Which Are the Largest Genes?
|
|
|
- Marianna Strickland
- 10 years ago
- Views:
Transcription
1 26 C H A P T E R T H R E E Which Are the Largest Genes? Many human genes extend across chromosomal segments that are much larger than needed for their protein-coding regions. The genes with the largest transcribed regions in the human genome are listed below in descending order. Gene Gene Size (Mb) RNA Size (kb) Protein/Function CNTNAP Caspr2 protein DMD dystrophin C20orf CSMD LRP1B lipoprotein receptor family CTNNA α-catenin 3 A2BP ataxin 2 binding protein FHIT dinucleoside triphosphate hydrolase GPC glypican 5 DLG chapsyn-110 GRID glutamate receptor NRXN neurexin 3 MAGI membrane guanylate kinase PARK parkin IL1RAPL receptor accessory protein CNTN contactin 5 DAB Drosophila disabled homolog 1 ANKS1B cajalin-2 GALNT N-acetylgalactosaminyltransferase PRKG protein kinase CSMD IL1RAPL receptor accessory protein AUTS DCC netrin receptor GPC glypican 6 CDH cadherin 13 ERBB EGF receptor family SGCZ ζ-sarcoglycan CTNNA α-catenin 2 SPAG sperm antigen OPCML PTPRT protein tyrosine phosphatase NRG neuregulin 3 NRXN neurexin 1 CDH cadherin 12 ALS2CR tight junction protein PTPRN protein tyrosine phosphatase SOX transcription factor TCBA Genes for Largest Proteins TTN titin MUC mucin 16
2 G E N E S 27 In this table, the size of each gene ( Gene Size column) is the genomic span of its largest unspliced transcript. The RNA Size column shows the size of the corresponding spliced product. For comparison, the gene sizes for the two largest proteins are included. The contrast between the largest genes and the genes for the largest proteins is quite dramatic in terms of the fraction of the gene that is present in the mature RNA. The chromosomal locations of all of the largest genes listed in the table are shown below. The genes are drawn to scale, with the very largest ones visible as open boxes on the chromosomes. They are widely distributed, but none are present on the chromosomes with the highest gene densities (17, 19, and 22). In a few cases, genes from the same family are linked (e.g., GPC5 and GPC6 on chromosome 13).
3 28 C H A P T E R T H R E E Many of these large genes have functions in the nervous system. Many are members of small gene families, and in some cases, the genes for the other family members are much smaller. For example, CNTNAP2, the largest gene (2.30 Mb), is in a family with four other genes that range in size from 0.89 Mb to fewer than 0.02 Mb, but all family members (including CNTNAP2) encode similarly sized proteins. Another example is the neurexin gene family: Two neurexin genes (NRXN3 and NRXN1) are listed in the table, and a third family member encodes a similar-sized transcript (compared to those in the table) but is fewer than 0.12 Mb (about onetenth of the size). A third example is the family of six glypican genes, which produce transcripts in the same size range and encode proteins very close in size. Again, two of the family members are listed in the table (GPC5 and GPC6). The other four glypican family genes range in size from 0.45 Mb to fewer than 0.01 Mb. Data Sources, Methods, and References The table and figure were built using the gene location information and chromosomal coordinates in release 36.2 of the human genome reference sequence. All genes greater than 1 Mb are reported, except for SMA4 (1.04 Mb; the RefSeq entry has been removed) and the hypothetical protein LOC (1.97 Mb; a small protein with many ambiguous positions). Gene sizes were rounded to the nearest 10 kb. The transcript (RNA) sizes were rounded to the nearest 0.1 kb. In cases in which multiple transcripts spanned the same-sized genomic region, the one with the smaller mature transcript was selected. The transcript sizes may underestimate the 5 UTR and may include a longer 3 UTR than is typical for certain genes (see p. 40 for details). For the very large genes, these errors may be significant for the transcript size, but have limited effect on the overall gene size.
4 32 C H A P T E R T H R E E What Is the Size of a Typical Exon? Exon sizes are quite variable. Generalizing about them is not appropriate because various categories of exons are quite different in size. The table below presents typical sizes for four classes of exons. For the selected set of transcripts, the median number of exons was 8 and the distribution had a mode of 4. Median Size Mean Size Type of Exon Count of Exon (bp) of Exon (bp) Single-exon genes First exon in gene 16, Middle exon in gene 150, Last exon in gene 16, Middle exons (the largest class of exons) are the smallest. The last exons (3 ends) are much larger than the first exons (5 ends). Single-exon genes are typically much larger than the terminal exons of intron-containing genes. In all cases, the mean values were driven by some very large examples, and for the terminal exons, the difference between the means and medians is larger. It is difficult to establish the sizes of extremely large and small exons. The genome is incompletely annotated, especially with regard to the UTRs (see p. 40 for details). Therefore, the sizes of some reported first exons may be underestimates, or the reported first exons may prove to be internal exons. Some of the last exons may have alternate polyadenylation signals that would produce shorter products. Data Sources, Methods, and References The set of transcripts used for this table was also used to produce the figures related to exon counts on page 30 (one transcript per gene was considered; predicted transcripts and genes without UTRs were excluded). All nonterminal exons in genes with three or more exons were classified as middle exons. Means were rounded to whole nucleotides. See also: Hawkins J.D A survey on intron and exon lengths. Nucleic Acids Res. 16:
5 G E N E F A M I L I E S 107 Which Are the Important Residues in the Homeobox? The homeobox transcription factor family includes about 190 genes (see the notes at the end of this section) with varying levels of sequence conservation. While these genes vary considerably in size, generally, they can easily be identified by the conserved homeobox domain. In the figure below, 28 family members were assembled to show the diversity of amino acids found at various positions in the homeobox domain. Darker boxes indicate higher levels of amino acid usage at a given position (a black box indicates complete conservation across the selected set of proteins). Some homeobox family members align over longer regions than the 57-aa segment shown in the figure. As shown in the figure, many positions have conserved basic amino acids, including those at the ends. In this set, there are completely conserved glutamine, phenylalanine, and tyrosine residues at positions 11, 19, and 24, respectively. Another conserved segment is the sequence of tryptophan, phenylalanine, glutamine, and asparagine, which spans positions 47 to 50 and is present in more than two-thirds of the entire family. In one small branch of the family (BARX1 and related genes), the phenylalanine at position 48 is a tyrosine. The most common variation at position 49 is a change from glutamine to lysine (this occurs in the pituitary [PITX] and sine oculis [SIX] homeobox types).
6 108 C H A P T E R S E V E N The POU family is a diverged group of homeobox proteins. All members of this family, except for a single predicted gene, have a conserved cysteine instead of a glutamine at position 49 of the homeodomain. As shown in the following figure, some of the other conserved residues in the more common homeobox types are also different in the POU proteins. Data Sources, Methods, and References The estimate of 190 genes includes the 39 HOX genes and many more diverged family members, but not the related POU family, which has 15 genes (see p. 105). The proteins used in the first figure were BAPX1, DLX1, DLX2, DLX3, DLX4, DLX5, DLX6, EMX1, EMX2, EVX1, GBX2, HOXC4, HOXB4, HOXA4, HOXD4, HLXB9, HMX1, HMX2, IPF1, LBX1, MEOX1, MEOX2, MSX1, MSX2, RAX, TLX1, TLX2, and TLX3. The aligned regions were assembled using NCBI BLAST and the query sequence DLX1. The selected proteins produced ungapped alignments for the 57-aa region shown. For the second figure, all of the POU family members except POU5F2 (FLJ25680) were used. Two of the proteins did not align with the query POU1F1 at the final position using NCBI BLAST , and those were added manually. Coordinates in both figures relate to the sequence alignments, not the complete proteins.
7 M O B I L E E L E M E N T S A N D R E A R R A N G I N G G E N E S 119 Which Types of L1 Elements Are Present in the Genome? The L1 family is the most abundant of the LINE-type elements. Approximately 900,000 L1-related regions have been annotated onto the chromosomes. When adjacent or overlapping L1 annotations are merged (see the details at the end of this section), this total is reduced to about 800,000 segments. Most L1 sequences fall into two subtypes based on their taxonomic distribution: mammalian (about 661,000) and primate (about 154,000). A third subtype, the human L1 elements, are much less numerous (a little over 1000). The figure below shows the size distribution of these three subtypes. For each subtype, the plot shows the cumulative number of segments that are smaller than the indicated size (50% on the y-axis indicates the median). Most L1 sequences are relatively small fragments that have been generated by incomplete reverse transcription or by rearrangements of the genome. The latter mechanism can be used to infer the age of transposition events. The older mammalian subtypes are typically smaller than the primate subtypes. Virtually all mammalian subtype segments are smaller than 3 kb. Although most of the primate subtypes are present as small fragments, a significant number are greater than 3 kb, and a small fraction is a little over 6 kb, the size of a complete element. For the L1 human subtypes, about 30% of the elements are near full-length. Segments larger than unit size likely arose by the transposition of segments into existing elements or by other rearrangements that yielded similar structures. In the following figure, the size and chromosomal distribution of the L1 human subtypes is presented. Each segment is plotted at the position corresponding to its size and chromosomal assignment. Near-full-length elements are present on most of
8 120 C H A P T E R E I G H T the chromosomes. Few human L1 segments are present on the most gene-rich chromosomes, but some large copies are present. Data Sources, Methods, and References The figures in this section were generated from the table of repeats annotated onto release 36.2 of the reference genome sequence. All entries with names beginning with L1 were collected. Because of the methods used during the annotation process, adjacent or overlapping segments may have related annotations. In this analysis, such segments were merged, regardless of orientation. Because some classes of transposons have inverted repeats, this approach is helpful in trying to detect larger functional units. As indicated above, this reduced the count of L1-related segments by about 100,000. The first figure presents the integrals of the histograms for the mammalian, primate, and human L1 elements (after merging the segments with the related annotations L1M, L1P, and L1HS, respectively). For the mammalian and primate subtypes, a few of the merged copies were much larger than unit size. These were used when the counts were normalized, but they are not shown because the plots were truncated at 7500 bp. For the second figure, there were a total of 1171 human L1 segments, 1089 of which were 100 bp or larger and 685 of which were 1000 bp or larger. These numbers reflect the merge of overlapping segments and related annotations. See also: Salem A.H. et al LINE-1 preta elements in the human genome. J. Mol. Biol. 326:
9 C O M P A R A T I V E G E N O M I C S 151 How Similar Are Human Proteins to Those in Other Species? Different types of human proteins have quite different degrees of sequence similarity to their counterparts in other species. Some examples are shown in the figure below. The proteins used were ACTG1 (γ1 actin), CS (citrate synthase), PIGA (in the GPI anchoring pathway), PRIM1 (DNA primase subunit), and CDC23 (anaphase promoting complex subunit). These proteins produce relatively straightforward plots related to evolutionary distance and the intrinsic conservation of protein function. Some examples presented in later sections are more complex (see pp. 157 and 160). Just as related sequences in other species may perform different functions, the absence of related sequences in other species does not indicate that the other species lacks those functions. This is readily shown with the enzymes of the glycolytic pathway, which are some of the most widely distributed metabolic enzymes. Although the counterparts for human glycolytic enzymes can be easily identified in other vertebrates and in Drosophila, the corresponding enzymes in other species frequently have unrelated sequences. The table on the following page summarizes the results of BLASTP searches of proteins from C. elegans and selected microbial species starting with human sequences for the glycolytic enzymes. In the majority of cases, a related sequence is readily identified ( yes in the table). In each species, at least one of the glycolytic enzymes is not readily found. However, these species do have enzymes for the steps (see the details at
10 152 C H A P T E R T E N the end of this section). The match to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in A. pernix is relatively weak and might not be identified without additional sequence comparisons beyond that with the human GAPDH sequence. Human Enzyme C. elegans S. cerevisiae E. coli A. pernix glucose phosphate isomerase yes yes yes no phosphofructokinase yes yes yes no aldolase yes no no no triosephosphate isomerase yes yes yes no glyceraldehyde-3-phosphate dehydrogenase yes yes yes very weak phosphoglycerate kinase yes yes yes yes phosphoglycerate mutase no yes yes no enolase yes yes yes yes pyruvate kinase yes yes yes yes Several human glycolytic enzymes are encoded by small gene families, but their members are closely related and do not affect the results significantly. The spermexpressed GAPDHS protein produces even weaker matches than GAPDH in A. pernix. Small gene families are sometimes found in the comparative species. There are many differences in the glycolytic enzymes of eukaryotes and archaea. In later sections, a number of important similarities between eukaryotes and archaea are described (see pp ). Data Sources, Methods, and References The method used to generate the points for the plot began with HSP scores from BLASTP (from NCBI BLAST 2.211). The y-axis is the ratio of the BLASTP score obtained with the best-matching protein in another species to the score from the self-match (both scores were adjusted as described in chapter 1). The scale on the x- axis is arbitrary and is not related to any measure of evolutionary relatedness. The sequences for the enzymes in the table that were not readily identified via BLASTP are as follows: GI: (A. pernix phosphoglucose/phosphomannose isomerase), GI: (likely A. pernix phosphofructokinase, note also GI: ), GI: (S. cerevisiae aldolase), GI: (E. coli aldolase class I; this species also has a class II enzyme), GI: (A. pernix aldolase class I; this species may also have a class II aldolase), GI: (A. pernix triose phosphate isomerase), GI: (C. elegans phosphoglycerate mutase), and GI: (A. pernix phosphoglycerate mutase).
Introduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
Gene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals
Systematic discovery of regulatory motifs in human promoters and 30 UTRs by comparison of several mammals Xiaohui Xie 1, Jun Lu 1, E. J. Kulbokas 1, Todd R. Golub 1, Vamsi Mootha 1, Kerstin Lindblad-Toh
Human Genome Organization: An Update. Genome Organization: An Update
Human Genome Organization: An Update Genome Organization: An Update Highlights of Human Genome Project Timetable Proposed in 1990 as 3 billion dollar joint venture between DOE and NIH with 15 year completion
Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
PrimePCR Assay Validation Report
Gene Information Gene Name sorbin and SH3 domain containing 2 Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID SORBS2 Human Arg and c-abl represent the mammalian
Control of Gene Expression
Home Gene Regulation Is Necessary? Control of Gene Expression By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
Chapter 5: Organization and Expression of Immunoglobulin Genes
Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
Concluding lesson. Student manual. What kind of protein are you? (Basic)
Concluding lesson Student manual What kind of protein are you? (Basic) Part 1 The hereditary material of an organism is stored in a coded way on the DNA. This code consists of four different nucleotides:
When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, 2.36 Email: [email protected].
Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION Professor Bharat Patel Office: Science 2, 2.36 Email: [email protected] What is Gene Expression & Gene Regulation? 1. Gene Expression
2007 7.013 Problem Set 1 KEY
2007 7.013 Problem Set 1 KEY Due before 5 PM on FRIDAY, February 16, 2007. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Where in a eukaryotic cell do you
Activity 7.21 Transcription factors
Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
GenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
Frequently Asked Questions Next Generation Sequencing
Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided
Human Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
Chapter 18 Regulation of Gene Expression
Chapter 18 Regulation of Gene Expression 18.1. Gene Regulation Is Necessary By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
RNA and Protein Synthesis
Name lass Date RN and Protein Synthesis Information and Heredity Q: How does information fl ow from DN to RN to direct the synthesis of proteins? 13.1 What is RN? WHT I KNOW SMPLE NSWER: RN is a nucleic
Yale Pseudogene Analysis as part of GENCODE Project
Sanger Center 2009.01.20, 11:20-11:40 Mark B Gerstein Yale Illustra(on from Gerstein & Zheng (2006). Sci Am. (c) Mark Gerstein, 2002, (c) Yale, 1 1Lectures.GersteinLab.org 2007bioinfo.mbb.yale.edu Yale
4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?
Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.
Chapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
How To Understand How Gene Expression Is Regulated
What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation
Sample Questions for Exam 3
Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.
Complex multicellular organisms are produced by cells that switch genes on and off during development.
Home Control of Gene Expression Gene Regulation Is Necessary? By switching genes off when they are not needed, cells can prevent resources from being wasted. There should be natural selection favoring
Transcription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
Control of Gene Expression
Control of Gene Expression What is Gene Expression? Gene expression is the process by which informa9on from a gene is used in the synthesis of a func9onal gene product. What is Gene Expression? Figure
MUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
Pairwise Sequence Alignment
Pairwise Sequence Alignment [email protected] SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
Copyright 2000-2003 Mark Brandt, Ph.D. 54
Pyruvate Oxidation Overview of pyruvate metabolism Pyruvate can be produced in a variety of ways. It is an end product of glycolysis, and can be derived from lactate taken up from the environment (or,
Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
Protein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
CSC 2427: Algorithms for Molecular Biology Spring 2006. Lecture 16 March 10
CSC 2427: Algorithms for Molecular Biology Spring 2006 Lecture 16 March 10 Lecturer: Michael Brudno Scribe: Jim Huang 16.1 Overview of proteins Proteins are long chains of amino acids (AA) which are produced
Genetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
Genomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
Special report. Chronic Lymphocytic Leukemia (CLL) Genomic Biology 3020 April 20, 2006
Special report Chronic Lymphocytic Leukemia (CLL) Genomic Biology 3020 April 20, 2006 Gene And Protein The gene that causes the mutation is CCND1 and the protein NP_444284 The mutation deals with the cell
Searching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.
Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,
Guide for Bioinformatics Project Module 3
Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first
Chapter 14 Glycolysis. Glucose. 2 Pyruvate 2 Lactate (sent to liver to be converted back to glucose) TCA Cycle
Chapter 14 Glycolysis Requires mitochondria and O 2 Glucose glycolysis anaerobic respiration 2 Pyruvate 2 Lactate (sent to liver to be converted back to glucose) pyruvate dehydrogenase acetyl-coa TCA Cycle
Overview of Eukaryotic Gene Prediction
Overview of Eukaryotic Gene Prediction CBB 231 / COMPSCI 261 W.H. Majoros What is DNA? Nucleus Chromosome Telomere Centromere Cell Telomere base pairs histones DNA (double helix) DNA is a Double Helix
trna Processing and Modification
trna Processing and Modification RNA POL III - TRANSCRIPTS 5S RNA, trna, repetitive Sequenzen (Alu-typ), versch. kleine stabile RNAs (7SL - RNA vom signal recognition particle (SRP)), U6 RNA 5S RNA nicht
Gene Switches Teacher Information
STO-143 Gene Switches Teacher Information Summary Kit contains How do bacteria turn on and turn off genes? Students model the action of the lac operon that regulates the expression of genes essential for
PrimePCR Assay Validation Report
Gene Information Gene Name Gene Symbol Organism Gene Summary Gene Aliases RefSeq Accession No. UniGene ID Ensembl Gene ID papillary renal cell carcinoma (translocation-associated) PRCC Human This gene
Gene Switches A Model
Gene Switches A Model Abstract Conceptually, how genetic switches function and their role in the process of evolution, can be difficult for students to visualize. Gene Switches A Model attempts to make
2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
Becker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
Novel Transcribed Regions in the Human Genome
Novel Transcribed Regions in the Human Genome J. ROZOWSKY,* J. WU, Z. LIAN, U. NAGALAKSHMI, J.O. KORBEL,* P. KAPRANOV,** D. ZHENG,* S. DYKE,** P. NEWBURGER, P. MILLER,, T.R. GINGERAS,** S. WEISSMAN, M.
Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison
Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]
Welcome to the Plant Breeding and Genomics Webinar Series
Welcome to the Plant Breeding and Genomics Webinar Series Today s Presenter: Dr. Candice Hansey Presentation: http://www.extension.org/pages/ 60428 Host: Heather Merk Technical Production: John McQueen
Molecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
Final Project Report
CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes
The world of non-coding RNA. Espen Enerly
The world of non-coding RNA Espen Enerly ncrna in general Different groups Small RNAs Outline mirnas and sirnas Speculations Common for all ncrna Per def.: never translated Not spurious transcripts Always/often
13.4 Gene Regulation and Expression
13.4 Gene Regulation and Expression Lesson Objectives Describe gene regulation in prokaryotes. Explain how most eukaryotic genes are regulated. Relate gene regulation to development in multicellular organisms.
Translation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
GENE REGULATION. Teacher Packet
AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures
2013 W. H. Freeman and Company. 26 RNA Metabolism
2013 W. H. Freeman and Company 26 RNA Metabolism CHAPTER 26 RNA Metabolism Key topics: Transcription: DNA-dependent synthesis of RNA Capping and splicing: RNA processing Overview of RNA Function Ribonucleic
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript
SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD
White Paper SGI High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems Haruna Cofer*, PhD January, 2012 Abstract The SGI High Throughput Computing (HTC) Wrapper
The Steps. 1. Transcription. 2. Transferal. 3. Translation
Protein Synthesis Protein synthesis is simply the "making of proteins." Although the term itself is easy to understand, the multiple steps that a cell in a plant or animal must go through are not. In order
PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: [email protected]
BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data
Using Illumina BaseSpace Apps to Analyze RNA Sequencing Data The Illumina TopHat Alignment and Cufflinks Assembly and Differential Expression apps make RNA data analysis accessible to any user, regardless
Lecture 8. Protein Trafficking/Targeting. Protein targeting is necessary for proteins that are destined to work outside the cytoplasm.
Protein Trafficking/Targeting (8.1) Lecture 8 Protein Trafficking/Targeting Protein targeting is necessary for proteins that are destined to work outside the cytoplasm. Protein targeting is more complex
Bioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
1.5 page 3 DNA Replication S. Preston 1
AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 3 l. DNA Replication 1. Go through PowerPoint 2. Read notes p2 and then watch the animation
Sequencing the Human Genome
Revised and Updated Edvo-Kit #339 Sequencing the Human Genome 339 Experiment Objective: In this experiment, students will read DNA sequences obtained from automated DNA sequencing techniques. The data
FINDING RELATION BETWEEN AGING AND
FINDING RELATION BETWEEN AGING AND TELOMERE BY APRIORI AND DECISION TREE Jieun Sung 1, Youngshin Joo, and Taeseon Yoon 1 Department of National Science, Hankuk Academy of Foreign Studies, Yong-In, Republic
Genetomic Promototypes
Genetomic Promototypes Mirkó Palla and Dana Pe er Department of Mechanical Engineering Clarkson University Potsdam, New York and Department of Genetics Harvard Medical School 77 Avenue Louis Pasteur Boston,
PRACTICE TEST QUESTIONS
PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.
Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003
Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:
The diagram below summarizes the effects of the compounds that cells use to regulate their own metabolism.
Regulation of carbohydrate metabolism Intracellular metabolic regulators Each of the control point steps in the carbohydrate metabolic pathways in effect regulates itself by responding to molecules that
Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
AP Biology 2015 Free-Response Questions
AP Biology 2015 Free-Response Questions College Board, Advanced Placement Program, AP, AP Central, and the acorn logo are registered trademarks of the College Board. AP Central is the official online home
The Aerobic Fate of Pyruvate
The Aerobic Fate of yruvate February 12, 2003 Bryant Miles I could tell that some of you were not impressed by the mere 2 ATs produced per glucose by glycolysis. The 2 AT s produced are only a small fraction
Basic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
CRAC: An integrated approach to analyse RNA-seq reads Additional File 3 Results on simulated RNA-seq data.
: An integrated approach to analyse RNA-seq reads Additional File 3 Results on simulated RNA-seq data. Nicolas Philippe and Mikael Salson and Thérèse Commes and Eric Rivals February 13, 2013 1 Results
Control of Gene Expression
Control of Gene Expression (Learning Objectives) Explain the role of gene expression is differentiation of function of cells which leads to the emergence of different tissues, organs, and organ systems
Module 1. Sequence Formats and Retrieval. Charles Steward
The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.
Overview of Glycolysis Under anaerobic conditions, the glycolytic pathway present in most species results in a balanced reaction:
Glycolysis Glucose is a valuable molecule. It can be used to generate energy (in red blood cells and in brain under normal conditions, glucose is the sole energy source), and it can be used to generate
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS)
Introduction to transcriptome analysis using High Throughput Sequencing technologies (HTS) A typical RNA Seq experiment Library construction Protocol variations Fragmentation methods RNA: nebulization,
H H N - C - C 2 R. Three possible forms (not counting R group) depending on ph
Amino acids - 0 common amino acids there are others found naturally but much less frequently - Common structure for amino acid - C, -N, and functional groups all attached to the alpha carbon N - C - C
DNA as a Mass-Storage Device: 1
DNA as a Mass-Storage Device Robert J. Robbins Johns Hopkins University [email protected] DNA as a Mass-Storage Device: 1 Goals of the Genome Project Sequence the Genome equivalent to obtaining an image
Outline. MicroRNA Bioinformatics. microrna biogenesis. short non-coding RNAs not considered in this lecture. ! Introduction
Outline MicroRNA Bioinformatics Rickard Sandberg Dept. of Cell and Molecular Biology (CMB) Karolinska Institutet! Introduction! microrna target site prediction! Useful resources 2 short non-coding RNAs
