Integration of data management and analysis for genome research
|
|
|
- Shanon Logan
- 10 years ago
- Views:
Transcription
1 Integration of data management and analysis for genome research Volker Brendel Deparment of Zoology & Genetics and Department of Statistics Iowa State University 2112 Molecular Biology Building Ames, Iowa U.S.A. In S. Schubert, B. Reusch and N. Jesse (eds.), Informatik bewegt. Lecture Notes in Informatics (LNI) - Proceedings P-20, Abstract: Technological advances in genome research have produced unprecedented volumes of genetic and molecular data that now provide the context for any biological research. However, data access, curation, and analysis have remained challenging areas for continued research and development and often prove to be the bottleneck for scientific progress. Many a paper in bioinformatics or even in general molecular biology these days start out just like the abstract above, with an acknowledgement of the explosive growth of molecular sequence, structure, and expression data. What fit nicely within the printed pages of a thin booklet only 25 years ago now comprises large and increasingly complex databases that are Web-accessible to the public. Figure 1 shows the growth on one major molecular sequence repository - GenBank, maintained at the U.S. National Center of Biotechnology Information (NCBI). The slope of the curve is indeed impressive. However, the actual size of the data sets would seem to be easily dwarfed by database sizes in other commericial, governmental, or even other research fields. What then is the real problem, if any, facing the biology community? I think there are many aspects for consideration. One important facet is that the molecular databases themselves have evolved over the years, and surely many details of database design should have been done differently in hindsight. However, the rapid pace of new data acquisition has so far prevented any major re-design and re-construction of the databases the community is accustomed to. Another critical point is that the data derive from a large variety of sources and are intrinsically heterogenous. There are no uniform standards for data quality and annotation. In these notes I shall not further discuss the challenges faced by the large database providers, but rather I shall review the problem first from the point of a user and then suggest some approaches we have pursued to provide intermediate solutions.
2 Figure 1: Molecular Database Growth (from 1 Some Comments on the Current Status of Molecular Databases 1.1 Existing Data Retrieval Systems Two of the centralized, prominent Web access points to existing sequence and molecular biology data are the Entrez system at NCBI ( and the SRS system developed in Europe ( Both systems are limited in three ways: 1) data are provided in flat file formats only, often requiring much user manipulation after receipt; 2) retrievals are inflexible, and do not
3 support items such as ranges and numerical operators (e.g.,,, etc.), and 3) the Web and server user interfaces are non-intuitive and force users to learn specific query syntaxes in order to use them effectively. For example, with current query protocols it is not possible to retrieve all GenBank genomic DNA entries with a single CDS feature annotation ; or the subset of the previous query restricting the retrieved entries to CDS with at least two annotated coding exons ; or the DNA sequence segments in FASTA format for 500 nucleotides immediately upstream of the annotated ATG start codon ; or protein records including their cognate cdna sequence (see Section 1.3 for further examples). 1.2 Annotation Errors in Public Databases Publicly available biological databases should be distinguished as either data repositories or curated databases. These two categories serve very different needs. Data repositories, including most prominently GenBank, provide centralized access to original data. Curated databases, on the other hand, provide annotated data according to the curators discretion. In practice, of course, these distinctions tend to be blurred, and most databases serve a mixture of original and annotated data, or data with rather limited annotation. The data repositories are essential when a researcher needs to locate particular data from its original source. For example, a search of GenBank might quickly turn up a particular protein sequence translated from its corresponding genomic and cdna sequence determined by author A in year X. Subsequently, errors in the interpretation of the data may be discovered, or author B may publish a corrected sequence independently in year Y. In this case, the data repository would still retain author A s entry, but in a curated database a single entry should represent the combined interpreted data (one correct sequence, or annotation of allelic variation). Brenner [Bre99] estimated the error rate of functional assignment in gene annotation to be at least 8%. To illustrate these problems, we followed up on a number of erroneous GenBank entries pointed out by Korning et al. [KHRB96]. These authors built a training set for a neural network algorithm to predict splice sites in Arabidopsis genes and encountered an alarmingly high error rate in the requisite GenBank annotation. While some errors were due to typographical misprints that could be corrected by comparison with the original papers, many errors were found to be systematic shift errors created by wrong assignments of splice sites (see below). Table 1 of the Korning et al. paper listed 24 specific GenBank entries with erroneous splice site annotations. Our present re-checking of these files revealed that only five of these entries have been corrected in the past six years. For others, the mostly obvious annotation errors remain. Figure 2 gives one example. For other files, splice sites are erroneously assigned when the ¼ and ¼ sequences are identically AGGT (the correct assignment is aggt... AGgt, intron residues in capitals; based on cognate cdna matching alone, there are four alternative assignments matching up the aggt of the cdna). It is evident that erroneous data place a heavy burden on individual researchers who have to devote a large effort to clean up the errors before the data can be successfully used in their research. Even more disturbing is the persistence and propagation of errors in the
4 LOCUS ATKIN2 880 bp DNA PLN 23-JUL-1992 CDS join( , , ) EST Accession : Exon ( 83 n); cdna 1 80 ( 80 n); score: Intron ( 161 n); Pd: (s: 0.90), Pa: (s: 1.00) Exon ( 69 n); cdna ( 69 n); score: Intron ( 114 n); Pd: (s: 0.96), Pa: (s: 0.98) Exon ( 281 n); cdna ( 280 n); score: Alignment (genomic DNA sequence = upper lines): TTTTACAAGA AAAAAATATC TGAAAAATGT CAGAGACCAA CAAGAATGCC TTCCAAGCCG 137 TTTTCCAAGG AAA-AATTTC TGAAAAAT-T CNGGGACC-A CNAGAATGCC TTCCAAGCCC 57 GTCAGGCCGC TGGCAAAGCT GAGGTACTCT TTCTCTCTTA GAACAGAGTA CTGATAGATT 197 GTCAGGCCGC TGGCCAAGCT GAG /////// ATAGGAGAAG AGCAATGTTC TGCTGGACAA GGCCAAGGAT GCTGCTGCTG CAGCTGGAGC GAGAAG AGCAATGTTC TGCTGGACAA GGCCAAGGAT GCTGCTGCTG CAGCTGGAGN 136 TTCCGCGCAA CAGGTAAACG ATCTATACAC ACATTATGAC ATTTATGTAA AGAATGAAAA 437 TTCCGCNCAA CAG /////// GTTATAGGCG GGAAAGAGTA TATCGGATGC GGCAGTGGGA GGTGTTAACT TCGTGAAGGA GCG GGAAAGAGTA TATCGGATGC GGCAGTGGGA GGTGTTAAC- TCGTGAAGGA 201 CAAGACCGGC CTGAACAAGT AGCGATCCGA GTCAACTTTG GGAGTTATAA TTTCCCTTTT 617 CAAGACCGGC CTGAACAAGT AGCGATCCGA GTCAACTTTG GGAGTTATAA TTTCCCTTTT 261 /////// >Pcorrect (gi sp P31169 KIN2_ARATH) MSETNKNAFQ AGQAAGKAEE KSNVLLDKAK DAAAAAGASA QQAGKSISDA AVGGVNFVKD KTGLNK >Pfalse (gi emb CAA ) MSETNKNAFQ AGQAAGKAER RRAMFCWTRP RMLLLQLELP RNRAGKSISD AAVGGVNFVK DKTGLNK Figure 2: Example of an erroneous GenBank annotation. The GenBank CDS gives incorrect assignment of both acceptor sites (319 should be 321, 503 should be 504), as pointed out by Korning et al. [KHRB96]. Spliced alignment with an Arabidopsis EST by the GeneSeqer program [UB00] proves the correct assignment (identities between the genomic DNA, upper lines, and EST, lower lines, are indicated by ; positions of the rightmost residues in each sequence block are given on the right; introns are indicated by ; for brevity, some sequence segments are replaced by ///////). The erroneous intron assignment led to an incorrect protein sequence prediction (Pfalse). Both the incorrect sequence and the correct protein sequence (Pcorrect) persist in the NCBI non-redundant protein database under different accessions.
5 databases. For example, assessment of protein sequence similarity is the major annotation tool for novel genomic and cdna sequences. Spurious similarities will lead to further misclassifications. 1.3 Examples of Data Retrieval Challenges for Specific Research Questions Many interesting questions in molecular biology, genomics, and bioinformatics involve initial data preparation steps that, although conceptually simple, can in practice turn out to very cumbersome and time-consuming. We illustrate such problems with a few typical examples. While drawn from our own research interests, the examples easily generalize and will be familiar to many researchers Derivation of Non-redundant Sets of Homologous Proteins We have a keen interest in pre-mrna processing in plants. As part of our studies, we have cloned several maize genes with high sequence similarity to vertebrate splicing factors. In particular, we have cloned a putative maize homolog of the human SC35 protein. To study the molecular phylogeny of this splicing factor and to characterize individual members of this multi-gene family, we decided to build our own database of SC35-related proteins. We pursued several common paths to derive this sequence collection: (1) Entrez text search for SC35 ; (2) NCBI BLAST search [AMS 97] with human SC35 against the non-redundant protein database GenPept; (3) NCBI BLASTX search against dbest. Figure 3 gives the (partial) output for approach (2); approach (1) gave a similar set. As displayed, human SC35 can be accessed by nine different accession numbers. The two groups of identical sequences represented by gi and gi ¼ differ by a single residue in the 221 amino acid protein. Thus, while Entrez provides a starting point for data collection, the process of deriving a non-redundant set of sequences is currently very cumbersome the different accessions must be downloaded locally and pairwise compared, representative sequences must be selected, and a final data set must be derived in a common format Identification of potential chloroplast proteins in Arabidopsis thaliana Now that the complete genome of the model dicot Arabidopsis thaliana is essentially at hand, many interesting questions can be posed and studied at the whole genome level. One such question concerns the cellular targeting of nuclear-encoded proteins. One approach is to use sequence analysis to determine the protein composition of the chloroplast. Because the chloroplast is believed to have derived from a cyanobacterial endosymbiont precursor, the following strategy seems reasonable: (1) retrieve the (FASTA-formatted) database of all Arabidopsis proteins and of all Synechocystis proteins (a completely sequenced cyanobacterium); (2) use a local BLAST comparison [AMS 97] to derive a set of significantly related pairs of proteins with one member of the pair each from one of the two species; (3) identify a potential signal peptide in the Arabidopsis proteins with
6 significant similarity to cyanobacterial proteins; and (4) determine possible roles for the identified proteins in biochemical pathways associated with the chloroplast. The intersection of sequence sets identified by (2)-(4) should provide a highly reliable set of definite chloroplast proteins. Novel methods for signal peptide identification can then be developed with this set as the positive training set. This approach is easily stated but its execution currently involves extensive programming and scripting. Query= gi pir A42701 PR264/SC35 protein -human (221 letters) Database: nr 511,898 sequences; 160,474,304 total letters Score E Sequences producing significant alignments: (bits) Value gi sp Q62093 SFR2_MOUSE SPLICING FACTOR, ARGININE/SERINE e-46 gi sp P30352 SFR2_CHICK SPLICING FACTOR, ARGININE/SERINE e-46 gi ref NP_ splicing factor, arginine/serine-ri e-46 gi ref NP_ splicing factor, arginine/serine-ri e-45 gi gb AAF AF232775_1 (AF232775) SR family splicin e-32 gi pir A46241 interferon response element-binding factor e-28 gi gb AAC (AF064592) RNA-binding protein [Schist e-26 gi sp Q09511 SFR2_CAEEL PUTATIVE SPLICING FACTOR, ARGINI e-25 gi pir T09704 probable arginine/serine-rich splicing fa e-16 >gi sp Q62093 SFR2_MOUSE SPLICING FACTOR, ARGININE/SERINE-RICH 2 (SC-35) (SPLICING COMPONENT, 35 KD) (PR264 PROTEIN) >gi emb CAA (X98511) PR264/SC35 [Mus musculus] >gi sp P30352 SFR2_CHICK SPLICING FACTOR, ARGININE/SERINE-RICH 2 (SC-35) (SPLICING COMPONENT, 35 KD) (PR264 PROTEIN) >gi pir B42701 PR264 protein - chicken >gi emb CAA (X62446) PR 264 [Gallus gallus] >gi prf A RNA-binding protein PR264 [Gallus gallus] >gi ref NP_ splicing factor, arginine/serine-rich 2 (SC-35) >gi pir A42701 PR264/SC35 protein - human >gi emb CAA (X62447) PR 264 [Homo sapiens] >gi emb CAA (X75755) PR264/SC35 [Homo sapiens] >gi gb AAC (AF077858) SC35 [Mus musculus] >gi prf B RNA-binding protein PR264 [Homo sapiens] >gi ref NP_ splicing factor, arginine/serine-rich 2 >gi sp Q01130 SFR2_HUMAN SPLICING FACTOR, ARGININE/SERINE-RICH 2 (SPLICING FACTOR SC35) (SC-35) (SPLICING COMPONENT, 35 KD) (PR264 PROTEIN) >gi pir A42634 splicing factor SC35 - human >gi gb AAA (M90104) splicing factor [Homo sapiens] Figure 3: (Partial) NCBI BLASTP output of a default query with a human SC35 protein sequence. Resolution of the query result into a non-redundant set of SC35-homologs would require much additional work of sequence and annotation comparisons Conserved Proteins Between Plants and Fungi but not Animals Similar to the previous problem, in this example the query involves initially the intersection of two sequence sets (plant and fungal protein sequences). Subsequently, we are interested in the complement of the result of the first intersection intersected with a third set (animal
7 proteins). The initial protein sets would be the complete protein repertoires of model organisms, and conservation would be assessed on the basis of strong sequence similarity Identification of Promoter Motifs for Co-regulated Genes A novel data resource of increasing application derives from microarray gene expression studies. A typical outcome of the analysis of such data would be the clustering of specific genes that appear to be co-regulated. Further analysis of such gene clusters would typically be directed at the ¼ -untranslated regions of these genes in search for common promoter motifs. A starting point for such analysis might be the sequence window of 500 bases upstream of the initiator methionine codon of all co-regulated genes (or their close homologs in other species). Figure 4: AtGDB - Whole genome view. The five Arabidopsis chromosomes are shown approximately to scale. Detailed views of particular genome locations are provided upon clicking the respective spot in the display.
8 2 An Arabidopsis thaliana Genome Database and Web-Workbench A common theme across the examples given above is the need to work with a subset or extract of data relevant to a particular research question. From many researchers experience, derivation of such extract can be one of the most time-consuming parts of a project. In our own work with the Arabidopsis genome we found data access and scope in the existing databases (TAIR, MATDB, mips.gsf.de/proj/thal) too limited. Figure 4 displays one of the entry pages into our local Arabidopsis database (AtGDB, zmdb.iastate.edu/plantgdb/atgdb), developed on MySQL ( The page illustrates one of the principles of molecular database interface design, which is to provide intuitive graphics to access the data in addition to command-line type access. In this case, the user can select a chromosomal segment of interest either by clicking on the graphic or by typing numberical coordinates in the toolbar fields. Figure 5: AtGDB - Query results refers to a particular gene family. All annotated genes from this family are shown with GenBank gene model code and respective genome location. Figure 5 shows the results of an alternative access point by querying for terms in the gene definition lines. The output lists all the locations of genes matching the search term,
9 Figure 6: AtGDB - Genome context view for a particular gene selected from the search results in Figure 5. The current gene model (GenBank annotation) is shown on the top in dark blue. Exons are shown as solid boxes, introns as lines. cdna (light blue and gray) and EST (red and pink) spliced alignments are shown below (the darker colors indicate cognate locations, whereas the lighter colors indicate that the respective sequence have a better match elsewhere in the genome). The green box associates ESTs experimentally known to derive from the same gene. and the user has again the choice to hone in on a particular gene by either clicking on the graphic or selecting the gene from the table. The listing below provides links to the
10 GenBank repository. The core of our database is shown in Figure 6. This schematic summarizes spliced alignment results of the type shown in Figure 2 using all available cdnas and ESTs matching the selected locus. The display is drawn dynamically from pre-computed spliced alignment coordinates stored in the database. Clicking on a particular sequence will show the record for that sequence (Figure 7) as well as provide links to insert this sequence directly into other tools, e.g. BLAST (Figure 8). Figure 7: AtGDB - Detail for a particular EST selected from the spliced alignment display in Figure 6. Alignment details and links to other analytical tools are available via buttons. A detailed description of biological background and questions addressed with the database and its interface are beyond the scope of this discussion. What I hope to convey are a number of design principles that in our view are critical for providing the best possible access to the rich resource of genomic sequence data. One key element is to parse the analytical output of standard research applications on the genome sequences also into the database, in addition to the raw sequence data and annotation. In this way, the full query capabilities of the database software can be applied to the results to quickly provide genome-wide views of the data. For example, it is now trivial to pull out a list of all gene models supported by
11 full-length cdna evidence, or to view all matching locations of a particular gene probe, or to select all duplicated gene pairs with different exon numbers, and so forth. A second point is to link the analytical tools directly to the displayed data so that all results can be reproduced by the user, possibly using different parameter choices or additional input data. In this way, for example, the biologist who is expert on a particular subset of genes is empowered to easily check the annotation provided in the database, without the awkward steps of having to download the sequence data, format the data correctly for input into local analytical programs, and then relating the results back to the database source. Ultimately, it would be helpful to design interfaces that will allow expert curation of the database via the Web. It is likely that in another 25 years hence today s achievements will look as insignificant as the small printed collections of sequences a quarter of a century ago. Figure 8: AtGDB - Integrated analytical tools. The EST sequence selected in Figure 7 is pasted into a text input window for a BLAST search against other sequence selections. I would like to acknowledge the students and staff in my research group at Iowa State University who has friends and collaborators contribute greatly to these emerging ideas and implementations.
12 Literature Cited [AMS 97] S.F. Altschul, T.L. Madden, A.A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D.J. Lipman. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Research, 25: , [Bre99] S. E. Brenner. Errors in genome annotation. Trends in Genetics, 15: , [KHRB96] P.G. Korning, S.M. Hebsgaard, P. Rouzé, and S. Brunak. Cleaning the GenBank Arabidopsis thaliana data set. Nucleic Acids Research, 24: , [UB00] J. Usuka and V. Brendel. Gene structure prediction by spliced alignment of genomic DNA with protein sequences: Increased accuracy by differential splice site scoring. Journal of Molecular Biology, 297: , 2000.
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
Bioinformatics Resources at a Glance
Bioinformatics Resources at a Glance A Note about FASTA Format There are MANY free bioinformatics tools available online. Bioinformaticists have developed a standard format for nucleotide and protein sequences
GenBank, Entrez, & FASTA
GenBank, Entrez, & FASTA Nucleotide Sequence Databases First generation GenBank is a representative example started as sort of a museum to preserve knowledge of a sequence from first discovery great repositories,
Just the Facts: A Basic Introduction to the Science Underlying NCBI Resources
1 of 8 11/7/2004 11:00 AM National Center for Biotechnology Information About NCBI NCBI at a Glance A Science Primer Human Genome Resources Model Organisms Guide Outreach and Education Databases and Tools
Searching Nucleotide Databases
Searching Nucleotide Databases 1 When we search a nucleic acid databases, Mascot always performs a 6 frame translation on the fly. That is, 3 reading frames from the forward strand and 3 reading frames
When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want
1 When you install Mascot, it includes a copy of the Swiss-Prot protein database. However, it is almost certain that you and your colleagues will want to search other databases as well. There are very
Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison
Introduction to Bioinformatics 2. DNA Sequence Retrieval and comparison Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]
Introduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
A Multiple DNA Sequence Translation Tool Incorporating Web Robot and Intelligent Recommendation Techniques
Proceedings of the 2007 WSEAS International Conference on Computer Engineering and Applications, Gold Coast, Australia, January 17-19, 2007 402 A Multiple DNA Sequence Translation Tool Incorporating Web
Biological Sequence Data Formats
Biological Sequence Data Formats Here we present three standard formats in which biological sequence data (DNA, RNA and protein) can be stored and presented. Raw Sequence: Data without description. FASTA
Biological Databases and Protein Sequence Analysis
Biological Databases and Protein Sequence Analysis Introduction M. Madan Babu, Center for Biotechnology, Anna University, Chennai 25, India Bioinformatics is the application of Information technology to
Protein & DNA Sequence Analysis. Bobbie-Jo Webb-Robertson May 3, 2004
Protein & DNA Sequence Analysis Bobbie-Jo Webb-Robertson May 3, 2004 Sequence Analysis Anything connected to identifying higher biological meaning out of raw sequence data. 2 Genomic & Proteomic Data Sequence
Efficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing
Efficient Parallel Execution of Sequence Similarity Analysis Via Dynamic Load Balancing James D. Jackson Philip J. Hatcher Department of Computer Science Kingsbury Hall University of New Hampshire Durham,
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
BIOINFORMATICS TUTORIAL
Bio 242 BIOINFORMATICS TUTORIAL Bio 242 α Amylase Lab Sequence Sequence Searches: BLAST Sequence Alignment: Clustal Omega 3d Structure & 3d Alignments DO NOT REMOVE FROM LAB. DO NOT WRITE IN THIS DOCUMENT.
A Tutorial in Genetic Sequence Classification Tools and Techniques
A Tutorial in Genetic Sequence Classification Tools and Techniques Jake Drew Data Mining CSE 8331 Southern Methodist University [email protected] www.jakemdrew.com Sequence Characters IUPAC nucleotide
Molecular Databases and Tools
NWeHealth, The University of Manchester Molecular Databases and Tools Afternoon Session: NCBI/EBI resources, pairwise alignment, BLAST, multiple sequence alignment and primer finding. Dr. Georgina Moulton
Similarity Searches on Sequence Databases: BLAST, FASTA. Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003
Similarity Searches on Sequence Databases: BLAST, FASTA Lorenza Bordoli Swiss Institute of Bioinformatics EMBnet Course, Basel, October 2003 Outline Importance of Similarity Heuristic Sequence Alignment:
Genome Explorer For Comparative Genome Analysis
Genome Explorer For Comparative Genome Analysis Jenn Conn 1, Jo L. Dicks 1 and Ian N. Roberts 2 Abstract Genome Explorer brings together the tools required to build and compare phylogenies from both sequence
Gene Models & Bed format: What they represent.
GeneModels&Bedformat:Whattheyrepresent. Gene models are hypotheses about the structure of transcripts produced by a gene. Like all models, they may be correct, partly correct, or entirely wrong. Typically,
Pairwise Sequence Alignment
Pairwise Sequence Alignment [email protected] SS 2013 Outline Pairwise sequence alignment global - Needleman Wunsch Gotoh algorithm local - Smith Waterman algorithm BLAST - heuristics What
Teaching Bioinformatics to Undergraduates
Teaching Bioinformatics to Undergraduates http://www.med.nyu.edu/rcr/asm Stuart M. Brown Research Computing, NYU School of Medicine I. What is Bioinformatics? II. Challenges of teaching bioinformatics
Guide for Bioinformatics Project Module 3
Structure- Based Evidence and Multiple Sequence Alignment In this module we will revisit some topics we started to look at while performing our BLAST search and looking at the CDD database in the first
Introduction to Bioinformatics 3. DNA editing and contig assembly
Introduction to Bioinformatics 3. DNA editing and contig assembly Benjamin F. Matthews United States Department of Agriculture Soybean Genomics and Improvement Laboratory Beltsville, MD 20708 [email protected]
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS
BIO 3350: ELEMENTS OF BIOINFORMATICS PARTIALLY ONLINE SYLLABUS NEW YORK CITY COLLEGE OF TECHNOLOGY The City University Of New York School of Arts and Sciences Biological Sciences Department Course title:
Module 1. Sequence Formats and Retrieval. Charles Steward
The Open Door Workshop Module 1 Sequence Formats and Retrieval Charles Steward 1 Aims Acquaint you with different file formats and associated annotations. Introduce different nucleotide and protein databases.
Sequence Formats and Sequence Database Searches. Gloria Rendon SC11 Education June, 2011
Sequence Formats and Sequence Database Searches Gloria Rendon SC11 Education June, 2011 Sequence A is the primary structure of a biological molecule. It is a chain of residues that form a precise linear
Clone Manager. Getting Started
Clone Manager for Windows Professional Edition Volume 2 Alignment, Primer Operations Version 9.5 Getting Started Copyright 1994-2015 Scientific & Educational Software. All rights reserved. The software
Tutorial. Reference Genome Tracks. Sample to Insight. November 27, 2015
Reference Genome Tracks November 27, 2015 Sample to Insight CLC bio, a QIAGEN Company Silkeborgvej 2 Prismet 8000 Aarhus C Denmark Telephone: +45 70 22 32 44 www.clcbio.com [email protected] Reference
BLAST. Anders Gorm Pedersen & Rasmus Wernersson
BLAST Anders Gorm Pedersen & Rasmus Wernersson Database searching Using pairwise alignments to search databases for similar sequences Query sequence Database Database searching Most common use of pairwise
Genomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
Bioinformatics Grid - Enabled Tools For Biologists.
Bioinformatics Grid - Enabled Tools For Biologists. What is Grid-Enabled Tools (GET)? As number of data from the genomics and proteomics experiment increases. Problems arise for the current sequence analysis
Lecture Outline. Introduction to Databases. Introduction. Data Formats Sample databases How to text search databases. Shifra Ben-Dor Irit Orr
Introduction to Databases Shifra Ben-Dor Irit Orr Lecture Outline Introduction Data and Database types Database components Data Formats Sample databases How to text search databases What units of information
SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE
AP Biology Date SICKLE CELL ANEMIA & THE HEMOGLOBIN GENE TEACHER S GUIDE LEARNING OBJECTIVES Students will gain an appreciation of the physical effects of sickle cell anemia, its prevalence in the population,
Choices, choices, choices... Which sequence database? Which modifications? What mass tolerance?
Optimization 1 Choices, choices, choices... Which sequence database? Which modifications? What mass tolerance? Where to begin? 2 Sequence Databases Swiss-prot MSDB, NCBI nr dbest Species specific ORFS
PlantGDB, plant genome database and analysis tools
D354±D359 Nucleic Acids Research, 2004, Vol. 32, Database issue DOI: 10.1093/nar/gkh046 PlantGDB, plant genome database and analysis tools Qunfeng Dong 1, Shannon D. Schlueter 1 and Volker Brendel 1,2,
SOP 3 v2: web-based selection of oligonucleotide primer trios for genotyping of human and mouse polymorphisms
W548 W552 Nucleic Acids Research, 2005, Vol. 33, Web Server issue doi:10.1093/nar/gki483 SOP 3 v2: web-based selection of oligonucleotide primer trios for genotyping of human and mouse polymorphisms Steven
Version 5.0 Release Notes
Version 5.0 Release Notes 2011 Gene Codes Corporation Gene Codes Corporation 775 Technology Drive, Ann Arbor, MI 48108 USA 1.800.497.4939 (USA) +1.734.769.7249 (elsewhere) +1.734.769.7074 (fax) www.genecodes.com
Focusing on results not data comprehensive data analysis for targeted next generation sequencing
Focusing on results not data comprehensive data analysis for targeted next generation sequencing Daniel Swan, Jolyon Holdstock, Angela Matchan, Richard Stark, John Shovelton, Duarte Mohla and Simon Hughes
Analyzing A DNA Sequence Chromatogram
LESSON 9 HANDOUT Analyzing A DNA Sequence Chromatogram Student Researcher Background: DNA Analysis and FinchTV DNA sequence data can be used to answer many types of questions. Because DNA sequences differ
BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs
BUDAPEST: Bioinformatics Utility for Data Analysis of Proteomics using ESTs Richard J. Edwards 2008. Contents 1. Introduction... 2 1.1. Version...2 1.2. Using this Manual...2 1.3. Why use BUDAPEST?...2
PROC. CAIRO INTERNATIONAL BIOMEDICAL ENGINEERING CONFERENCE 2006 1. E-mail: [email protected]
BIOINFTool: Bioinformatics and sequence data analysis in molecular biology using Matlab Mai S. Mabrouk 1, Marwa Hamdy 2, Marwa Mamdouh 2, Marwa Aboelfotoh 2,Yasser M. Kadah 2 1 Biomedical Engineering Department,
Final Project Report
CPSC545 by Introduction to Data Mining Prof. Martin Schultz & Prof. Mark Gerstein Student Name: Yu Kor Hugo Lam Student ID : 904907866 Due Date : May 7, 2007 Introduction Final Project Report Pseudogenes
Linear Sequence Analysis. 3-D Structure Analysis
Linear Sequence Analysis What can you learn from a (single) protein sequence? Calculate it s physical properties Molecular weight (MW), isoelectric point (pi), amino acid content, hydropathy (hydrophilic
MASCOT Search Results Interpretation
The Mascot protein identification program (Matrix Science, Ltd.) uses statistical methods to assess the validity of a match. MS/MS data is not ideal. That is, there are unassignable peaks (noise) and usually
Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at
Woods Hole Zebrafish Genetics and Development Bioinformatics/Genomics Lab Ian Woods Note: This document wh_informatics_practical.doc and supporting materials can be downloaded at http://faculty.ithaca.edu/iwoods/docs/wh/
Frequently Asked Questions Next Generation Sequencing
Frequently Asked Questions Next Generation Sequencing Import These Frequently Asked Questions for Next Generation Sequencing are some of the more common questions our customers ask. Questions are divided
Protein Synthesis How Genes Become Constituent Molecules
Protein Synthesis Protein Synthesis How Genes Become Constituent Molecules Mendel and The Idea of Gene What is a Chromosome? A chromosome is a molecule of DNA 50% 50% 1. True 2. False True False Protein
Overview of Eukaryotic Gene Prediction
Overview of Eukaryotic Gene Prediction CBB 231 / COMPSCI 261 W.H. Majoros What is DNA? Nucleus Chromosome Telomere Centromere Cell Telomere base pairs histones DNA (double helix) DNA is a Double Helix
SGI. High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems. January, 2012. Abstract. Haruna Cofer*, PhD
White Paper SGI High Throughput Computing (HTC) Wrapper Program for Bioinformatics on SGI ICE and SGI UV Systems Haruna Cofer*, PhD January, 2012 Abstract The SGI High Throughput Computing (HTC) Wrapper
org.rn.eg.db December 16, 2015 org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank accession numbers.
org.rn.eg.db December 16, 2015 org.rn.egaccnum Map Entrez Gene identifiers to GenBank Accession Numbers org.rn.egaccnum is an R object that contains mappings between Entrez Gene identifiers and GenBank
GenBank: A Database of Genetic Sequence Data
GenBank: A Database of Genetic Sequence Data Computer Science 105 Boston University David G. Sullivan, Ph.D. An Explosion of Scientific Data Scientists are generating ever increasing amounts of data. Relevant
Webserver: bioinfo.bio.wzw.tum.de Mail: [email protected]
Webserver: bioinfo.bio.wzw.tum.de Mail: [email protected] About me H. Werner Mewes, Lehrstuhl f. Bioinformatik, WZW C.V.: Studium der Chemie in Marburg Uni Heidelberg (Med. Fakultät, Bioenergetik)
DNA Sequence formats
DNA Sequence formats [Plain] [EMBL] [FASTA] [GCG] [GenBank] [IG] [IUPAC] [How Genomatix represents sequence annotation] Plain sequence format A sequence in plain format may contain only IUPAC characters
How To Use The Assembly Database In A Microarray (Perl) With A Microarcode) (Perperl 2) (For Macrogenome) (Genome 2)
The Ensembl Core databases and API Useful links Installation instructions: http://www.ensembl.org/info/docs/api/api_installation.html Schema description: http://www.ensembl.org/info/docs/api/core/core_schema.html
Genome Viewing. Module 2. Using Genome Browsers to View Annotation of the Human Genome
Module 2 Genome Viewing Using Genome Browsers to View Annotation of the Human Genome Bert Overduin, Ph.D. PANDA Coordination & Outreach EMBL - European Bioinformatics Institute Wellcome Trust Genome Campus
SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications
Product Bulletin Sequencing Software SeqScape Software Version 2.5 Comprehensive Analysis Solution for Resequencing Applications Comprehensive reference sequence handling Helps interpret the role of each
Sequencing the Human Genome
Revised and Updated Edvo-Kit #339 Sequencing the Human Genome 339 Experiment Objective: In this experiment, students will read DNA sequences obtained from automated DNA sequencing techniques. The data
SUBMITTING DNA SEQUENCES TO THE DATABASES
Bioinformatics: A Practical Guide to the Analysis of Genes and Proteins, Second Edition Andreas D. Baxevanis, B.F. Francis Ouellette Copyright 2001 John Wiley & Sons, Inc. ISBNs: 0-471-38390-2 (Hardback);
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
Geospiza s Finch-Server: A Complete Data Management System for DNA Sequencing
KOO10 5/31/04 12:17 PM Page 131 10 Geospiza s Finch-Server: A Complete Data Management System for DNA Sequencing Sandra Porter, Joe Slagel, and Todd Smith Geospiza, Inc., Seattle, WA Introduction The increased
Laboratorio di Bioinformatica
Laboratorio di Bioinformatica Lezione #2 Dr. Marco Fondi Contact: [email protected] www.unifi.it/dblemm/ tel. 0552288308 Dip.to di Biologia Evoluzionistica Laboratorio di Evoluzione Microbica e Molecolare,
Lecture 11 Data storage and LIMS solutions. Stéphane LE CROM [email protected]
Lecture 11 Data storage and LIMS solutions Stéphane LE CROM [email protected] Various steps of a DNA microarray experiment Experimental steps Data analysis Experimental design set up Chips on catalog
Replacing TaqMan SNP Genotyping Assays that Fail Applied Biosystems Manufacturing Quality Control. Begin
User Bulletin TaqMan SNP Genotyping Assays May 2008 SUBJECT: Replacing TaqMan SNP Genotyping Assays that Fail Applied Biosystems Manufacturing Quality Control In This Bulletin Overview This user bulletin
Data Integration. Lectures 16 & 17. ECS289A, WQ03, Filkov
Data Integration Lectures 16 & 17 Lectures Outline Goals for Data Integration Homogeneous data integration time series data (Filkov et al. 2002) Heterogeneous data integration microarray + sequence microarray
Chapter 4.3. of Molecular Plant Physiology Am Mühlenberg 1, D-14476 Golm, GERMANY;
Chapter 4.3 LOTUS JAPONICUS EXPRESSION DATABASE Sebastian Kloska 1, Peter Krüger 2, and Joachim Selbig 2,3* 1 Scienion AG, Volmerstrasse 7a, D-12489 Berlin, GERMANY; 2 Max Planck Institute of Molecular
Basic Analysis of Microarray Data
Basic Analysis of Microarray Data A User Guide and Tutorial Scott A. Ness, Ph.D. Co-Director, Keck-UNM Genomics Resource and Dept. of Molecular Genetics and Microbiology University of New Mexico HSC Tel.
Exercise with Gene Ontology - Cytoscape - BiNGO
Exercise with Gene Ontology - Cytoscape - BiNGO This practical has material extracted from http://www.cbs.dtu.dk/chipcourse/exercises/ex_go/goexercise11.php In this exercise we will analyze microarray
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem
FlipFlop: Fast Lasso-based Isoform Prediction as a Flow Problem Elsa Bernard Laurent Jacob Julien Mairal Jean-Philippe Vert September 24, 2013 Abstract FlipFlop implements a fast method for de novo transcript
200630 - FBIO - Fundations of Bioinformatics
Coordinating unit: Teaching unit: Academic year: Degree: ECTS credits: 2015 200 - FME - School of Mathematics and Statistics 1004 - UB - (ENG)Universitat de Barcelona MASTER'S DEGREE IN STATISTICS AND
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
UGENE Quick Start Guide
Quick Start Guide This document contains a quick introduction to UGENE. For more detailed information, you can find the UGENE User Manual and other special manuals in project website: http://ugene.unipro.ru.
Algorithms in Bioinformatics I, WS06/07, C.Dieterich 47. This lecture is based on the following, which are all recommended reading:
Algorithms in Bioinformatics I, WS06/07, C.Dieterich 47 5 BLAST and FASTA This lecture is based on the following, which are all recommended reading: D.J. Lipman and W.R. Pearson, Rapid and Sensitive Protein
Microarray Data Analysis. A step by step analysis using BRB-Array Tools
Microarray Data Analysis A step by step analysis using BRB-Array Tools 1 EXAMINATION OF DIFFERENTIAL GENE EXPRESSION (1) Objective: to find genes whose expression is changed before and after chemotherapy.
Global and Discovery Proteomics Lecture Agenda
Global and Discovery Proteomics Christine A. Jelinek, Ph.D. Johns Hopkins University School of Medicine Department of Pharmacology and Molecular Sciences Middle Atlantic Mass Spectrometry Laboratory Global
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
BIOINF 525 Winter 2016 Foundations of Bioinformatics and Systems Biology http://tinyurl.com/bioinf525-w16
Course Director: Dr. Barry Grant (DCM&B, [email protected]) Description: This is a three module course covering (1) Foundations of Bioinformatics, (2) Statistics in Bioinformatics, and (3) Systems
DNA Banking International Efforts
DNA Banking International Efforts J. L. Karihaloo Asia-Pacific Consortium on Agricultural Biotechnology, New Delhi DNA Bank DNA Bank is a particular type of genebank that preserves and distributes the
Special report. Chronic Lymphocytic Leukemia (CLL) Genomic Biology 3020 April 20, 2006
Special report Chronic Lymphocytic Leukemia (CLL) Genomic Biology 3020 April 20, 2006 Gene And Protein The gene that causes the mutation is CCND1 and the protein NP_444284 The mutation deals with the cell
InSyBio BioNets: Utmost efficiency in gene expression data and biological networks analysis
InSyBio BioNets: Utmost efficiency in gene expression data and biological networks analysis WHITE PAPER By InSyBio Ltd Konstantinos Theofilatos Bioinformatician, PhD InSyBio Technical Sales Manager August
Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6
Introduction to Bioinformatics AS 250.265 Laboratory Assignment 6 In the last lab, you learned how to perform basic multiple sequence alignments. While useful in themselves for determining conserved residues
Evolutionary Bioinformatics. EvoPipes.net: Bioinformatic Tools for Ecological and Evolutionary Genomics
Evolutionary Bioinformatics Short Report Open Access Full open access to this and thousands of other papers at http://www.la-press.com. EvoPipes.net: Bioinformatic Tools for Ecological and Evolutionary
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
T cell Epitope Prediction
Institute for Immunology and Informatics T cell Epitope Prediction EpiMatrix Eric Gustafson January 6, 2011 Overview Gathering raw data Popular sources Data Management Conservation Analysis Multiple Alignments
