Columbia, MO 65211 http://biotech.missouri.edu/dnacore/ Table of Contents 1. Evaluating Sequencing Data..
DNA Sequencing Handbook
Genomics Core 147 Biotechnology Building Ithaca, New York 14853-2703 Phone: (607) 254-4857; Fax (607) 254-4847 Web: http://cores.lifesciences.cornell.edu/brcinfo/ Email: [email protected] DNA Sequencing
Procedures For DNA Sequencing
Procedures For DNA Sequencing Plant-Microbe Genomics Facility (PMGF) Ohio State University 420 Biological Sciences Building 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204 FAX: 614/292-6337
DNA Sample preparation and Submission Guidelines
DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send
DNA Sequencing Troubleshooting Guide
DNA Sequencing Troubleshooting Guide Successful DNA Sequencing Read Peaks are well formed and separated with good quality scores. There is a small area at the beginning of the run before the chemistry
Description: Molecular Biology Services and DNA Sequencing
Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:
DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE
DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE We recommend for the sequence visualization the use of software that allows the examination of raw data in order to determine quantitatively how good has
Troubleshooting Sequencing Data
Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page
The Techniques of Molecular Biology: Forensic DNA Fingerprinting
Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins
SYBR Green Realtime PCR Master Mix -Plus-
Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction
A Brief Guide to Interpreting the DNA Sequencing Electropherogram Version 3.0
A Brief Guide to Interpreting the DNA Sequencing Electropherogram Version 3.0 Plant-Microbe Genomics Facility The Ohio State University 484 W.12 th Ave., Columbus, OH 43210 Ph: 614/247-6204 FAX: 614/247-8696
Taq98 Hot Start 2X Master Mix
Taq98 Hot Start 2X Master Mix Optimized for 98C Denaturation Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608) 831-9012 [email protected]
ZR DNA Sequencing Clean-up Kit
INSTRUCTION MANUAL ZR DNA Sequencing Clean-up Kit Catalog Nos. D40 & D4051 Highlights Simple 2 Minute Bind, Wash, Elute Procedure Flexible 6-20 µl Elution Volumes Allow for Direct Loading of Samples with
CUSTOM DNA SEQUENCING SERVICES
CUSTOM DNA SEQUENCING SERVICES Satisfied Customers are our Driving Force We never stop exceeding your Expectations Value Read Service Single read sequencing of plasmid inserts or PCR products in tube and
ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053
INSTRUCTION MANUAL ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 Highlights Simple 10 Minute Bind, Wash, Elute Procedure Flexible 15-20 µl Elution Volumes Allow for Direct Loading of Samples
PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System)
Sanger Sequencing. Troubleshooting Guide. Failed sequence
Sanger Sequencing Troubleshooting Guide Below are examples of the main problems experienced in ABI Sanger sequencing. Possible causes for failure and their solutions are listed below each example. The
qstar mirna qpcr Detection System
qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr
Gene Expression Assays
APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency
Cloning GFP into Mammalian cells
Protocol for Cloning GFP into Mammalian cells Studiepraktik 2013 Molecular Biology and Molecular Medicine Aarhus University Produced by the instructors: Tobias Holm Bønnelykke, Rikke Mouridsen, Steffan
Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology
Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,
Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation
Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna
BacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
PicoMaxx High Fidelity PCR System
PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED
MICB ABI PRISM 310 SEQUENCING GUIDE SEQUENCING OF PLASMID DNA
Plasmid DNA Preparation MICB ABI PRISM 310 SEQUENCING GUIDE SEQUENCING OF PLASMID DNA Introduction: I have always used the classic Alkaline Lysis miniprep method to isolate plasmid DNA. (See below) If
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
HiPer RT-PCR Teaching Kit
HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The
RevertAid Premium First Strand cdna Synthesis Kit
RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent
Genomic DNA Extraction Kit INSTRUCTION MANUAL
Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:
HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone
TIANquick Mini Purification Kit
TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer
PrimeSTAR HS DNA Polymerase
Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction
50 g 650 L. *Average yields will vary depending upon a number of factors including type of phage, growth conditions used and developmental stage.
3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: [email protected] Phage DNA Isolation Kit Product # 46800, 46850 Product Insert
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna
All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination
Guide to using the Bio Rad CFX96 Real Time PCR Machine
Guide to using the Bio Rad CFX96 Real Time PCR Machine Kyle Dobbs and Peter Hansen Table of Contents Overview..3 Setup Reaction Guidelines 4 Starting up the Software 5 Setup Protocol on Software 6 Setup
DNA and Forensic Science
DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief
ab185916 Hi-Fi cdna Synthesis Kit
ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1
Crime Scenes and Genes
Glossary Agarose Biotechnology Cell Chromosome DNA (deoxyribonucleic acid) Electrophoresis Gene Micro-pipette Mutation Nucleotide Nucleus PCR (Polymerase chain reaction) Primer STR (short tandem repeats)
Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011
Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)
HighPure Maxi Plasmid Kit
HighPure Maxi Plasmid Kit For purification of high pure plasmid DNA with high yields www.tiangen.com PP120109 HighPure Maxi Plasmid Kit Kit Contents Storage Cat.no. DP116 Contents RNaseA (100 mg/ml) Buffer
PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide
PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR Results Interpretation Guide Pathogen Detection Systems by Real Time PCR Microbial offers real time PCR based systems for the detection of pathogenic bacteria
Bio-Reagents Gene synthesis Peptide Synthesis Protein Expression Antibody Production. Life Science Products and Services
Bio-Reagents Gene synthesis Peptide Synthesis Protein Expression Antibody Production Life Science Products and Services Since 2002, Biomatik has provided worldwide researchers in life science discovery
Mir-X mirna First-Strand Synthesis Kit User Manual
User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.
CompleteⅡ 1st strand cdna Synthesis Kit
Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: www.greenmountainbio.com Tel: 800-942-1160 Sales: Sales@ greenmountainbio.com Support:
Integrated Protein Services
Integrated Protein Services Custom protein expression & purification Version DC04-0012 Expression strategy The first step in the recombinant protein generation process is to design an appropriate expression
RT-PCR: Two-Step Protocol
RT-PCR: Two-Step Protocol We will provide both one-step and two-step protocols for RT-PCR. We recommend the twostep protocol for this class. In the one-step protocol, the components of RT and PCR are mixed
restriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
SERVICE REQUEST OF DNA SEQUENCING
SERVICE REQUEST OF DNA SEQUENCING To submit samples for DNA sequencing please read carefully the following instructions (Operational Procedure) where the steps to follow are detailed. *Important Note:
DNA Sequence Analysis
DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide
Essentials of Real Time PCR. About Sequence Detection Chemistries
Essentials of Real Time PCR About Real-Time PCR Assays Real-time Polymerase Chain Reaction (PCR) is the ability to monitor the progress of the PCR as it occurs (i.e., in real time). Data is therefore collected
Table of Contents. I. Description... 2. II. Kit Components... 2. III. Storage... 2. IV. 1st Strand cdna Synthesis Reaction... 3
Table of Contents I. Description... 2 II. Kit Components... 2 III. Storage... 2 IV. 1st Strand cdna Synthesis Reaction... 3 V. RT-PCR, Real-time RT-PCR... 4 VI. Application... 5 VII. Preparation of RNA
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College
Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology
UltraClean PCR Clean-Up Kit
UltraClean PCR Clean-Up Kit Catalog No. Quantity 12500-50 50 Preps 12500-100 100 Preps 12500-250 250 Preps Instruction Manual Please recycle Version: 02212013 1 Table of Contents Introduction... 3 Protocol
Beginner s Guide to Real-Time PCR
Beginner s Guide to Real-Time PCR 02 Real-time PCR basic principles PCR or the Polymerase Chain Reaction has become the cornerstone of modern molecular biology the world over. Real-time PCR is an advanced
Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform
Reduced Representation Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 3 Sample Prep Workflow, 4 Best Practices, 5 DNA Input Recommendations,
TransformAid Bacterial Transformation Kit
Home Contacts Order Catalog Support Search Alphabetical Index Numerical Index Restriction Endonucleases Modifying Enzymes PCR Kits Markers Nucleic Acids Nucleotides & Oligonucleotides Media Transfection
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the
Real-Time PCR Vs. Traditional PCR
Real-Time PCR Vs. Traditional PCR Description This tutorial will discuss the evolution of traditional PCR methods towards the use of Real-Time chemistry and instrumentation for accurate quantitation. Objectives
Classic Immunoprecipitation
292PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 [email protected] A Geno Technology, Inc. (USA) brand name Classic Immunoprecipitation Utilizes Protein A/G Agarose for Antibody Binding (Cat.
Mitochondrial DNA Analysis
Mitochondrial DNA Analysis Lineage Markers Lineage markers are passed down from generation to generation without changing Except for rare mutation events They can help determine the lineage (family tree)
Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.
Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-)
PyroPhage 3173 DNA Polymerase, Exonuclease Minus (Exo-) FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608)
Intended Use: The kit is designed to detect the 5 different mutations found in Asian population using seven different primers.
Unzipping Genes MBPCR014 Beta-Thalassemia Detection Kit P r o d u c t I n f o r m a t i o n Description: Thalassemia is a group of genetic disorders characterized by quantitative defects in globin chain
IMBB 2013. Genomic DNA purifica8on
IMBB 2013 Genomic DNA purifica8on Why purify DNA? The purpose of DNA purifica8on from the cell/8ssue is to ensure it performs well in subsequent downstream applica8ons, e.g. Polymerase Chain Reac8on (PCR),
Real-time quantitative RT -PCR (Taqman)
Real-time quantitative RT -PCR (Taqman) Author: SC, Patti Lab, 3/03 This is performed as a 2-step reaction: 1. cdna synthesis from DNase 1-treated total RNA 2. PCR 1. cdna synthesis (Advantage RT-for-PCR
All-in-One mirna qrt-pcr Detection System Handbook
All-in-One mirna qrt-pcr Detection System Handbook For quantitative detection of mature mirna All-in-One mirna First-Strand cdna Synthesis Kit Cat. No. AMRT-0020 (20 mirna reverse transcription reactions)
Welcome to Pacific Biosciences' Introduction to SMRTbell Template Preparation.
Introduction to SMRTbell Template Preparation 100 338 500 01 1. SMRTbell Template Preparation 1.1 Introduction to SMRTbell Template Preparation Welcome to Pacific Biosciences' Introduction to SMRTbell
360 Master Mix. , and a supplementary 360 GC Enhancer.
Product Bulletin AmpliTaq Gold 360 Master Mix and 360 DNA Polymerase AmpliTaq Gold 360 Master Mix AmpliTaq Gold 360 DNA Polymerase 360 Coverage for a Full Range of Targets AmpliTaq Gold 360 Master Mix
Data Analysis for Ion Torrent Sequencing
IFU022 v140202 Research Use Only Instructions For Use Part III Data Analysis for Ion Torrent Sequencing MANUFACTURER: Multiplicom N.V. Galileilaan 18 2845 Niel Belgium Revision date: August 21, 2014 Page
DNA Sequencing Overview
DNA Sequencing Overview DNA sequencing involves the determination of the sequence of nucleotides in a sample of DNA. It is presently conducted using a modified PCR reaction where both normal and labeled
Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280.
Technical Bulletin Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280. PRINTED IN USA. Revised 4/06 AF9TB141 0406TB141 Wizard DNA Clean-Up System All technical literature is available on
Easy Collection and Extraction of BioSamples Ahlstrom GenCollect Ahlstrom GenCollect Color
Easy Collection and Extraction of BioSamples Ahlstrom GenCollect Ahlstrom GenCollect Color Ahlstrom GenCollect and Ahlstrom GenCollect Color Collection of biosamples COST Storage at ambient temperature
How To Use An Enzymatics Spark Dna Sample Prep Kit For Ion Torrent
SPARK DNA Sample Prep Kit Ion Torrent (SPK0002-V08) Frequently Asked Questions Under what circumstances would I use SPARK DNA Sample Prep Kit for Ion Torrent? Enzymatics SPARK DNA Sample Prep Kit for Ion
ID kit. imegen Anchovies II. and E. japonicus) DNA detection by. User manual. Anchovies species (E. encrasicolus. sequencing.
User manual imegen Anchovies II ID kit Anchovies species (E. encrasicolus and E. japonicus) DNA detection by sequencing Reference: Made in Spain The information in this guide is subject to change without
Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit
Product Bulletin Human Identification Quantifiler Human DNA Quantification Kit Quantifiler Y Human Male DNA Quantification Kit The Quantifiler kits produce reliable and reproducible results, helping to
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual
Thermo Scientific DyNAmo cdna Synthesis Kit for qrt-pcr Technical Manual F- 470S 20 cdna synthesis reactions (20 µl each) F- 470L 100 cdna synthesis reactions (20 µl each) Table of contents 1. Description...
Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform
Whole genome Bisulfite Sequencing for Methylation Analysis Preparing Samples for the Illumina Sequencing Platform Introduction, 2 Sample Prep Workflow, 3 Best Practices, 4 DNA Input Recommendations, 6
PCR Instruments and Consumables
Index Page GeneAmp PCR Instrument Systems 2 GeneAmp PCR System 9700 Components 3 Accessories and Software for GeneAmp PCR Instrument Systems 4 Disposables 5 PCR Enzymes 7 GeneAmp PCR Kits 12 RNA PCR Kits
Use of the Agilent 2100 Bioanalyzer and the DNA 500 LabChip in the Analysis of PCR Amplified Mitochondrial DNA Application
Use of the Agilent 2100 Bioanalyzer and the DNA LabChip in the Analysis of PCR Amplified Mitochondrial DNA Application Homeland Security/Forensics Author Mark Jensen Agilent Technologies, Inc. 2850 Centerville
quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476
BioScience quantitative real-time PCR, grain, simplex DNA extraction: PGS0426 RT-PCR: PGS0494 & PGS0476 This method describes a Real-time semi-quantitative TaqMan PCR procedure for the determination of
Amazing DNA facts. Hands-on DNA: A Question of Taste Amazing facts and quiz questions
Amazing DNA facts These facts can form the basis of a quiz (for example, how many base pairs are there in the human genome?). Students should be familiar with most of this material, so the quiz could be
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR)
IIID 14. Biotechnology in Fish Disease Diagnostics: Application of the Polymerase Chain Reaction (PCR) Background Infectious diseases caused by pathogenic organisms such as bacteria, viruses, protozoa,
Illumina TruSeq DNA Adapters De-Mystified James Schiemer
1 of 5 Illumina TruSeq DNA Adapters De-Mystified James Schiemer The key to sequencing random fragments of DNA is by the addition of short nucleotide sequences which allow any DNA fragment to: 1) Bind to
Automation in Genomics High-throughput purification of nucleic acids from biological samples. Valentina Gualdi Operational Scientist PGP
Automation in Genomics High-throughput purification of nucleic acids from biological samples Valentina Gualdi Operational Scientist PGP OVERVIEW Nucleic acid purification technologies general aspects Genomic
Validating Microarray Data Using RT 2 Real-Time PCR Products
Validating Microarray Data Using RT 2 Real-Time PCR Products Introduction: Real-time PCR monitors the amount of amplicon as the reaction occurs. Usually, the amount of product is directly related to the
UltraClean Soil DNA Isolation Kit
PAGE 1 UltraClean Soil DNA Isolation Kit Catalog # 12800-50 50 preps New improved PCR inhibitor removal solution (IRS) included Instruction Manual (New Alternative Protocol maximizes yields) Introduction
User Manual. CelluLyser Lysis and cdna Synthesis Kit. Version 1.4 Oct 2012 From cells to cdna in one tube
User Manual CelluLyser Lysis and cdna Synthesis Kit Version 1.4 Oct 2012 From cells to cdna in one tube CelluLyser Lysis and cdna Synthesis Kit Table of contents Introduction 4 Contents 5 Storage 5 Additionally
Reverse Transcription System
TECHNICAL BULLETIN Reverse Transcription System Instruc ons for use of Product A3500 Revised 1/14 TB099 Reverse Transcription System All technical literature is available on the Internet at: www.promega.com/protocols/
AffinityScript QPCR cdna Synthesis Kit
AffinityScript QPCR cdna Synthesis Kit INSTRUCTION MANUAL Catalog #600559 Revision C.01 For In Vitro Use Only 600559-12 LIMITED PRODUCT WARRANTY This warranty limits our liability to replacement of this
Hepatitis B Virus Genemer Mix
Product Manual Hepatitis B Virus Genemer Mix Primer Pair for amplification of HBV Specific DNA Fragment Includes Internal Negative Control Primers and Template Catalog No.: 60-2007-12 Store at 20 o C For
ABSTRACT. Promega Corporation, Updated September 2008. http://www.promega.com/pubhub. 1 Campbell-Staton, S.
A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA... A Modified Wizard SV Genomic DNA Purification System Protocol to Purify Genomic DNA from Shed Reptile Skin ABSTRACT
How To Get Rid Of Small Dna Fragments
AxyPrep TM Mag FragmentSelect-I Protocol (Fragment Size Selection for Illumina Genome Analyzer and Life Technologies SoLiD) Introduction The AxyPrep Mag FragmentSelect-I purification kit utilizes a unique
