Protein Protein Interactions (PPI) APID (Agile Protein Interaction DataAnalyzer)
|
|
- Sheila Watts
- 8 years ago
- Views:
Transcription
1 APID (Agile Protein Interaction DataAnalyzer) 23 APID (Agile Protein Interaction DataAnalyzer) Integrates and unifies 7 DBs: BIND, DIP, HPRD, IntAct, MINT, BioGRID. Includes 51,873 proteins 241,204 interactions Includes quality assessment methods based on: - nº of experimental methods - functional similarity (GO) - interacting domains (ipfam) 24
2 APID (Agile Protein Interaction DataAnalyzer) Problems found in PPI data and DBs Quite heterogene (little overlap) Each DB take different scientific papers and have different curation teams Each DB follows different annotation protocols Still partial (incomplete ) Include many false positives (noisy) comparison done in APID (6 source DBs) BIND (University of Toronto) BioGRID (Mount Sinai Hospital) DIP (UCLA) HPRD (Johns Hopkins University) IntAct (EBI) 51,873 proteins 241,204 interactions MINT (University Rome)! 22,781 proteins! 50,218 interactions! 529,018 proteins???! 98,867 interactions! 19,935 proteins! 56,638 interactions! 25,661 proteins! 38,167 interactions! 63,568 proteins! 111,249 interactions! 28,817 proteins! 105,899 interactions NOTE: the numbers are in continuous revision by the DBs (look at their web sites). 26
3 Proteins per Organism: APID Statistics 51,873 proteins 241,204 interactions Interactions per Organism: ORGANISM (SPECIES) Homo sapiens Drosophila melanogaster NUMBER OF PROTEINS ORGANISM (SPECIES) Saccharomyces cerevisiae Homo sapiens NUMBER OF INTERACTIONS Saccharomyces cerevisiae Mus musculus Caenorhabditis elegans Escherichia coli Rattus norvegicus Drosophila melanogaster Escherichia coli Campylobacter jejuni Caenorhabditis elegans Mus musculus APID Search Protein A protein name, protein identifier, protein description or part of it can be inserted in the general APID search tool. 28
4 APID Protein Query Results The figure shows the result given by the search for RASH. A table with 3 rows (one for each result) is presented. This table includes six columns with information about proteins: the UniProt entry name, the number of interactions, the UniProt_ID number, the taxon (NCBI Taxonomy ID), the protein name or description and a link to more information about the protein. 29 APID Protein More Information, +info_prot Clicking on +info_prot a new window with more detailed information about the query protein is displayed, including links to other referred biomolecular databases. The +info_prot file also includes some calculated parameters about the protein interaction network (i.e. connectivity and cluster coefficient) and about the protein functional environment based on GO annotation (i.e. GO environment enrichment) 30
5 APID Protein Interactions Clicking on the 81 link (interactions column) in the Protein Query Results a new page is displayed including a table with details about the 81 interactions that have been reported for RASH_HUMAN. This table has 5 columns with information about: the interaction protein partners, the number of experiments that validate each interaction, the provenance source databases (with links to them) and a final column with more information about the interaction: +info_inter 31 APID Interaction More Information, +info_inter Clicking on any +info_inter (in Protein Interaction page) a new window with more detailed information about the corresponding interaction protein pair is displayed, including marks in yellow that show GO terms overlapping and marks in green that show ipfam domain-domain interactions. 32
6 APID Interaction Filter Protein interactions can be selected using a filter that restrict the display to interaction pairs proven by 5 methods at least and that also show ipfam domain domain interactions. Doing this the number of interaction partners for RASH_HUMAN is reduced to only 6 proteins. 33 APID Experiments Clicking on the number of experiments APID displays another window with the information about all the experiments that validate any given PPI (e.g. RASH_HUMAN - SOS1_HUMAN), presenting for each experiment: (i) the publications that describe such interaction, linking to PubMed (by accession number PMID) and including a description of the publication; (ii) the type of method, linked to the publication that explains such experimental technique and the PSI-MI method-identifier; (iii) the source databases that include these data. 34
7 APID Network Browser APID also includes a Graph button that opens a graphical interactive network browser, where the proteins are nodes and the interactions edges. This application tool visualizes dynamically the data, and allows interactive exploring and navigating along the network. 35 How to submit your interaction data? 36
8 How to submit your interaction data? From Orchard et al. (2007) Nature Biotech. 37 How to submit your interaction data? From Orchard et al. (2007) 38
TUTORIAL From Protein-Protein Interactions (PPIs) to networks and pathways ??? http://bioinfow.dep.usal.es
TUTORIAL From Protein-Protein Interactions (PPIs) to networks and pathways http://bioinfow.dep.usal.es Dr. Javier De Las Rivas (jrivas@usal.es) Dr. Carlos Prieto (cprietos@usal.es) Bioinformatics and Functional
More information國 立 交 通 大 學. 同 源 蛋 白 質 - 蛋 白 質 交 互 作 用 之 研 究 A Study of Homologous Protein-protein Interactions 生 物 科 技 學 系 博 士 論 文
國 立 交 通 大 學 生 物 科 技 學 系 博 士 論 文 同 源 蛋 白 質 - 蛋 白 質 交 互 作 用 之 研 究 A Study of Homologous Protein-protein Interactions 研 究 生 : 陳 俊 辰 Chen Chun-Chen 指 導 教 授 : 楊 進 木 博 士 Advisor: Yang Jinn-Moon, Ph. D. 中 華 民
More informationGenome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome
Module 2 Genome Viewing Using Genome Browsers to View Annotation of the Human Genome Bert Overduin, Ph.D. PANDA Coordination & Outreach EMBL - European Bioinformatics Institute Wellcome Trust Genome Campus
More informationID of alternative translational initiation events. Description of gene function Reference of NCBI database access and relative literatures
Data resource: In this database, 650 alternatively translated variants assigned to a total of 300 genes are contained. These database records of alternative translational initiation have been collected
More informationThe human gene encoding Glucose-6-phosphate dehydrogenase (G6PD) is located on chromosome X in cytogenetic band q28.
Tutorial Module 5 BioMart You will learn about BioMart, a joint project developed and maintained at EBI and OiCR www.biomart.org How to use BioMart to quickly obtain lists of gene information from Ensembl
More informationorg.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers.
org.rn.eg.db December 16, 2015 org.rn.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank
More information0 value2. 3. Assign labels to the proteins in each interval of the ranked list
Ranked list of protein degrees in decreasing order 0 100 Proteins with few connections Proteins with many connections 1. Sort a random number between 80 and 98 (value1) 0 value1 2. Sort a random number
More informationIntroduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
More informationCENG 734 Advanced Topics in Bioinformatics
CENG 734 Advanced Topics in Bioinformatics Week 9 Text Mining for Bioinformatics: BioCreative II.5 Fall 2010-2011 Quiz #7 1. Draw the decompressed graph for the following graph summary 2. Describe the
More informationIsoBase: a database of functionally related proteins across PPI networks
D295 D300 doi:10.1093/nar/gkq1234 IsoBase: a database of functionally related proteins across PPI networks Daniel Park 1,2, Rohit Singh 1, Michael Baym 1,3,4, Chung-Shou Liao 5 and Bonnie Berger 1,4, *
More informationSequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011
Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear
More informationProteinQuest user guide
ProteinQuest user guide 1. Introduction... 3 1.1 With ProteinQuest you can... 3 1.2 ProteinQuest basic version 4 1.3 ProteinQuest extended version... 5 2. ProteinQuest dictionaries... 6 3. Directions for
More informationPROTEOMEXCHANGE AN INTERNATIONAL INFRASTRUCTURE FOR OPEN PROTEOMICS DATA
PROTEOMEXCHANGE AN INTERNATIONAL INFRASTRUCTURE FOR OPEN PROTEOMICS DATA Henning Hermjakob Team Leader Proteomics Services European Bioinformatics Institute hhe@ebi.ac.uk Introduction to proteomics Introduction
More informationModule 9 Ad Hoc Queries
Module 9 Ad Hoc Queries Objectives Familiarize the User with basic steps necessary to create ad hoc queries using the Data Browser. Topics Ad Hoc Queries Create a Data Browser query Filter data Save a
More informationNetwork building algorithms
Network building algorithms 1 General considerations...3 1.1 Terminology...3 1.2 Pre-filters, algorithms and parameters...3 2 Network building steps...3 2.1 Pre-filtering step...3 2.2 Transformation step...3
More informationEfficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing
Efficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing James D. Jackson Philip J. Hatcher Department of Computer Science Kingsbury Hall University of New Hampshire Durham,
More informationGuide for Bioinformatics Project Module 3
Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first
More informationCSSEA Helpdesk User Guide
CSSEA Helpdesk User Guide Contents I. Creating tickets... 3 1. Creating a New Ticket via Email... 3 a. Email format... 3 b. New ticket reply... 3 2. Creating a New ticket via the Website... 4 a. Browse
More informationAnalyzing microrna Data and Integrating mirna with Gene Expression Data in Partek Genomics Suite 6.6
Analyzing microrna Data and Integrating mirna with Gene Expression Data in Partek Genomics Suite 6.6 Overview This tutorial outlines how microrna data can be analyzed within Partek Genomics Suite. Additionally,
More informationExtraction and Visualization of Protein-Protein Interactions from PubMed
Extraction and Visualization of Protein-Protein Interactions from PubMed Ulf Leser Knowledge Management in Bioinformatics Humboldt-Universität Berlin Finding Relevant Knowledge Find information about Much
More informationRETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
More informationSES PAS Senior Executive Service (SES) Performance Appraisal System (PAS)
Job Aid: Create the Executive Development Plan (EDP) Creating the Developmental Plan Step 1: From within your performance plan, navigate to the Developmental Plan tool bar in the left column Step 2: Click
More informationUser Manual. Crystal Report Integration
User Manual Crystal Report Integration Version 1.0 1 1 Contents 1 Introduction... 3 2 Integration Of Crystal Report... 3 2.1 Open Report and Process Window from Menu... 3 2.2 Give Access to Report and
More informationCONTENTS MANUFACTURERS GUIDE FOR PUBLIC USERS
OPA DATABASE GUIDE FOR PUBLIC USERS - MARCH 2013 VERSION 5.0 CONTENTS Manufacturers 1 Manufacturers 1 Registering a Manufacturer 2 Search Manufacturers 3 Advanced Search Options 3 Searching for Manufacturers
More informationCre-X-Mice Database. User guide
Cre-X-Mice Database User guide Table of Contents Table of Figure... ii Introduction... 1 Searching the Database... 1 Quick Search Mode... 1 Advanced Search... 1 Viewing Search Results... 2 Registration...
More informationGenome and DNA Sequence Databases. BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009
Genome and DNA Sequence Databases BME 110/BIOL 181 CompBio Tools Todd Lowe March 31, 2009 Admin Reading: Chapters 1 & 2 Notes available in PDF format on-line (see class calendar page): http://www.soe.ucsc.edu/classes/bme110/spring09/bme110-calendar.html
More informationHPI in-memory-based database system in Task 2b of BioASQ
CLEF 2014 Conference and Labs of the Evaluation Forum BioASQ workshop HPI in-memory-based database system in Task 2b of BioASQ Mariana Neves September 16th, 2014 Outline 2 Overview of participation Architecture
More informationBioinformatics: Network Analysis
Bioinformatics: Network Analysis Graph-theoretic Properties of Biological Networks COMP 572 (BIOS 572 / BIOE 564) - Fall 2013 Luay Nakhleh, Rice University 1 Outline Architectural features Motifs, modules,
More informationHow To Understand A Protein Network
Graph-theoretical approaches for studying biological networks by Tijana Milenković Advancement Committee: Prof. Wayne Hayes Prof. Lan Huang Prof. Eric Mjolsness Prof. Zoran Nenadić Prof. Nataša Pržulj,
More informationTutorial. Reference Genome Tracks. Sample to Insight. November 27, 2015
Reference Genome Tracks November 27, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com support-clcbio@qiagen.com Reference
More informationASTP Online. Assisted School Travel Program. Student Rollover User Guide. NSW Department of Education
ASTP Online Assisted School Travel Program Student Rollover User Guide NSW Department of Education Table of Contents Introduction 2 Accessing ASTP Online 2 Locating ASTP online 2 Orientation of ASTP Online
More informationA brief introduction to Cytoscape
A brief introduction to Cytoscape Scientific day «Data mining of omics data» 5th Feb 2015 CGFB, Bordeaux yves.vandenbrouck@cea.fr (U1038, EDyP team, CEA-Grenoble) OUTLINES Concepts and context Cytoscape
More informationPPInterFinder A Web Server for Mining Human Protein Protein Interaction
PPInterFinder A Web Server for Mining Human Protein Protein Interaction Kalpana Raja, Suresh Subramani, Jeyakumar Natarajan Data Mining and Text Mining Laboratory, Department of Bioinformatics, Bharathiar
More informationTitle: Surveying Genome to Identify Origins of DNA Replication In Silico
Title: Surveying Genome to Identify Origins of DNA Replication In Silico Abstract: DNA replication origins are the bases to realize the process of chromosome replication and analyze the progress of cell
More informationJournal of Biology. BioMed Central
Journal of Biology BioMed Central Open Access Research article Comprehensive curation and analysis of global interaction networks in Saccharomyces cerevisiae Teresa Reguly *, Ashton Breitkreutz *, Lorrie
More informationTutorial for proteome data analysis using the Perseus software platform
Tutorial for proteome data analysis using the Perseus software platform Laboratory of Mass Spectrometry, LNBio, CNPEM Tutorial version 1.0, January 2014. Note: This tutorial was written based on the information
More informationCall Logging Quick Reference User Guide
Call Logging provides companywide call records, comparison and analytical tools for tracking and improving the efficiency and effectiveness of business communications. An intuitive, feature rich interface
More informationOfgem Carbon Savings Community Obligation (CSCO) Eligibility System
Ofgem Carbon Savings Community Obligation (CSCO) Eligibility System User Guide 2015 Page 1 Table of Contents Carbon Savings Community Obligation... 3 Carbon Savings Community Obligation (CSCO) System...
More informationJustClust User Manual
JustClust User Manual Contents 1. Installing JustClust 2. Running JustClust 3. Basic Usage of JustClust 3.1. Creating a Network 3.2. Clustering a Network 3.3. Applying a Layout 3.4. Saving and Loading
More informationExcel Reports and Macros
Excel Reports and Macros Within Microsoft Excel it is possible to create a macro. This is a set of commands that Excel follows to automatically make certain changes to data in a spreadsheet. By adding
More informationOriginal article AnnotCompute: annotation-based exploration and meta-analysis of genomics experiments
Original article AnnotCompute: annotation-based exploration and meta-analysis of genomics experiments Jie Zheng 1, Julia Stoyanovich 2, Elisabetta Manduchi 1, Junmin Liu 1 and Christian J. Stoeckert Jr
More informationProject Server Plus Risk to Issue Escalator User Guide v1.1
Project Server Plus Risk to Issue Escalator User Guide v1.1 Overview The Project Server Plus Risk to Issue Escalator app will immediately raise a risk to an issue at the push of a button. Available within
More informationIntegrated Research Application System (IRAS)
Integrated Research Application System (IRAS) Guidance on electronic submission of supporting documentation with applications and storing files in IRAS. New functionality is being phased in to IRAS to
More informationMicrosoft Excel 2010 Training. Use Excel tables to manage information
Microsoft Excel 2010 Training Use Excel tables to manage information Overview: Help with data management In this course, you ll learn how to manage information by using tables in Excel. Tables make it
More informationManaging User Accounts
Managing User Accounts This chapter includes the following sections: Configuring Local Users, page 1 Active Directory, page 2 Viewing User Sessions, page 6 Configuring Local Users Before You Begin You
More informationHow to Login Username Password:
How to Login After navigating to the SelecTrucks ATTS Call Tracking & Support Site: www.selectrucksatts.com Select Corporate Link to login for Corporate owned Centers/Locations. Username: Your Email Address
More informationDALHOUSIE NOTES ON PAYROLL EXPENSE DETAIL IN FINANCE SELF SERVICE. QUICK REFERENCE As of September 1, 2015
DALHOUSIE NOTES ON PAYROLL EXPENSE DETAIL IN FINANCE SELF SERVICE QUICK REFERENCE As of September 1, 2015 Quick reference document outlining the basic steps to access the payroll expense detail results
More information12-Steps: Searching & Registering for Classes
Office of the Registrar. Division of Student Affairs 12-Steps: Searching & Registering for Classes Step 1: Access your web browser and log on to www.ucdenver.edu/ucdaccess. Proceed to login with your User
More informationAeries.net Teacher Portal User Documentation July 31, 2015. 1. Access Teacher Portal. 2. Utilizing the Navigation Tree
Aeries.net Teacher Portal User Documentation July 31, 2015 1. Access Teacher Portal 2. Utilizing the Navigation Tree 3. Attendance Attendance Add/Dropped Students ** SSA (Safe Schools Act) Attendance Notes
More informationIntroduction to Microsoft Access 2010
Introduction to Microsoft Access 2010 A database is a collection of information that is related. Access allows you to manage your information in one database file. Within Access there are four major objects:
More informationLab Inventory Quick Start Guide
Lab Inventory Quick Start Guide 2 When logging in for the first time, login name and password for the default administrator login are both admin. 3 You are directed to the Inventory tab after logging in.
More informationLesson 07: MS ACCESS - Handout. Introduction to database (30 mins)
Lesson 07: MS ACCESS - Handout Handout Introduction to database (30 mins) Microsoft Access is a database application. A database is a collection of related information put together in database objects.
More informationSetting up SMTP in Talis Decisions
Decisions Talis Library Management Suite Setting up SMTP in Talis Decisions This document describes how to configure SMTP (Single Mail Transfer Protocol) in Talis Decisions. It is intended for system administrators
More information2) Log in using the Email Address and Password provided in your confirmation email
Welcome to HR Classroom! The following will show you how to use your HR Classroom admin account, including setting up Training Groups, inserting Policies, and generating Trainee Reports. 1) Logging into
More informationQuestions? Contact AZA s Conservation and Science Department:
User Orientation Navigating Animal Programs Database Animal Program Participants Table of Contents Part I Animal Program Pages Part II Searching and Downloading Documents Questions? Contact AZA s Conservation
More informationSpecify the location of an HTML control stored in the application repository. See Using the XPath search method, page 2.
Testing Dynamic Web Applications How To You can use XML Path Language (XPath) queries and URL format rules to test web sites or applications that contain dynamic content that changes on a regular basis.
More information1) After login WinTonenet Securities Trading System, a window named WinTonenet Securities Trading will be shown.
(A) BUY STOCKS WinTonenet Securities Trading Guidelines (2) TRANSACTION (STANDARD VERSION) 1) After login WinTonenet Securities Trading System, a window named WinTonenet Securities Trading will be shown.
More informationThe NIHMS System User s Guide to Submitting a Manuscript
On May 2, 2005, The National Institutes of Health (NIH) Public Access Policy went into effect for NIH-funded researchers to submit their peer-reviewed manuscripts only those that have been accepted for
More informationIntroduction to Microsoft Access 2013
Introduction to Microsoft Access 2013 A database is a collection of information that is related. Access allows you to manage your information in one database file. Within Access there are four major objects:
More informationOpen Flow Biological Network Initiative: Pathway map building, standards, simulation, and knowledge sharing
Open Flow Biological Network Initiative: Pathway map building, standards, simulation, and knowledge sharing Hiroaki Kitano (1,2), Yukiko Matsuoka (1) (1) The Systems Biology Institute, (2) OIST 2009/04/07
More informationNYC Common Online Charter School Application
NYC Common Online Charter School Application Admin Guide In this guide, you will find information about the following features: How to log in How to view or export basic data 1. Application index How to
More informationInteraction with Operational Crystal Report... 3
Interaction with Operational Crystal Report Content Introduction to Crystal Report... 2 Interaction with Operational Crystal Report... 3 Introduction to Crystal Report SAP Crystal Reports is designed to
More informationBusiness Intelligence Overview. BW/BI Security. BW/BI Architecture. Business Explorer (BEx) BW/BI BEx Tools Overview. What is BEx?
SAP Business Warehouse/Business Intelligence Reporting Business Explorer (BEx) Washington State HRMS Business Warehouse/Business Intelligence (BW/BI) BW/BI Power User Workshop Materials General Topics
More informationHow To Use Syntheticys User Management On A Pc Or Mac Or Macbook Powerbook (For Mac) On A Computer Or Mac (For Pc Or Pc) On Your Computer Or Ipa (For Ipa) On An Pc Or Ipad
SYNTHESYS MANAGEMENT User Management Synthesys.Net User Management 1 SYNTHESYS.NET USER MANAGEMENT INTRODUCTION...3 STARTING SYNTHESYS USER MANAGEMENT...4 Viewing User Details... 5 Locating individual
More informationQuick Help Guide SAP CRMS Login, Navigation and Layout
Introduction This quick help guide provides details on the following features of the SAP Customer Relationship Management system (CRMS) Roles How to log on Screen layout Moving around Maximising/minimising
More informationT Analyst User Guide 1
T Analyst User Guide 1 Contents Contents...2 Getting Started...3 Navigation...4 Logging Out of T Analyst...4 View bills...4 Bill columns and definitions...4 Viewing a PDF bill...5 Comparing bills...5 Requesting
More informationEdge Configuration Series Reporting Overview
Reporting Edge Configuration Series Reporting Overview The Reporting portion of the Edge appliance provides a number of enhanced network monitoring and reporting capabilities. WAN Reporting Provides detailed
More informationFilling out application form manual
Document version : 1.0.0 Date of creation : 20.12.2010 CENTRAL REGISTRY OF REPUBLIC OF MACEDONIA Blvd. Kuzman Josifoski Pitu Nr.1 1000 Skopje Tel.: + 389 2 3290-241, + 389 2 3290-248 Fax: + 389 2 3123-169
More informationMultiExperiment Viewer Quickstart Guide
MultiExperiment Viewer Quickstart Guide Table of Contents: I. Preface - 2 II. Installing MeV - 2 III. Opening a Data Set - 2 IV. Filtering - 6 V. Clustering a. HCL - 8 b. K-means - 11 VI. Modules a. T-test
More informationModule 1. Sequence Formats and Retrieval. Charles Steward
The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.
More informationEfficient Storage and Temporal Query Evaluation of Hierarchical Data Archiving Systems
Efficient Storage and Temporal Query Evaluation of Hierarchical Data Archiving Systems Hui (Wendy) Wang, Ruilin Liu Stevens Institute of Technology, New Jersey, USA Dimitri Theodoratos, Xiaoying Wu New
More informationAn Overview of Cells and Cell Research
An Overview of Cells and Cell Research 1 An Overview of Cells and Cell Research Chapter Outline Model Species and Cell types Cell components Tools of Cell Biology Model Species E. Coli: simplest organism
More informationClass Scheduler Queries: Navigation and Directions for Creating a Query and a Report in Excel
Class Scheduler Queries: Navigation and Directions for Creating a Query and a Report in Excel Directory Navigation: Main Menu>Reporting Tools>Query>Query Viewer 1. In the Search By field, type FSU_SR_CLASS.
More informationCreating a Network Graph with Gephi
Creating a Network Graph with Gephi Gephi is a powerful tool for network analysis, but it can be intimidating. It has a lot of tools for statistical analysis of network data most of which you won't be
More informationGephi Tutorial Quick Start
Gephi Tutorial Welcome to this introduction tutorial. It will guide you to the basic steps of network visualization and manipulation in Gephi. Gephi version 0.7alpha2 was used to do this tutorial. Get
More informationATLAS.ti for Mac OS X Getting Started
ATLAS.ti for Mac OS X Getting Started 2 ATLAS.ti for Mac OS X Getting Started Copyright 2014 by ATLAS.ti Scientific Software Development GmbH, Berlin. All rights reserved. Manual Version: 5.20140918. Updated
More informationAdministration Guide. . All right reserved. For more information about Specops Inventory and other Specops products, visit www.specopssoft.
. All right reserved. For more information about Specops Inventory and other Specops products, visit www.specopssoft.com Copyright and Trademarks Specops Inventory is a trademark owned by Specops Software.
More informationQuick start. A project with SpagoBI 3.x
Quick start. A project with SpagoBI 3.x Summary: 1 SPAGOBI...2 2 SOFTWARE DOWNLOAD...4 3 SOFTWARE INSTALLATION AND CONFIGURATION...5 3.1 Installing SpagoBI Server...5 3.2Installing SpagoBI Studio and Meta...6
More informationMicroStrategy Desktop
MicroStrategy Desktop Quick Start Guide MicroStrategy Desktop is designed to enable business professionals like you to explore data, simply and without needing direct support from IT. 1 Import data from
More informationManaging User Accounts
Managing User Accounts This chapter includes the following sections: Active Directory, page 1 Configuring Local Users, page 3 Viewing User Sessions, page 5 Active Directory Active Directory is a technology
More informationMolecular Facts and Figures
Nucleic Acids Molecular Facts and Figures DNA/RNA bases: DNA and RNA are composed of four bases each. In DNA the four are Adenine (A), Thymidine (T), Cytosine (C), and Guanine (G). In RNA the four are
More informationIs This The How-to For You?
This document is for UNE Professional staff who need to create and submit a timesheet. Only staff members employed on a casual basis are required to complete and submit a timesheet. If you are a member
More informationHow To Run A Run Dashboard On An Aca.Edu
Chairs and Deans Argos Dashboards Guide The following guide is provided to assist you in running and understanding the information that the dashboard in Argos returns. The dashboard located through the
More informationDoña Ana County, NM Interactive Zoning Map
Doña Ana County, NM Interactive Zoning Map Users Guide Basic Map Navigation Zoom Control The most efficient way of zooming, or changing the scale of the map is with the use of a mouse with a scroll wheel.
More informationThe Integrated Microbial Genomes (IMG) System: A Case Study in Biological Data Management
The Integrated Microbial Genomes (IMG) System: A Case Study in Biological Data Management Victor M. Markowitz 1, Frank Korzeniewski 1, Krishna Palaniappan 1, Ernest Szeto 1, Natalia Ivanova 2, and Nikos
More informationMy AutoSupport. User Guide. October 2013
System User Guide My AutoSupport October 2013 NetApp AutoSupport is an integrated, efficient monitoring and reporting technology that checks the health of your AutoSupport enabled NetApp systems on a continual
More informationUnderstanding the dynamics and function of cellular networks
Understanding the dynamics and function of cellular networks Cells are complex systems functionally diverse elements diverse interactions that form networks signal transduction-, gene regulatory-, metabolic-
More informationSimplifying Data Interpretation with Nexus Copy Number
Simplifying Data Interpretation with Nexus Copy Number A WHITE PAPER FROM BIODISCOVERY, INC. Rapid technological advancements, such as high-density acgh and SNP arrays as well as next-generation sequencing
More informationVMware vrealize Operations for Horizon Administration
VMware vrealize Operations for Horizon Administration vrealize Operations for Horizon 6.1 This document supports the version of each product listed and supports all subsequent versions until the document
More informationTRIM: Web Tool. Web Address The TRIM web tool can be accessed at:
TRIM: Web Tool Accessing TRIM Records through the Web The TRIM web tool is primarily aimed at providing access to records in the TRIM system. While it is possible to place records into TRIM or amend records
More informationPeptidomicsDB: a new platform for sharing MS/MS data.
PeptidomicsDB: a new platform for sharing MS/MS data. Federica Viti, Ivan Merelli, Dario Di Silvestre, Pietro Brunetti, Luciano Milanesi, Pierluigi Mauri NETTAB2010 Napoli, 01/12/2010 Mass Spectrometry
More informationBioinformatics: Network Analysis
Bioinformatics: Network Analysis Network Motifs COMP 572 (BIOS 572 / BIOE 564) - Fall 2013 Luay Nakhleh, Rice University 1 Recall Not all subgraphs occur with equal frequency Motifs are subgraphs that
More informationCOGNOS KARATE BELT SESSION III CREATING SLOTS
COGNOS KARATE BELT SESSION III CREATING SLOTS DIY SLOTS Purpose: This document explains the process for creating indicators as a way to slot information into one row from data that would normally be in
More informationCSA Helpdesk User Guide
CSA Helpdesk User Guide CSA Helpdesk User Guide 1 Creating Tickets 1.1 1.2 Creating a New Ticket via Email 4 Creating a New Ticket via the Website 7 2 Account Management 2.1 2.2 2.3 Logging in to your
More informationGuide for Data Visualization and Analysis using ACSN
Guide for Data Visualization and Analysis using ACSN ACSN contains the NaviCell tool box, the intuitive and user- friendly environment for data visualization and analysis. The tool is accessible from the
More informationCA Nimsoft Monitor. Probe Guide for Active Directory Response. ad_response v1.6 series
CA Nimsoft Monitor Probe Guide for Active Directory Response ad_response v1.6 series Legal Notices This online help system (the "System") is for your informational purposes only and is subject to change
More informationGetting Started with Access 2007
Getting Started with Access 2007 1 A database is an organized collection of information about a subject. Examples of databases include an address book, the telephone book, or a filing cabinet full of documents
More informationOption 1: empirical network analysis. Task: find data, analyze data (and visualize it), then interpret.
Programming project Task Option 1: empirical network analysis. Task: find data, analyze data (and visualize it), then interpret. Obtaining data This project focuses upon cocktail ingredients. Data was
More informationFinance BI Pilot UM Analytics - Navigate to Central Developed Dashboards
Key Terms Here are some key terms will be helpful as you work within the UM Analytics environment. Analysis Think of an analysis as simply a query or collection of data fields that provide answers to various
More informationVisualization methods for patent data
Visualization methods for patent data Treparel 2013 Dr. Anton Heijs (CTO & Founder) Delft, The Netherlands Introduction Treparel can provide advanced visualizations for patent data. This document describes
More information