1) Orthology of zebrafish HoxD4 and euteleost HoxD4a:
|
|
|
- Esmond Davidson
- 7 years ago
- Views:
Transcription
1 Supplementary Material for Karen D Crow, Peter F. Stadler, Vincent J. Lynch, Chris Amemiya, and Günter P. Wagner The fish specific Hox cluster duplication is coincident with the origin of teleosts. Molecular Biology and Evolution, in press. HoxD4 amino acid sequence analysis Gunter P. Wagner Date document finished: 1/20/05 Objective: analyze the fish HoxD4 genes to clarify whether the fugu/zebrafish HoxD4a are orthologous. Add new sequences one by one, and restrict the analysis to the most critical species to determine orthology of the new sequences. 1) Orthology of zebrafish HoxD4 and euteleost HoxD4a: Approach: use complete amino acid sequences of exon 1 of zebrafish and euteleost genes to establish orthology of zebrafish and euteleost HoxD4a. Sequences: shark (Hfr) HoxD4, coelacanth HoxD4 (Lme), zebrafish HoxD4, pufferfish (Sne) HoxD4a/b, medaka (Ola) HoxD4a/b, fugu (Tru) HoxD4b (8 sequences) ClustalW amino acid alignment yields a good alignment, with few corrections necessary. For analysis I used the file D4ab_aaAligNoGap.phy. The original alignment is 150 positions, the no-gap alignment is 127 amino acid positions. The analysis was done with the protein sequence algorithms of Phylip3.6 (NJ, MP, ML). Results: In all analysis the zebrafish HoxD4 gene groups with the a-clade of euteleosts. The bootstrap support is reasonable (77/70/57) for (NJ/MP/ML). Hence it is most likely that the zebrafish HoxD4 gene is orthologous to HoxD4a. This is consistent with the HoxD9 result of Prohaska and Stadler (2004).
2 NJ:
3 MP:
4 ML:
5 2) Identity of elopomorph genes: For both elopomorph species, tarpon and eel, we obtained two paralogs. The orthology of these genes was investigated with an alignment of the known zebrafish and euteleost genes and the four elopomorph sequences. The file is D4ab_aaAroMat copy.phy. In all analyses the four elopomorph sequences form a clade nested in the HoxD4a clade with support values (97/86/74). Hence the elopomorph paralogs are probably the result of a gene duplication which happened after the split of the zebrafish and the elopomorph lineage but before the split of the eel and tarop lineage. NJ: 84 Aro3D4a MatD4a MatD AroD4n
6 MP: 81 MatD4a AroD4n1 86 Aro3D4an MatD
7 ML: 50 MatD4a AroD4n1 74 Aro3D4an MatD
8 3) The orthology of Hiodon paralogs: From the goldeye two genes were found and compared to the known HoxD4a/b sequences and outgroups, shark and coelacanth(d4ab_aahalnogap copy.phy). The trees support an affiliation of one of the Hiodon sequences with the HoxD4a and HoxD4b clade respectively, suggesting orthology. In this analysis the most significant observation is the association of the HalD4b gene with the euteleost HoxD4b genes, because the association of the other paralog with the HoxD4a clade could in principle be artifactual, as the clustering of the coelacanth sequence shows. NJ: HalD4b HalD4a
9 MP: HalD4a HalD4b 99 9
10 ML: HalD4b HalD4a
11 4) The orthology of Amia HoxD4 gene: One sequence was recovered from bowfin (D4ab_aaAcaLme copy.phy). This sequence is consistently placed inside the HoxD4a clade, but this result is certainly artifactual because even when the duplication occurred before the split of the Amia/Teleost lineage one would predict the Amia sequence to diverge before the zebrafish sequence, because the monophyly of teleosts is not in question. In summary this data is not able to constrain the duplication event downwards. On the other hand it also does not provide evidence for a duplication date different from that suggested by the HoxA11 and HoxB5 data. NJ: 74 AcaD
12 MP: AcaD OlaD
13 ML: AcaD
14 Conclusions: The zebrafish HoxD4 gene is orthologous to HoxD4a. The two paralogs of Hiodon are orthologous to the HoxD4a and HoxD4b respectively, i.e. the duplication occurred before the most recent common ancestor of teleosts. The two paralogs of HoxD4 genes recovered in this study arose through one additional duplication event in the stem of the elopomorph clade. The present analysis cannot decide whether the duplication occurred after the most recent common ancestor of Amia and teleosts, but it also does not contain any evidence against a duplication along with HoxA11 and HoxB5. 14
Phylogenetic Trees Made Easy
Phylogenetic Trees Made Easy A How-To Manual Fourth Edition Barry G. Hall University of Rochester, Emeritus and Bellingham Research Institute Sinauer Associates, Inc. Publishers Sunderland, Massachusetts
Introduction to Phylogenetic Analysis
Subjects of this lecture Introduction to Phylogenetic nalysis Irit Orr 1 Introducing some of the terminology of phylogenetics. 2 Introducing some of the most commonly used methods for phylogenetic analysis.
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 matthewb@ba.ars.usda.gov
Protein Sequence Analysis - Overview -
Protein Sequence Analysis - Overview - UDEL Workshop Raja Mazumder Research Associate Professor, Department of Biochemistry and Molecular Biology Georgetown University Medical Center Topics Why do protein
Bayesian Phylogeny and Measures of Branch Support
Bayesian Phylogeny and Measures of Branch Support Bayesian Statistics Imagine we have a bag containing 100 dice of which we know that 90 are fair and 10 are biased. The
An ancestral MADS-box gene duplication occurred before the divergence of plants and animals
An ancestral MADS-box gene duplication occurred before the divergence of plants and animals Elena R. Alvarez-Buylla*, Soraya Pelaz*, Sarah J. Liljegren*, Scott E. Gold*, Caroline Burgeff, Gary S. Ditta*,
Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6
Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 In the last lab, you learned how to perform basic multiple sequence alignments. While useful in themselves for determining conserved residues
DNA Sequence Alignment Analysis
Analysis of DNA sequence data p. 1 Analysis of DNA sequence data using MEGA and DNAsp. Analysis of two genes from the X and Y chromosomes of plant species from the genus Silene The first two computer classes
Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Chapter 17 Practice Multiple Choice Identify the choice that best completes the statement or answers the question. 1. The correct order for the levels of Linnaeus's classification system,
This is a series of skulls and front leg fossils of organisms believed to be ancestors of the modern-day horse.
Evidence of Evolution Background When Charles Darwin first proposed the idea that all new species descend from an ancestor, he performed an exhaustive amount of research to provide as much evidence as
MAKING AN EVOLUTIONARY TREE
Student manual MAKING AN EVOLUTIONARY TREE THEORY The relationship between different species can be derived from different information sources. The connection between species may turn out by similarities
ID of alternative translational initiation events. Description of gene function Reference of NCBI database access and relative literatures
Data resource: In this database, 650 alternatively translated variants assigned to a total of 300 genes are contained. These database records of alternative translational initiation have been collected
Supporting Online Material for
www.sciencemag.org/cgi/content/full/312/5781/1762/dc1 Supporting Online Material for Silk Genes Support the Single Origin of Orb Webs Jessica E. Garb,* Teresa DiMauro, Victoria Vo, Cheryl Y. Hayashi *To
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
Biological Sequence Data Formats
Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA
PHYLOGENETIC ANALYSIS
Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins, Second Edition Andreas D. Baxevanis, B.F. Francis Ouellette Copyright 2001 John Wiley & Sons, Inc. ISBNs: 0-471-38390-2 (Hardback);
Scaling the gene duplication problem towards the Tree of Life: Accelerating the rspr heuristic search
Scaling the gene duplication problem towards the Tree of Life: Accelerating the rspr heuristic search André Wehe 1 and J. Gordon Burleigh 2 1 Department of Computer Science, Iowa State University, Ames,
Name Class Date. binomial nomenclature. MAIN IDEA: Linnaeus developed the scientific naming system still used today.
Section 1: The Linnaean System of Classification 17.1 Reading Guide KEY CONCEPT Organisms can be classified based on physical similarities. VOCABULARY taxonomy taxon binomial nomenclature genus MAIN IDEA:
Worksheet - COMPARATIVE MAPPING 1
Worksheet - COMPARATIVE MAPPING 1 The arrangement of genes and other DNA markers is compared between species in Comparative genome mapping. As early as 1915, the geneticist J.B.S Haldane reported that
Bioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: msm_eng@k-space.org
BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,
A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML
9 June 2011 A Step-by-Step Tutorial: Divergence Time Estimation with Approximate Likelihood Calculation Using MCMCTREE in PAML by Jun Inoue, Mario dos Reis, and Ziheng Yang In this tutorial we will analyze
A short guide to phylogeny reconstruction
A short guide to phylogeny reconstruction E. Michu Institute of Biophysics, Academy of Sciences of the Czech Republic, Brno, Czech Republic ABSTRACT This review is a short introduction to phylogenetic
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Milk protein genetic variation in Butana cattle
Milk protein genetic variation in Butana cattle Ammar Said Ahmed Züchtungsbiologie und molekulare Genetik, Humboldt Universität zu Berlin, Invalidenstraβe 42, 10115 Berlin, Deutschland 1 Outline Background
Supplementary material: A benchmark of multiple sequence alignment programs upon structural RNAs Paul P. Gardner a Andreas Wilm b Stefan Washietl c
Supplementary material: A benchmark of multiple sequence alignment programs upon structural RNAs Paul P. Gardner a Andreas Wilm b Stefan Washietl c a Department of Evolutionary Biology, University of Copenhagen,
Inferred thermophily of the last universal ancestor based on estimated
1 Inferred thermophily of the last universal ancestor based on estimated amino acid composition Dawn J. Brooks and Eric A. Gaucher Address: Foundation for Applied Molecular Evolution, Gainesville, Florida
Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at
Woods Hole Zebrafish Genetics and Development Bioinformatics/Genomics Lab Ian Woods Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at http://faculty.ithaca.edu/iwoods/docs/wh/
Introduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
Evidence for evolution factsheet
The theory of evolution by natural selection is supported by a great deal of evidence. Fossils Fossils are formed when organisms become buried in sediments, causing little decomposition of the organism.
Name: Date: Problem How do amino acid sequences provide evidence for evolution? Procedure Part A: Comparing Amino Acid Sequences
Name: Date: Amino Acid Sequences and Evolutionary Relationships Introduction Homologous structures those structures thought to have a common origin but not necessarily a common function provide some of
Maximum-Likelihood Estimation of Phylogeny from DNA Sequences When Substitution Rates Differ over Sites1
Maximum-Likelihood Estimation of Phylogeny from DNA Sequences When Substitution Rates Differ over Sites1 Ziheng Yang Department of Animal Science, Beijing Agricultural University Felsenstein s maximum-likelihood
Lab 2/Phylogenetics/September 16, 2002 1 PHYLOGENETICS
Lab 2/Phylogenetics/September 16, 2002 1 Read: Tudge Chapter 2 PHYLOGENETICS Objective of the Lab: To understand how DNA and protein sequence information can be used to make comparisons and assess evolutionary
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
Crime Scene Investigation (Adopted from Forensics in the Classroom developed by Court TV)
Crime Scene Investigation (Adopted from Forensics in the Classroom developed by Court TV) The case: Last night, the school cafeteria was vandalized; the kitchen area was broken into, several appliances
Genome Explorer For Comparative Genome Analysis
Genome Explorer For Comparative Genome Analysis Jenn Conn 1, Jo L. Dicks 1 and Ian N. Roberts 2 Abstract Genome Explorer brings together the tools required to build and compare phylogenies from both sequence
Extensive Cryptic Diversity in Indo-Australian Rainbowfishes Revealed by DNA Barcoding
Extensive Cryptic Diversity in Indo-Australian Rainbowfishes Revealed by DNA Barcoding Kadarusman, Hubert N, Hadiaty R.K #, Sudarto, Paradis E., Pouyaud L. Akademi Perikanan Sorong, Papua Barat, Indonesia
PHYLOGENY AND EVOLUTION OF NEWCASTLE DISEASE VIRUS GENOTYPES
Eötvös Lóránd University Biology Doctorate School Classical and molecular genetics program Project leader: Dr. László Orosz, corresponding member of HAS PHYLOGENY AND EVOLUTION OF NEWCASTLE DISEASE VIRUS
Hidden Markov Models in Bioinformatics. By Máthé Zoltán Kőrösi Zoltán 2006
Hidden Markov Models in Bioinformatics By Máthé Zoltán Kőrösi Zoltán 2006 Outline Markov Chain HMM (Hidden Markov Model) Hidden Markov Models in Bioinformatics Gene Finding Gene Finding Model Viterbi algorithm
Efficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing
Efficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing James D. Jackson Philip J. Hatcher Department of Computer Science Kingsbury Hall University of New Hampshire Durham,
BIOINFORMATICS TUTORIAL
Bio 242 BIOINFORMATICS TUTORIAL Bio 242 α Amylase Lab Sequence Sequence Searches: BLAST Sequence Alignment: Clustal Omega 3d Structure & 3d Alignments DO NOT REMOVE FROM LAB. DO NOT WRITE IN THIS DOCUMENT.
Visualization of Phylogenetic Trees and Metadata
Visualization of Phylogenetic Trees and Metadata November 27, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com
Principles of Evolution - Origin of Species
Theories of Organic Evolution X Multiple Centers of Creation (de Buffon) developed the concept of "centers of creation throughout the world organisms had arisen, which other species had evolved from X
DnaSP, DNA polymorphism analyses by the coalescent and other methods.
DnaSP, DNA polymorphism analyses by the coalescent and other methods. Author affiliation: Julio Rozas 1, *, Juan C. Sánchez-DelBarrio 2,3, Xavier Messeguer 2 and Ricardo Rozas 1 1 Departament de Genètica,
2.3 Identify rrna sequences in DNA
2.3 Identify rrna sequences in DNA For identifying rrna sequences in DNA we will use rnammer, a program that implements an algorithm designed to find rrna sequences in DNA [5]. The program was made by
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Biological kinds and the causal theory of reference
Biological kinds and the causal theory of reference Ingo Brigandt Department of History and Philosophy of Science 1017 Cathedral of Learning University of Pittsburgh Pittsburgh, PA 15260 E-mail: inb1@pitt.edu
The Central Dogma of Molecular Biology
Vierstraete Andy (version 1.01) 1/02/2000 -Page 1 - The Central Dogma of Molecular Biology Figure 1 : The Central Dogma of molecular biology. DNA contains the complete genetic information that defines
Bio-Informatics Lectures. A Short Introduction
Bio-Informatics Lectures A Short Introduction The History of Bioinformatics Sanger Sequencing PCR in presence of fluorescent, chain-terminating dideoxynucleotides Massively Parallel Sequencing Massively
Interaktionen von Nukleinsäuren und Proteinen
Sonja Prohaska Computational EvoDevo Universitaet Leipzig June 9, 2015 DNA is never naked in a cell DNA is usually in association with proteins. In all domains of life there are small, basic chromosomal
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
PHYML Online: A Web Server for Fast Maximum Likelihood-Based Phylogenetic Inference
PHYML Online: A Web Server for Fast Maximum Likelihood-Based Phylogenetic Inference Stephane Guindon, F. Le Thiec, Patrice Duroux, Olivier Gascuel To cite this version: Stephane Guindon, F. Le Thiec, Patrice
EMBL-EBI Web Services
EMBL-EBI Web Services Rodrigo Lopez Head of the External Services Team SME Workshop Piemonte 2011 EBI is an Outstation of the European Molecular Biology Laboratory. Summary Introduction The JDispatcher
Searching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
Sequence Analysis 15: lecture 5. Substitution matrices Multiple sequence alignment
Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's dilemma To understand... Multiple sequence alignment Substitution matrices Phylogenetic trees You first need
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
The Quixote Project: a pioneering work in managing Computational Chemistry research data
1 The Quixote Project: a pioneering work in managing Computational Chemistry research data Pablo Echenique http://www.pabloechenique.com echenique.p@gmail.com 2 The protein folding problem Folding Native
Year 10: The transmission of heritable characteristics from one generation to the next involves DNA
1 Overview In this activity, students identify an unknown code (Activity 1) and then apply it to identify the message in an unknown text (Activity 2). Discussion questions consolidate the learning,and
Network Protocol Analysis using Bioinformatics Algorithms
Network Protocol Analysis using Bioinformatics Algorithms Marshall A. Beddoe Marshall_Beddoe@McAfee.com ABSTRACT Network protocol analysis is currently performed by hand using only intuition and a protocol
An Overview of Cells and Cell Research
An Overview of Cells and Cell Research 1 An Overview of Cells and Cell Research Chapter Outline Model Species and Cell types Cell components Tools of Cell Biology Model Species E. Coli: simplest organism
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:
Regents Biology REGENTS REVIEW: PROTEIN SYNTHESIS
Period Date REGENTS REVIEW: PROTEIN SYNTHESIS 1. The diagram at the right represents a portion of a type of organic molecule present in the cells of organisms. What will most likely happen if there is
Which Are the Largest Genes?
26 C H A P T E R T H R E E Which Are the Largest Genes? Many human genes extend across chromosomal segments that are much larger than needed for their protein-coding regions. The genes with the largest
Pairwise Sequence Alignment
Pairwise Sequence Alignment carolin.kosiol@vetmeduni.ac.at SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
Human Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
A branch-and-bound algorithm for the inference of ancestral. amino-acid sequences when the replacement rate varies among
A branch-and-bound algorithm for the inference of ancestral amino-acid sequences when the replacement rate varies among sites Tal Pupko 1,*, Itsik Pe er 2, Masami Hasegawa 1, Dan Graur 3, and Nir Friedman
Systematics - BIO 615
Outline - and introduction to phylogenetic inference 1. Pre Lamarck, Pre Darwin Classification without phylogeny 2. Lamarck & Darwin to Hennig (et al.) Classification with phylogeny but without a reproducible
Graph theoretic approach to analyze amino acid network
Int. J. Adv. Appl. Math. and Mech. 2(3) (2015) 31-37 (ISSN: 2347-2529) Journal homepage: www.ijaamm.com International Journal of Advances in Applied Mathematics and Mechanics Graph theoretic approach to
Survey of clinical data mining applications on big data in health informatics
Survey of clinical data mining applications on big data in health informatics Matthew Herland, Taghi M. Khoshgoftaar, and Randall Wald 劉 俊 成 Survey of clinical data mining applications on big data in health
Keywords: evolution, genomics, software, data mining, sequence alignment, distance, phylogenetics, selection
Sudhir Kumar has been Director of the Center for Evolutionary Functional Genomics in The Biodesign Institute at Arizona State University since 2002. His research interests include development of software,
Consequences of genome duplication Marie Sémon and Kenneth H Wolfe
Consequences of genome duplication Marie Sémon and Kenneth H Wolfe Polyploidy has been widely appreciated as an important force in the evolution of plant genomes, but now it is recognized as a common phenomenon
Heuristics for the Gene-duplication Problem: A Θ(n) Speed-up for the Local Search
Heuristics for the Gene-duplication Problem: A Θ(n) Speed-up for the Local Search M. S. Bansal 1, J. G. Burleigh 2, O. Eulenstein 1, and A. Wehe 3 1 Department of Computer Science, Iowa State University,
The evolution of HOM-C homeoboxes in the Dipteran
Insect Molecular Biology (2003) 12(4), 345 351 The evolution of HOM-C homeoboxes in the Dipteran Blackwell Publishing Ltd. family Drosophilidae R. DeSalle*, M. A. Branham*, P. O Grady* and J. Gatesy *Division
UCHIME in practice Single-region sequencing Reference database mode
UCHIME in practice Single-region sequencing UCHIME is designed for experiments that perform community sequencing of a single region such as the 16S rrna gene or fungal ITS region. While UCHIME may prove
Arbres formels et Arbre(s) de la Vie
Arbres formels et Arbre(s) de la Vie A bit of history and biology Definitions Numbers Topological distances Consensus Random models Algorithms to build trees Basic principles DATA sequence alignment distance
Section 3 Comparative Genomics and Phylogenetics
Section 3 Section 3 Comparative enomics and Phylogenetics At the end of this section you should be able to: Describe what is meant by DNA sequencing. Explain what is meant by Bioinformatics and Comparative
Bob Jesberg. Boston, MA April 3, 2014
DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double
A Rough Guide to BEAST 1.4
A Rough Guide to BEAST 1.4 Alexei J. Drummond 1, Simon Y.W. Ho, Nic Rawlence and Andrew Rambaut 2 1 Department of Computer Science The University of Auckland, Private Bag 92019 Auckland, New Zealand alexei@cs.auckland.ac.nz
13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
Guide for Bioinformatics Project Module 3
Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first
Mechanisms of Evolution
page 2 page 3 Teacher's Notes Mechanisms of Evolution Grades: 11-12 Duration: 28 mins Summary of Program Evolution is the gradual change that can be seen in a population s genetic composition, from one
MEGA. Molecular Evolutionary Genetics Analysis VERSION 4. Koichiro Tamura, Joel Dudley Masatoshi Nei, Sudhir Kumar
MEGA Molecular Evolutionary Genetics Analysis VERSION 4 Koichiro Tamura, Joel Dudley Masatoshi Nei, Sudhir Kumar Center of Evolutionary Functional Genomics Biodesign Institute Arizona State University
Gene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
Classification/Decision Trees (II)
Classification/Decision Trees (II) Department of Statistics The Pennsylvania State University Email: jiali@stat.psu.edu Right Sized Trees Let the expected misclassification rate of a tree T be R (T ).
Distributed Bioinformatics Computing System for DNA Sequence Analysis
Global Journal of Computer Science and Technology: A Hardware & Computation Volume 14 Issue 1 Version 1.0 Type: Double Blind Peer Reviewed International Research Journal Publisher: Global Journals Inc.
Molecular Databases and Tools
NWeHealth, The University of Manchester Molecular Databases and Tools Afternoon Session: NCBI/EBI resources, pairwise alignment, BLAST, multiple sequence alignment and primer finding. Dr. Georgina Moulton
Inference of Large Phylogenetic Trees on Parallel Architectures. Michael Ott
Inference of Large Phylogenetic Trees on Parallel Architectures Michael Ott TECHNISCHE UNIVERSITÄT MÜNCHEN Lehrstuhl für Rechnertechnik und Rechnerorganisation / Parallelrechnerarchitektur Inference of
Building a phylogenetic tree
bioscience explained 134567 Wojciech Grajkowski Szkoła Festiwalu Nauki, ul. Ks. Trojdena 4, 02-109 Warszawa Building a phylogenetic tree Aim This activity shows how phylogenetic trees are constructed using
Phylogenetic relationships among Staphylococcus species and refinement of cluster groups based on multilocus data
Lamers et al. BMC Evolutionary Biology 2012, 12:171 RESEARCH ARTICLE Open Access Phylogenetic relationships among Staphylococcus species and refinement of cluster groups based on multilocus data Ryan P
Discovering Bioinformatics
Discovering Bioinformatics Sami Khuri Natascha Khuri Alexander Picker Aidan Budd Sophie Chabanis-Davidson Julia Willingale-Theune English version ELLS European Learning Laboratory for the Life Sciences
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD
White Paper SGI High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems Haruna Cofer*, PhD January, 2012 Abstract The SGI High Throughput Computing (HTC) Wrapper
Module 3. Genome Browsing. Using Web Browsers to View Genome Annota4on. Kers4n Howe Wellcome Trust Sanger Ins4tute zfish- help@sanger.ac.
Module 3 Genome Browsing Using Web Browsers to View Genome Annota4on Kers4n Howe Wellcome Trust Sanger Ins4tute zfish- help@sanger.ac.uk Introduc.on Genome browsing The Ensembl gene set Guided examples
Outline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction
Outline MicroRNA Bioinformatics Rickard Sandberg Dept. of Cell and Molecular Biology (CMB) Karolinska Institutet! Introduction! microrna target site prediction! Useful resources 2 short non-coding RNAs
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
RNA and Protein Synthesis
Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic
Bayesian coalescent inference of population size history
Bayesian coalescent inference of population size history Alexei Drummond University of Auckland Workshop on Population and Speciation Genomics, 2016 1st February 2016 1 / 39 BEAST tutorials Population
Lecture/Recitation Topic SMA 5303 L1 Sampling and statistical distributions
SMA 50: Statistical Learning and Data Mining in Bioinformatics (also listed as 5.077: Statistical Learning and Data Mining ()) Spring Term (Feb May 200) Faculty: Professor Roy Welsch Wed 0 Feb 7:00-8:0
Unraveling protein networks with Power Graph Analysis
Unraveling protein networks with Power Graph Analysis PLoS Computational Biology, 2008 Loic Royer Matthias Reimann Bill Andreopoulos Michael Schroeder Schroeder Group Bioinformatics 1 Complex Networks
many diverse adaptations to life -
Introduction to Fish Biology About 25,000 species of fish have been described this is the most numerous group of vertebrates approximately 45%-50% of all vertebrate species are fish dominant life form