Standard DNA Sequencing Services Standard DNA Sequencing Services Standard DNA Sequencing Services BIO BASIC INC.

Save this PDF as:

Size: px
Start display at page:

Download "Standard DNA Sequencing Services Standard DNA Sequencing Services Standard DNA Sequencing Services BIO BASIC INC."


1 1 344 BIO BASIC INC.

2 BBI STANDARD DNA SEQUENCING SERVICES Catalogue With over 10 years of experience, Bio Basic Inc. is a leader in offering single and high-throughput DNA sequencing services. All DNA sequencing is performed within our own facility using state-of-the-art technologies and informatics. Key Features Incoming sample QC Fluorescent dye-terminator sequencing ABI Prism 3730xl DNA sequencers >650bp Q20 read lengths typical Universal primers provided at no additional charge (complete list below) Template preparation and primer synthesis available Services & Prices Samples Quantity Price USD Additional charge (USD) Purified Plasmids Purified PCR Products Bacterial Stabs Culture Crude PCR Products Primer synthesis 1-9 reactions > reactions > reactions > 500 $ 5.00 $ 4.80 $ 4.50 Inquire $ 5.00 $ 4.80 $ 4.50 Inquire $ 5.00 $ 4.80 $ 4.50 Inquire $ 0.19/base Purification: $0.60 Purification: $0.60 Purification: $0.60 Purification: $0.60 Purification: $1.00 Purification: $1.00 Purification: $1.00 Purification: $1.00 For long term or bulk project, please inquire about our bulk pricing. Purified plasmid DNA: Purified plasmid DNA: Plasmids should be purified usinga qualified Plasmid DNA Purification Kit. Quantity:The sample volume should be at least 20 μl in dd-water, at a desired concentration of 100 ng/μl to 200 ng/μl. TE is not recommended to dissolve the DNA samples. Bacterial: (1) LB stabs (2) 1 ml of overnight culture containing 15% glycerol te: A. Low copy bacteria stabs or culture are not acceptable. Please send 10 μg of purified plasmid DNA. B. Please provide all necessary information including insert size, antibiotic resistance. Purified PCR products: PCR products should be purified by qualified PCR Products Purification Kits. Purity: one band should appear on agarose gel. Sample volume should be around μl in dd-water at a desired concentration of 30 ng/μl or higher. Crude PCR products: at least 50 μl of non-purified PCR product must be provided for purification at a desired concentration of 30 ng/μl or higher. Primers: We provide many universal primers at no additional charge (see list as below). If the primers for your sequencing reactions are not included in the list, you will need to provide the primer. Alternatively, Bio Basic Inc. can synthesize the primer for you at an additional cost. Concentration of primers: >5 pmole/μl (20-50 μl). Chain length of the primer should be more than 15 bases, but no longer than 50 bases. Random primers are not accepted as sequencing primers. DNA sequence and annealing temperature should be provided by the customer for primer. Results: Sequence chromatogram files will be sent to customer electronically as well as the.txt file of the DNA sequence. We also provide PDF alignment file upon request. Turnaround: ~24 hr to 48 hr. For bulk orders, please inquire. 345

3 Placing Your Order ONLINE: You may order Bio Basic Inc's DNA Sequencing Service online through our website, by filling out the Online Order Form. Options are available for submitting one to hundreds of samples. DOWNLOAD and You may download an excel Sequencing Order Form from and it to and We offer easy payments options via purchase order number and/or credit card (Visa and MasterCard only). After your order is approved, please send samples to Bio Basic Inc. or our distributor in your country. Bio Basic Inc. offers FREE pick ups for > 100 samples within Canada/USA. If there is no distributor in your country, you may contact a distributor near your country or Bio Basic Inc. directly. 1Contact Us Phone or Fax Web Mail Samples Universal Primers Universal Primer M13 Forward 20 Konrad Crescent, Markham, ON, L3R 8T4 Canada Free Shipping if >100 Samples (Canada/USA only) Sequence GTAAAACGACGGCCAGT M13 Reverse pgex 3' pgex 5' SP6 T3 T7 (short) T7 (long) T7 terminator CAGGAAACAGCTATGAC CCGGGAGCTGCATGTGTCAGAGG GGGCTGGCAAGCCACGTTTGGTG ATTTAGGTGACACTATA ATTAACCCTCACTAAAG AATACGACTCACTATAG AATACGACTCACTATAGgg GCTAGTTATTGCTCAGCGGT 346 BIO BASIC INC.

4 Sequencing Reports BBI Catalogue 1.Sequencing report Format (1) Original ABI format of ~700 bp sequencing chromatogram (2) Text file of the DNA Sequence (3) Summary of Report (4) All results are sent electronically 2. View results (1) Download Chromas from (2) Double click Chromas and open ABI file from Chromas (3) Export text file from Chromas (4) Sequences between 60 bp to 500 bp are most reliable region. To obtain reliable reads, it is highly recommended to perform double stranded sequencing using reverse primers as a good laboratory practice. 3. report (1) Samples fail to pass incoming QC (2) Sample with no readable signal 4.Charges on sequences with structures Standard charge applies even if sequences are not clear due to known structures including Poly N,GC,inverted repeats direct repeats etc. 5.Charges on mixed peaks Most mixed peaks are results from mixed templates (see below Q&A). Standard charge applies. 6.Sample Storage All samples are kept at Bio Basic Inc. for 2 months. During this period, customer may request additional sequencing service. After 2 months, the samples are automatically destroyed without further notification. 347

5 Check List Before Sending Samples Template Requirements Crude PCR Products 1. PCR product > 200 bp 2. Concentration of PCR product should be >30 ng/μl and volume 1 μg-2 μg. 3. Take 2-3 μl samples, a single band of final PCR product should be detected on gel. 4. Specific primers are to be provided by customer. 5. To avoid cross contaminations during shipment, please make sure you use a tight-fit lid when shipping samples in 96-well format. Alternatively, samples can be delivered in 8-strip PCR tubes. 1 Purified PCR Product Purified Plasmid DNA Bacteria 1. Dissolve final PCR product in ddh 2 O ( Please do not use TE). 2. Concentration of PCR product should be >30 ng/μl and volume >10 μl. For PCR product >2 kb, more DNA may be required for sequencing. 3. A single distinct band of final PCR product should be detected on gel. If smearing or multiple bands are seen, you may receive poor or no readable sequencing data. 4. Specific primers are to be provided by customer. 5. To avoid cross contaminations during shipment, please make sure you use a tight-fit lid when shipping samples in 96-well format. Alternatively, samples can be delivered in 8-strip PCR tubes. 1. Dissolve purified plasmid DNA in 30~50 μl ddh 2 O (Please do not use TE). 2. Concentration of plasmid should be > ng/μl; 3. It is recommended to use molecular biology kit to purify plasmid DNA rather than ethanol precipitation. 4. Specific primers are to be provided by customer. 5. To avoid cross contaminations during shipment, please make sure you use a tight-fit lid when shipping samples in 96-well format. Alternatively, samples can be delivered in 8-strip PCR tubes. 1. Please indicate antibiotic resistance for desired bacteria strain. Bio Basic Inc. offers services of DNA extraction from Amp, Kan, Tet and Chl. All other antibiotics are to be provided by customer with instruction manuals. 2. Bio Basic Inc offers DNA extraction from high copy plasmid. For low copy plasmid bacteria, please send ~10 μg purified DNA. 3. Please provide 1 ml overnight culture or 15% glycerol stock. Please send bacterial samples in individual Eppendorft tubes with openings securely sealed. 4. For large sample size, we recommend Ecoli stab in 96-well plate. This is to avoid cross contamination between samples during shipment. Specific Primers 1. Concentration of primers should be >5 pmol/μl( or 5 μmol/l) and volume > μl. Please mark primer concentration clearly. 2. Random primers and/or primers <15 bases cannot be used for sequencing. 3. Please provide sequences of primers so that Tm could be known for condition optimization. Universal Primers M13 Forward, M13 Reverse, pgex 3, pgex 5, T7promoter, T7 terminator, SP6, T3 are primers provided at FREE of charge. If your primers are not in the above list, please ship primers along with your sample(s). Alternatively, Bio Basic Inc. can synthesize the oligos for you at $0.19 per base. Please refer to Oligo Synthesis. 348 BIO BASIC INC.

6 What is DNA Sequencing BBI Catalogue The term DNA sequencing encompasses biochemical methods for determining the order of the nucleotide bases, adenine, guanine, cytosine, and thymine, in a DNA oligonucleotide. The sequence of DNA constitutes the heritable genetic information in nuclei, plasmids, mitochondria, and chloroplasts that forms the basis for the developmental programs of all living organisms. Determining the DNA sequence is therefore useful in basic research for studying fundamental biological processes, as well as in applied fields such as diagnostic or forensic research. The advent of DNA sequencing has significantly accelerated biological research and discovery. The rapid speed of sequencing attained with modern DNA sequencing technology has been instrumental in the large-scale sequencing of the human genome, in the Human Genome Project. Related projects, often by scientific collaboration across continents, have generated the complete DNA sequences of many animal, plant, and microbial genomes. Frequent Questions and Answers A:We would need you to first clearly tell us at which position is unclear to you and then we would go case by case. If it is from Bio Basic Inc. s processing Q:In one of the region, the sequencing was not clear. Could I request Bio Basic Inc. to sequence again? problem, we will initiate a no-charge repeat immediately. Q:I lost all data, could you send me another copy? A:Yes. However, please note, all sequencing results are kept for a period of 6 months. Samples are kept at Bio Basic Inc. for 1-2months. Q:I have a 4kb PCR fragments, can Bio Basic Inc. sequence through the full length? A:For PCR >2 kb, we recommend to first sub-clone it into a vector. The insert is more stable in a vector and sequencing results will be easier to achieve. Q:I have a mixed base pair in a position, how come I do not see the mixed base in the report? A:When preparing the report, Bio Basic Inc. assumes sequencing sample is from a pure single population rather than mixed. Based on this assumption, the higher/stronger peak is being reported and lower/weaker peak being treated as background. If your sample contains a mixed population, please kindly notify us. Q:The bands are present and strong, but irregularly spaced, or with mixed colors. The technician may have reported "superimposed sequences" or used the phrase "peaks on peaks"? A: If you see this, you usually have two sequences superimposed on other. There are several common causes: The sequencing primer binds to two (or more) sites on the template. There are two (or more) templates present. This was a PCR reaction, and you didn't remove the original primers. This was a PCR reaction, and one primer generated *both* ends. This was a PCR reaction, and there is more than one amplified species present. Here's an example of 'mixed peaks' such as might arise from two or more unrelated templates: 349

7 Another example, this time with templates that might be related. te the alignment of the peaks: 1Q:Your sequence proceeds normally, then the bands abruptly become much smaller Secondary structure in the template is the most likely cause of this problem. The polymerase is presumably unable to progress through some stem-loop form. A couple possible solutions: (i) try re-sequencing by selecting 'sirna construct' as your DNA type, (ii) try to sequence from another primer at a different position (closer or further); (iii) sequence the other strand. We maybe able to use special cycling conditions and/or special reagents that help the polymerase to push through this region. We cannot do this routinely, as it involves extensive optimizations. Here's an example of a secondary structure effect: Q: Your sequence proceeds normally, then the bands abruptly vanish. This usually happens when the template DNA has simply stopped, for example if it was restricted at a downstream site or if the template was a PCR product. This may also be caused by an extremely stable secondary structure. Q: The sequence looks great until it hits a polya (or polyt), and then the bands rise and fall in waves. This is called "polymerase slip". It happens when the growing strand temporarily dissociates from the template, then re-associates at a different spot - say, one nucleotide forward or back from where it started. If this happens often enough (as it will on polya or polyt templates), every individual band becomes a family of closely-spaced peaks giving a 'roller coaster' look to the chromatogram. Try sequencing in the other direction from the opposite strand, or try another primer either closer or further from the homopolymer region. The following is an excellent example of 'polymerase slip' on a homopolymeric tract: Q:You offer 24hr to 48hr service, but it has been 2 days and I still have not received data? A:24 hr to 48 hr is AFTER we receive the samples at Bio Basic Inc. If you have more than 5 plates, longer turnaround is expected. 350 BIO BASIC INC.

8 BBI Catalogue Terms and Conditions Terms Bio Basic Inc. will send electronically DNA sequencing results to customers. All results will be kept in Bio Basic Inc. s data base for 6 months. During this period, customer may request sequencing results. After 6 months, DNA sequencing results are automatically destroyed without further notification. DNA sequencing tests are not considered confirmed without the customer providing a P.O. number or credit card number. Bio Basic Inc. accepts credit card (Visa or MasterCard), cheque or wire for payment. Turnaround Bio Basic Inc. will make its best effort to send DNA sequencing results within 48 hours. For Larger projects, time will vary depending on the size of the project. We try our best to accommodate special time constraints whenever possible, and projects of more than one hundred reactions may still get hours turn around. Mail-in samples need to be received before noon time to catch the same day run (results available the next day). If you are using FedEX, priority overnight arrives here day at around :00 am. Cancellations Buyer may not cancel any order or return any samples without Bio Basic Inc. s consent. Cancellation and return charges may be charged. Buyer must contact Bio Basic Inc. to obtain a return material authorization number. Warranty Bio Basic Inc. guarantees > 650 bp Q20 read length and more than 90%successful rate. Bio Basic Inc. does not guarantee any downstream application(s) or usage of the DNA sequencing results. Any claims or dispute must be submitted within 2 weeks of the results being sent. At the time of shipment, Bio Basic Inc. keeps a database for unexpected incidents and/or disputes. Bio Basic Inc. reserves the right to refuse handling disputes after a period of 3 months. Prices Bio Basic Inc. unit prices for DNA sequencing tests apply only to the specific quantity, sample purification and primer synthesis. All prices are subject to correction of errors; Bio Basic Inc. reserves the right to adjust prices on orders during production due to changes in cost of materials, transportation or wages. Any tax, customs, surcharge or duty, howsoever denominated, imposed upon the sale, importation, delivery or use of products shall be the responsibility of the Buyer. 351


SEQUENCING TROUBLESHOOTING SEQUENCING TROUBLESHOOTING No sequence or very weak sequence Possible explanations: There was no DNA in your tube (or far less DNA than necessary). o Did you quantitate the DNA using a spectrophotometer?

More information

SEQUENCING SERVICES. McGill University and Génome Québec Innovation Centre JANUARY 21, 2016. Version 3.4

SEQUENCING SERVICES. McGill University and Génome Québec Innovation Centre JANUARY 21, 2016. Version 3.4 JANUARY 21, 2016 SEQUENCING SERVICES McGill University and Génome Québec Innovation Centre Sanger Sequencing User Guide Version 3.4 Copyright 2010 McGill University and Génome Québec Innovation Centre

More information

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website

Sequencing Guidelines Adapted from ABI BigDye Terminator v3.1 Cycle Sequencing Kit and Roswell Park Cancer Institute Core Laboratory website Biomolecular Core Facility AI Dupont Hospital for Children, Rockland Center One, Room 214 Core: (302) 651-6712, Office: (302) 651-6707, Katia Sol-Church, Ph.D., Director Jennifer Frenck

More information

For information regarding shipping specifications, please refer to the following link:

For information regarding shipping specifications, please refer to the following link: Macrogen Sample Submission Guide Macrogen has served over 10 years in sequencing field using the cutting edge technology and delivering fast and reliable results. We use high throughput Applied Biosystems

More information

Introduction. Preparation of Template DNA

Introduction. Preparation of Template DNA Procedures and Recommendations for DNA Sequencing at the Plant-Microbe Genomics Facility Ohio State University Biological Sciences Building Room 420, 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204;

More information

Procedures For DNA Sequencing

Procedures For DNA Sequencing Procedures For DNA Sequencing Plant-Microbe Genomics Facility (PMGF) Ohio State University 420 Biological Sciences Building 484 W. 12th Ave., Columbus OH 43210 Telephone: 614/247-6204 FAX: 614/292-6337

More information

DNA Sample preparation and Submission Guidelines

DNA Sample preparation and Submission Guidelines DNA Sample preparation and Submission Guidelines Requirements: Please submit samples in 1.5ml microcentrifuge tubes. Fill all the required information in the Eurofins DNA sequencing order form and send

More information

First Strand cdna Synthesis

First Strand cdna Synthesis 380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences

More information

DNA Sequencing Handbook

DNA Sequencing Handbook Genomics Core 147 Biotechnology Building Ithaca, New York 14853-2703 Phone: (607) 254-4857; Fax (607) 254-4847 Web: Email: DNA Sequencing

More information

DNA Core Facility: DNA Sequencing Guide

DNA Core Facility: DNA Sequencing Guide DNA Core Facility: DNA Sequencing Guide University of Missouri-Columbia 216 Life Sciences Center Columbia, MO 65211 Table of Contents 1. Evaluating Sequencing Data..

More information

Genetics Faculty of Agriculture and Veterinary Medicine

Genetics Faculty of Agriculture and Veterinary Medicine Genetics 10201232 Faculty of Agriculture and Veterinary Medicine Instructor: Dr. Jihad Abdallah Topic 15:Recombinant DNA Technology 1 Recombinant DNA Technology Recombinant DNA Technology is the use of

More information

DNA Sequencing Troubleshooting Guide

DNA Sequencing Troubleshooting Guide DNA Sequencing Troubleshooting Guide Successful DNA Sequencing Read Peaks are well formed and separated with good quality scores. There is a small area at the beginning of the run before the chemistry

More information

PCR Polymerase Chain Reaction

PCR Polymerase Chain Reaction Biological Sciences Initiative HHMI PCR Polymerase Chain Reaction PCR is an extremely powerful technique used to amplify any specific piece of DNA of interest. The DNA of interest is selectively amplified

More information

Description: Molecular Biology Services and DNA Sequencing

Description: Molecular Biology Services and DNA Sequencing Description: Molecular Biology s and DNA Sequencing DNA Sequencing s Single Pass Sequencing Sequence data only, for plasmids or PCR products Plasmid DNA or PCR products Plasmid DNA: 20 100 ng/μl PCR Product:

More information

Realtime PCR Master Mix

Realtime PCR Master Mix Instruction manual Realtime PCR Master Mix 0810 F0923K Realtime PCR Master Mix Contents [1] Introduction [2] Components [3] Primer/Probe design [4] Detection [5] Specimens [6] Protocol 1. TaqMan assay

More information


DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE DNA SEQUENCING SANGER: TECHNICALS SOLUTIONS GUIDE We recommend for the sequence visualization the use of software that allows the examination of raw data in order to determine quantitatively how good has

More information

Troubleshooting Sequencing Data

Troubleshooting Sequencing Data Troubleshooting Sequencing Data Troubleshooting Sequencing Data No recognizable sequence (see page 7-10) Insufficient Quantitate the DNA. Increase the amount of DNA in the sequencing reactions. See page

More information

A Brief Guide to Interpreting the DNA Sequencing Electropherogram Version 3.0

A Brief Guide to Interpreting the DNA Sequencing Electropherogram Version 3.0 A Brief Guide to Interpreting the DNA Sequencing Electropherogram Version 3.0 Plant-Microbe Genomics Facility The Ohio State University 484 W.12 th Ave., Columbus, OH 43210 Ph: 614/247-6204 FAX: 614/247-8696

More information

Next Generation Sequencing

Next Generation Sequencing Next Generation Sequencing Molecular Methods Sylvain Forêt March 2010 1 Introduction 2 Sanger 3 Illumina 4 454 5 SOLiD 6 Summary The Genomic Age Recent landmarks

More information

QuickClean 96-Well Plasmid Miniprep Kit

QuickClean 96-Well Plasmid Miniprep Kit QuickClean 96-Well Plasmid Miniprep Kit L00237 Technical Manual No. TM 0231 Version 0712007 I Description.. 1 II Kit Contents.. 1 III Applications 2 IV Key Features.. 2 V Storage.. 2 VI Plasmid Miniprep

More information

Chapter 20: Biotechnology: DNA Technology & Genomics

Chapter 20: Biotechnology: DNA Technology & Genomics Biotechnology Chapter 20: Biotechnology: DNA Technology & Genomics The BIG Questions How can we use our knowledge of DNA to: o Diagnose disease or defect? o Cure disease or defect? o Change/improve organisms?

More information

BIOTECHNOLOGY. What can we do with DNA?

BIOTECHNOLOGY. What can we do with DNA? BIOTECHNOLOGY What can we do with DNA? Biotechnology Manipulation of biological organisms or their components for research and industrial purpose Usually manipulate DNA itself How to study individual gene?

More information


POLYMERASE CHAIN REACTION (PCR) POLYMERASE CHAIN REACTION (PCR) The polymerase chain reaction (PCR) is a technique used to amplify specific segments of DNA that may range in size from ca. 200-2000 or more base pairs. Two recent papers

More information

The Techniques of Molecular Biology: Forensic DNA Fingerprinting

The Techniques of Molecular Biology: Forensic DNA Fingerprinting Revised Fall 2011 The Techniques of Molecular Biology: Forensic DNA Fingerprinting The techniques of molecular biology are used to manipulate the structure and function of molecules such as DNA and proteins

More information

SYBR Green Realtime PCR Master Mix -Plus-

SYBR Green Realtime PCR Master Mix -Plus- Instruction manual SYBR Green Realtime PCR Master Mix -Plus- 0810 F0925K SYBR Green Realtime PCR Master Mix -Plus- Contents QPK-212T 1mLx1 QPK-212 1mLx5 Store at -20 C, protected from light [1] Introduction

More information

ZR DNA Sequencing Clean-up Kit

ZR DNA Sequencing Clean-up Kit INSTRUCTION MANUAL ZR DNA Sequencing Clean-up Kit Catalog Nos. D40 & D4051 Highlights Simple 2 Minute Bind, Wash, Elute Procedure Flexible 6-20 µl Elution Volumes Allow for Direct Loading of Samples with

More information

Zback Faster Ligation Kit

Zback Faster Ligation Kit Zback Faster Ligation Kit For the highest efficiency cloning of PCR products either blunt or sticky-end Kit Contents Contents TGVTB04 TGVTB04-2 pzback/blunt vector 10 µl 20 µl T4 DNA Ligase 5 µl 10 µl

More information


MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS MOLECULAR BIOLOGY OVERVIEW NUCLEIC ACIDS: THE BASICS Richard L. Hodinka, Ph.D. University of South Carolina School of Medicine Greenville Greenville Health System, Greenville, SC

More information

RNA-related Products

RNA-related Products RNA-related Products TranscriptME RNA kit: Ideal choice for obtaining high yields of full-length cdna for RT-qPCR assays Suitable for as low RNA amount as 10 pg p p Convenient, reliable and cost-effective

More information

RNA-related Products

RNA-related Products RNA-related Products TRANSCRIPTME RNA kit: Ideal choice for obtaining high yields of full-length cdna for RT-qPCR assays Suitable for as low RNA amount as 10 pg p p Convenient, reliable and cost-effective

More information

Oligo d(t) Primers. Product Specification. Reverse Transcriptase Primers, cdna Cloning Primers, T7 RNA Amplification Primers

Oligo d(t) Primers. Product Specification. Reverse Transcriptase Primers, cdna Cloning Primers, T7 RNA Amplification Primers Product Specification Reverse Transcriptase Primers, cdna Cloning Primers, T7 RNA Amplification Primers Oligo d(t) Primers Shipped at ambient temperature. Store at -20 o C For research use only. Not for

More information

Taq98 Hot Start 2X Master Mix

Taq98 Hot Start 2X Master Mix Taq98 Hot Start 2X Master Mix Optimized for 98C Denaturation Lucigen Corporation 2905 Parmenter St, Middleton, WI 53562 USA Toll Free: (888) 575-9695 (608) 831-9011 FAX: (608) 831-9012

More information


MICB ABI PRISM 310 SEQUENCING GUIDE SEQUENCING OF PLASMID DNA Plasmid DNA Preparation MICB ABI PRISM 310 SEQUENCING GUIDE SEQUENCING OF PLASMID DNA Introduction: I have always used the classic Alkaline Lysis miniprep method to isolate plasmid DNA. (See below) If

More information

Chapter 12 - DNA Technology

Chapter 12 - DNA Technology Bio 100 DNA Technology 1 Chapter 12 - DNA Technology Among bacteria, there are 3 mechanisms for transferring genes from one cell to another cell: transformation, transduction, and conjugation 1. Transformation

More information


CUSTOM DNA SEQUENCING SERVICES CUSTOM DNA SEQUENCING SERVICES Satisfied Customers are our Driving Force We never stop exceeding your Expectations Value Read Service Single read sequencing of plasmid inserts or PCR products in tube and

More information

UltraClean -htp 96 Well PCR Clean-Up Kit

UltraClean -htp 96 Well PCR Clean-Up Kit UltraClean -htp 96 Well PCR Clean-Up Kit Catalog No. Quantity Total Isolations 12596-4 4 x 96 Preps 384 Instruction Manual Please recycle Version: 09122013 1 Table of Contents Introduction... 3 Protocol

More information

Cloning of genes from genomic DNA: Part 3-Restriction Enzyme Digestion and Agarose Gel Electrophoresis

Cloning of genes from genomic DNA: Part 3-Restriction Enzyme Digestion and Agarose Gel Electrophoresis Cloning of genes from genomic DNA: Part 3-Restriction Enzyme Digestion and Agarose Gel Electrophoresis Continuing from our isolation of genomic DNA and PCR amplification of either the evenskipped gene

More information

qstar mirna qpcr Detection System

qstar mirna qpcr Detection System qstar mirna qpcr Detection System Table of Contents Table of Contents...1 Package Contents and Storage Conditions...2 For mirna cdna synthesis kit...2 For qstar mirna primer pairs...2 For qstar mirna qpcr

More information

MagExtractor-PCR & Gel Clean up-

MagExtractor-PCR & Gel Clean up- Instruction manual MagExtractor-PCR & Gel Clean up-0810 F0986K MagExtractor-PCR & Gel Clean up- NPK-601 200 preparations Store at room temperature Contents [1] Introduction [2] Components [3] Materials

More information

LaboPass TM PCR. Protocol Book

LaboPass TM PCR. Protocol Book LaboPass TM PCR Protocol Book LaboPass TM PCR Introduction LaboPass TM PCR kit provides a simple and rapid method to purify PCR products or other enzymatic reactions in just 6 minutes. Up to 10 µg of pure

More information

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053

ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 INSTRUCTION MANUAL ZR-96 DNA Sequencing Clean-up Kit Catalog Nos. D4052 & D4053 Highlights Simple 10 Minute Bind, Wash, Elute Procedure Flexible 15-20 µl Elution Volumes Allow for Direct Loading of Samples

More information

Sanger Sequencing. Troubleshooting Guide. Failed sequence

Sanger Sequencing. Troubleshooting Guide. Failed sequence Sanger Sequencing Troubleshooting Guide Below are examples of the main problems experienced in ABI Sanger sequencing. Possible causes for failure and their solutions are listed below each example. The

More information

Perfect Match PCR Enhancer

Perfect Match PCR Enhancer Perfect Match PCR Enhancer Instruction Manual Catalog #600129 (100 U) and #600130 (200 U) Revision C.0 For Research Use Only. Not for use in diagnostic procedures. 600129-12 LIMITED PRODUCT WARRANTY This

More information

Sequencing a Genome: Inside the Washington University Genome Sequencing Center. Activity Supplement Paper PCR (DNA Amplification)

Sequencing a Genome: Inside the Washington University Genome Sequencing Center. Activity Supplement Paper PCR (DNA Amplification) Sequencing a Genome: Inside the Washington University Genome Sequencing Center Activity Supplement (DNA Amplification) Project Outline The multimedia project Sequencing a Genome: Inside the Washington

More information

Chapter 10 Manipulating Genes

Chapter 10 Manipulating Genes How DNA Molecules Are Analyzed Chapter 10 Manipulating Genes Until the development of recombinant DNA techniques, crucial clues for understanding how cell works remained lock in the genome. Important advances

More information

PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200

PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System) 50 preps Product #60200 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: PCR and Sequencing Reaction Clean-Up Kit (Magnetic Bead System)

More information

Cloning GFP into Mammalian cells

Cloning GFP into Mammalian cells Protocol for Cloning GFP into Mammalian cells Studiepraktik 2013 Molecular Biology and Molecular Medicine Aarhus University Produced by the instructors: Tobias Holm Bønnelykke, Rikke Mouridsen, Steffan

More information

Extraction from Buccal Epithelial Cells

Extraction from Buccal Epithelial Cells Genomic DNA Extraction from Buccal Epithelial Cells The purpose of this lab is to collect a DNA sample from the cells that line the inside of your mouth and to use this sample to explore one of the most

More information

PicoMaxx High Fidelity PCR System

PicoMaxx High Fidelity PCR System PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision C Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED

More information

Lab 1: Who s Your Daddy? (AKA DNA Purification and PCR)

Lab 1: Who s Your Daddy? (AKA DNA Purification and PCR) Lab 1: Who s Your Daddy? (AKA DNA Purification and PCR) Goals of the lab: 1. To understand how DNA s chemical properties can be exploited for purification 2. To learn practical applications of DNA purification

More information

HiPer RT-PCR Teaching Kit

HiPer RT-PCR Teaching Kit HiPer RT-PCR Teaching Kit Product Code: HTBM024 Number of experiments that can be performed: 5 Duration of Experiment: Protocol: 4 hours Agarose Gel Electrophoresis: 45 minutes Storage Instructions: The

More information

DNA CLONING: amplification of unique DNA molecules. In vivo-in different host cells

DNA CLONING: amplification of unique DNA molecules. In vivo-in different host cells DNA CLONING DNA CLONING: amplification of unique DNA molecules In vitro-pcr In vivo-in different host cells POLYMERASE CHAIN REACTION (PCR) PCR THE POLYMERASE CHAIN REACTION (PCR) PROVIDES AN EXTREMELY

More information

Gene Expression Assays

Gene Expression Assays APPLICATION NOTE TaqMan Gene Expression Assays A mpl i fic ationef ficienc yof TaqMan Gene Expression Assays Assays tested extensively for qpcr efficiency Key factors that affect efficiency Efficiency

More information


Genomic DNA Extraction Kit INSTRUCTION MANUAL Genomic DNA Extraction Kit INSTRUCTION MANUAL Table of Contents Introduction 3 Kit Components 3 Storage Conditions 4 Recommended Equipment and Reagents 4 Introduction to the Protocol 4 General Overview

More information

Recombinant DNA Technology

Recombinant DNA Technology PowerPoint Lecture Presentations prepared by Mindy Miller-Kittrell, North Carolina State University C H A P T E R 8 Recombinant DNA Technology The Role of Recombinant DNA Technology in Biotechnology Biotechnology

More information

4 General PCR Methods Page

4 General PCR Methods Page Table of Contents General PCR Methods Page PCR Protocol Selection Guide...65.1 Basic PCR... 66.1.1 Hot Start PCR - The new Standard... Reagents and Equipment Required... General Considerations

More information

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology

Lecture 13: DNA Technology. DNA Sequencing. DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology Lecture 13: DNA Technology DNA Sequencing Genetic Markers - RFLPs polymerase chain reaction (PCR) products of biotechnology DNA Sequencing determine order of nucleotides in a strand of DNA > bases = A,

More information

Forensic DNA Testing Terminology

Forensic DNA Testing Terminology Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.

More information

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation

Recombinant DNA & Genetic Engineering. Tools for Genetic Manipulation Recombinant DNA & Genetic Engineering g Genetic Manipulation: Tools Kathleen Hill Associate Professor Department of Biology The University of Western Ontario Tools for Genetic Manipulation DNA, RNA, cdna

More information

BacReady TM Multiplex PCR System

BacReady TM Multiplex PCR System BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental

More information

PCR and qpcr solutions

PCR and qpcr solutions A T C C C G C A T C C C G C A T C C C G C A T C C C G C A T C C G A T A T C C C G C A T C C C G C A T C C C G C A T C C C G C A T C C A T C C C G C A T C C C G C A T C C C G C A T C C C G C A T C C G C

More information

PicoMaxx High Fidelity PCR System

PicoMaxx High Fidelity PCR System PicoMaxx High Fidelity PCR System Instruction Manual Catalog #600420 (100 U), #600422 (500 U), and #600424 (1000 U) Revision B Research Use Only. Not for Use in Diagnostic Procedures. 600420-12 LIMITED

More information

50 g 650 L. *Average yields will vary depending upon a number of factors including type of phage, growth conditions used and developmental stage.

50 g 650 L. *Average yields will vary depending upon a number of factors including type of phage, growth conditions used and developmental stage. 3430 Schmon Parkway Thorold, ON, Canada L2V 4Y6 Phone: 866-667-4362 (905) 227-8848 Fax: (905) 227-1061 Email: Phage DNA Isolation Kit Product # 46800, 46850 Product Insert

More information

DNA Sequencing Dr. Serageldeen A. A. Sultan

DNA Sequencing Dr. Serageldeen A. A. Sultan DNA Sequencing Dr. Serageldeen A. A. Sultan PhD in Molecular virology Yamaguchi University, Japan (2010) Lecturer of virology Dept. of Microbiology SVU, Qena, Egypt What is DNA sequencing?

More information

Troubleshooting Guide for DNA Digestion

Troubleshooting Guide for DNA Digestion . FastDigest & CONVENTIONAL RESTRICTION ENZYMES Troubleshooting Guide for Digestion. Inactive.2. protocol.2.2 Improper dilution Incomplete, no Assess activity with control.2 reaction conditions Active

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information

Plasmid Isolation. Prepared by Latifa Aljebali Office: Building 5, 3 rd floor, 5T250

Plasmid Isolation. Prepared by Latifa Aljebali Office: Building 5, 3 rd floor, 5T250 Plasmid Isolation Prepared by Latifa Aljebali Office: Building 5, 3 rd floor, 5T250 Plasmid Plasmids are small, double strand, closed circular DNA molecules. Isolated from bacterial cells. Replicate independently

More information

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites.

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites. 1. A recombinant DNA molecules is one that is a. produced through the process of crossing over that occurs in meiosis b. constructed from DNA from different sources c. constructed from novel combinations

More information

TruePrime Single Cell WGA Kit

TruePrime Single Cell WGA Kit TruePrime SINGLE CELL WGA KIT HANDBOOK TruePrime Single Cell WGA Kit INDEX Legal...4 Intended use...4 Kit contents...5 Shipping and storage...5 Handling...6 Quality control...6 Reagents and equipment to

More information

DNA, RNA, Protein Markers & Cloning Vectors DNA, RNA, Protein Markers & Cloning Vectors DNA, RNA, Protein Markers & Cloning Vectors

DNA, RNA, Protein Markers & Cloning Vectors DNA, RNA, Protein Markers & Cloning Vectors DNA, RNA, Protein Markers & Cloning Vectors DNA, RNA, Protein Markers & DNA, RNA, Protein Markers & 218 BIO BASIC INC. Add: 20 Konrad Crescent, Markham, ON, L3R 8T Canada Tel:(905) 7 93, (800) 313 722 Fax:(905) 7 579 160 Bailey

More information

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.

2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99. 1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence

More information

PrimeSTAR HS DNA Polymerase

PrimeSTAR HS DNA Polymerase Cat. # R010A For Research Use PrimeSTAR HS DNA Polymerase Product Manual Table of Contents I. Description...3 II. III. IV. Components...3 Storage...3 Features...3 V. General Composition of PCR Reaction

More information

TIANquick Mini Purification Kit

TIANquick Mini Purification Kit TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer

More information

RevertAid Premium First Strand cdna Synthesis Kit

RevertAid Premium First Strand cdna Synthesis Kit RevertAid Premium First Strand cdna Synthesis Kit #K1651, #K1652 CERTIFICATE OF ANALYSIS #K1651 Lot QUALITY CONTROL RT-PCR using 100 fg of control GAPDH RNA and GAPDH control primers generated a prominent

More information

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna

All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One mirna qrt-pcr Reagent Kits For quantitative detection of mature mirna All-in-One TM mirna First-Strand cdna Synthesis Kit AMRT-0020 (20 RT reactions), AMRT-0060 (60 RT reactions) Used in combination

More information

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes.

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology has had-and will havemany important

More information

DNA and Forensic Science

DNA and Forensic Science DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief

More information

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise:

HCS604.03 Exercise 1 Dr. Jones Spring 2005. Recombinant DNA (Molecular Cloning) exercise: HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA (Molecular Cloning) exercise: The purpose of this exercise is to learn techniques used to create recombinant DNA or clone genes. You will clone

More information

Guide to using the Bio Rad CFX96 Real Time PCR Machine

Guide to using the Bio Rad CFX96 Real Time PCR Machine Guide to using the Bio Rad CFX96 Real Time PCR Machine Kyle Dobbs and Peter Hansen Table of Contents Overview..3 Setup Reaction Guidelines 4 Starting up the Software 5 Setup Protocol on Software 6 Setup

More information

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011

Genomic DNA Clean & Concentrator Catalog Nos. D4010 & D4011 Page 0 INSTRUCTION MANUAL Catalog Nos. D4010 & D4011 Highlights Quick (5 minute) spin column recovery of large-sized DNA (e.g., genomic, mitochondrial, plasmid (BAC/PAC), viral, phage, (wga)dna, etc.)

More information

Creation of a Bacterial Cell Controlled by a Chemically Synthesized Genome Gibson et al. (2010)

Creation of a Bacterial Cell Controlled by a Chemically Synthesized Genome Gibson et al. (2010) Creation of a Bacterial Cell Controlled by a Chemically Synthesized Genome Gibson et al. (2010) In 1977 Sanger and his colleagues were the first who sequenced the complete DNA genome of a phage. From 1977

More information


Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA Microbiology Laboratory: MOLECULAR IDENTIFICATION OF UNKNOWN BACTERIA Classical Microbiology courses are typically structured to introduce the identification of bacterial species using a series of biochemical

More information

Put the odds in your favor

Put the odds in your favor Reverse Transcription Put the odds in your favor SuperScript III Reverse Transcriptase Reverse Transcription Engineered for performance SuperScript III Reverse Transcriptase (RT) is engineered for reduced

More information

Bio-Reagents Gene synthesis Peptide Synthesis Protein Expression Antibody Production. Life Science Products and Services

Bio-Reagents Gene synthesis Peptide Synthesis Protein Expression Antibody Production. Life Science Products and Services Bio-Reagents Gene synthesis Peptide Synthesis Protein Expression Antibody Production Life Science Products and Services Since 2002, Biomatik has provided worldwide researchers in life science discovery

More information

Technical Bulletin #176. Avoiding DNA Contamination in RT-PCR

Technical Bulletin #176. Avoiding DNA Contamination in RT-PCR 1 of 7 7/12/2007 8:27 PM Shop My Account View Cart nmlkji Products nmlkj Documents Technical Resources > Help Desk > Technical Bulletins Technical Bulletin #176 Avoiding DNA Contamination in RT-PCR A frequent

More information

HighPure Maxi Plasmid Kit

HighPure Maxi Plasmid Kit HighPure Maxi Plasmid Kit For purification of high pure plasmid DNA with high yields PP120109 HighPure Maxi Plasmid Kit Kit Contents Storage DP116 Contents RNaseA (100 mg/ml) Buffer

More information

Worked solutions to student book questions Chapter 13 DNA

Worked solutions to student book questions Chapter 13 DNA Q1. Copy the structural formula of deoxyribose sugar. Now indicate where covalent bonds form to link this group to: a a phosphate group b a base group A1. Q2. Give the sequence of bases that will pair

More information

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA

Chapter 9. Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Chapter 9 Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Q&A Interferons are species specific, so that interferons to be used in humans must be produced in human cells. Can you think

More information

StrataScript One-Tube RT-PCR System with Easy-A High-Fidelity PCR Cloning Enzyme

StrataScript One-Tube RT-PCR System with Easy-A High-Fidelity PCR Cloning Enzyme StrataScript One-Tube RT-PCR System with Easy-A High-Fidelity PCR Cloning Enzyme INSTRUCTION MANUAL Catalog #600168 Revision #056001a For in Vitro Use Only *600168-12_056001a/* LIMITED PRODUCT WARRANTY

More information

Appendix D: Pre-lab Assignments and Gel Electrophoresis Worksheet

Appendix D: Pre-lab Assignments and Gel Electrophoresis Worksheet Appendix D: Pre-lab Assignments and Gel Electrophoresis Worksheet PCR Pre-Lab (pg. 1-3) PCR Pre-Lab Answers (pg. 4-7) RNAi Pre-Lab (pg. 8) RNAi Pre-Lab Answers (pg. 9-10 Gel Electrophoresis Worksheet (pg.

More information

CompleteⅡ 1st strand cdna Synthesis Kit

CompleteⅡ 1st strand cdna Synthesis Kit Instruction Manual CompleteⅡ 1st strand cdna Synthesis Kit Catalog # GM30401, GM30402 Green Mountain Biosystems. LLC Web: Tel: 800-942-1160 Sales: Sales@ Support:

More information


PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR. Results Interpretation Guide PATHOGEN DETECTION SYSTEMS BY REAL TIME PCR Results Interpretation Guide Pathogen Detection Systems by Real Time PCR Microbial offers real time PCR based systems for the detection of pathogenic bacteria

More information

Crime Scenes and Genes

Crime Scenes and Genes Glossary Agarose Biotechnology Cell Chromosome DNA (deoxyribonucleic acid) Electrophoresis Gene Micro-pipette Mutation Nucleotide Nucleus PCR (Polymerase chain reaction) Primer STR (short tandem repeats)

More information


PRELAB DISCUSSION #12 PRELAB DISCUSSION #12 ANNOUNCEMENTS KEY DATES: CH6C Labs: Dec2-8 th CH6 Write-up: pdf due 9 pm the evening before your CH6C Lab and hardcopy due at the beginning of CH6C lab. (The write up template outlining

More information

Beginner s Guide to Real-Time PCR

Beginner s Guide to Real-Time PCR Beginner s Guide to Real-Time PCR 02 Real-time PCR basic principles PCR or the Polymerase Chain Reaction has become the cornerstone of modern molecular biology the world over. Real-time PCR is an advanced

More information

UltraClean PCR Clean-Up Kit

UltraClean PCR Clean-Up Kit UltraClean PCR Clean-Up Kit Catalog No. Quantity 12500-50 50 Preps 12500-100 100 Preps 12500-250 250 Preps Instruction Manual Please recycle Version: 02212013 1 Table of Contents Introduction... 3 Protocol

More information

Wizard Genomic DNA Purification Kit and the Isolation of Plant Genomic DNA

Wizard Genomic DNA Purification Kit and the Isolation of Plant Genomic DNA Wizard Genomic DNA Purification Kit and the Isolation of Plant Genomic DNA ABSTRACT Genomic DNA was isolated from plant leaf tissue using the Wizard Genomic DNA Isolation Kit (Cat.# A1120). Isolated DNA

More information

ab185916 Hi-Fi cdna Synthesis Kit

ab185916 Hi-Fi cdna Synthesis Kit ab185916 Hi-Fi cdna Synthesis Kit Instructions for Use For cdna synthesis from various RNA samples This product is for research use only and is not intended for diagnostic use. Version 1 Last Updated 1

More information

Mir-X mirna First-Strand Synthesis Kit User Manual

Mir-X mirna First-Strand Synthesis Kit User Manual User Manual Mir-X mirna First-Strand Synthesis Kit User Manual United States/Canada 800.662.2566 Asia Pacific +1.650.919.7300 Europe +33.(0)1.3904.6880 Japan +81.(0)77.543.6116 Clontech Laboratories, Inc.

More information


GenCore GENOMICS CORE FACILITY. User Guide. Index GenCore GENOMICS CORE FACILITY User Guide Index. A brief description of the facility 2 2. How to order a service?... 2 a. Registration i. New customer registration ii. Registered customers b. Filling out

More information