Leclercq, A., C. Charlier, and M. Lecuit Global burden of listeriosis: the tip of the iceberg. Lancet Infect Dis. In press

Save this PDF as:

Size: px
Start display at page:

Download "Leclercq, A., C. Charlier, and M. Lecuit. 2014. Global burden of listeriosis: the tip of the iceberg. Lancet Infect Dis. In press"


1 2014 Charlier, C., C. Fevre, L. Travier, B. Cazenave, H. Bracq-Dieye, J. Podevin, D. Assomany, L. Guilbert, C. Bossard, F. Carpentier, V. Cales, A. Leclercq, and M. Lecuit. Listeria monocytogenes-associated Biliary Tract Infections: A Study of 12 Consecutive Cases and Review. Medicine (Baltimore) 93:e105. Girard, D., A. Leclercq, E. Laurent, M. Lecuit, H. de Valk, and V. Goulet Pregnancy-related listeriosis in France, 1984 to 2011, with a focus on 606 cases from 1999 to Euro Surveill 19. Leclercq, A., C. Charlier, and M. Lecuit Global burden of listeriosis: the tip of the iceberg. Lancet Infect Dis. In press Tourdjman M, Laurent E, Leclercq A Listériose humaine : une zoonose d origine alimentaire. Revue Francophone des Laboratoires. 464(37). Hmaied, F., S. Helel, V. Le Berre, J. M. Francois, A. Leclercq, M. Lecuit, H. Smaoui, A. Kechrid, A. Boudabous, and I. Barkallah Prevalence, identification by a DNA microarray-based assay of human and food isolates Listeria spp. from Tunisia. Pathol Biol (Paris) 62(1):24-9. Charlier-Woerther, C., and M. Lecuit Listeriosis and pregnancy. Presse Med 43: Leclercq, A., A. Oevermann, R. Danguy-des-Déserts, Sophie Granier, Thomas Hammack, Karen Jinneman, Yi Chen, Robert Rathbone, Garlon Riegler Listeria monocytogenes. Chapitre In OIE Terrestrial Manual. World Organization for Animal Health (OIE), Paris. Lecuit, M., and C. Charlier. Listériose. Chapitre 67. Pilly Edition Charlier, C., Goffinet, F., Azria E., Leclercq, A., Lecuit, M Inadequate management of pregnancy-associated listeriosis: lessons from four case-reports. Clin Infect Dis. 20(3): Charlier, C., and M. Lecuit Fiches e-popi Micrococcus, Listeria, Fusarium, Geotrichum et Malassezia. Chenal-Francisque, V., C. Charlier, S. Mehvish, H. Dieye, A. Leclercq, P. Courvalin, and M. Lecuit Highly Rifampin-Resistant Listeria monocytogenes Isolated from a Patient with Prosthetic Bone Infection. Antimicrob Agents Chemother 58(3): Le Lamer, S., I. Desforges, and A. Leclercq. Octobre Le Point sur : les Listeria. biomérieux Lettre de veille Normative. biomérieux, Marcy l Etoile. Haase, J. K., X. Didelot, M. Lecuit, H. Korkeala, L. monocytogenes MLST study group (A. Leclercq, K. Grant, M. Wiedmann, Petra Apfalter) and M. Achtman. The ubiquitous nature of Listeria monocytogenes clones: a large-scale Multilocus Sequence Typing study. Environ Microbiol. 16(2): Disson O, Lecuit M In vitro and in vivo models to study human listeriosis: mind the gap. Microbes Infect 15:

2 Cantinelli T, Chenal-Francisque V, Diancourt L, Frezal L, Leclercq A, Wirth T, Lecuit M, Brisse S "Epidemic Clones" of Listeria monocytogenes Are Widespread and Ancient Clonal Groups.J Clin Microbiol. 51(11): Lazarus, C., A. Leclercq, M. Lecuit, V. Vaillant, B. Coignard, H. Blanchard, I. Novakova, and P. Astagneau Probable nosocomial transmission of listeriosis in neonates. J Hosp Infect. 85(2): J. Zuk, S. Bazan-Socha, J. Zarychta, A. Leclercq,Marc Lecuit, A. Le Flèche-Matéos, J. Orlowska- Heitzman, J.Musial Disseminated nocardiosis mimicking exacerbation of pulmonary Sarcoidosis. Sarcoidosis Vasculitis and Diffuse Lung Diseases. 30: Chenal-Francisque, V., L. Diancourt, T. Cantinelli, V. Passet, C. Tran-Hykes, H. Bracq-Dieye, A. Leclercq, C. Pourcel, M. Lecuit, and S. Brisse Optimized Multilocus Variable-Number Tandem-Repeat Analysis Assay and Its Complementarity with Pulsed-Field Gel Electrophoresis and Multilocus Sequence Typing for Listeria monocytogenes Clone Identification and Surveillance. J Clin Microbiol 51: Travier, L., S. Guadagnini, E. Gouin, A. Dufour, V. Chenal-Francisque, P. Cossart, J. C. Olivo- Marin, J. M. Ghigo, O. Disson, and M. Lecuit ActA Promotes Listeria monocytogenes Aggregation, Intestinal Colonization and Carriage. PLoS Pathog 9:e Mailles, A., De Broucker, T., Costanzo, P., Martinez-Almoyna L, Vaillant V, Stahl JP, Bebear C, Bernillon P, Brouard C, de Broucker T, Cua E, Dabernat H, Floret D, Lecuit M et al Long-term outcome of patients presenting with acute infectious encephalitis of various causes in France Clin Infect Dis. 54(10): Disson, O., and M. Lecuit Targeting of the central nervous system by Listeria monocytogenes. Virulence 3: Archambaud, C., M. A. Nahori, G. Soubigou, C. Becavin, L. Laval, P. Lechat, T. Smokvina, P. Langella, M. Lecuit, and P. Cossart Impact of lactobacilli on orally acquired listeriosis. Proc Natl Acad Sci U S A 109: Roche, S. M., O. Grepinet, A. Kerouanton, M. Ragon, A. Leclercq, S. Temoin, B. Schaeffer, G. Skorski, L. Mereghetti, A. Le Monnier, and P. Velge Polyphasic characterization and genetic relatedness of low-virulence and virulent Listeria monocytogenes isolates. BMC Microbiol 12:304. Farfour, E., J. Leto, M. Barritault, C. Barberis, J. Meyer, B. Dauphin, A. S. Le Guern, A. Lefleche, E. Badell, N. Guiso, A. Leclercq, A. Le Monnier, M. Lecuit, V. Rodriguez-Nava, E. Bergeron, J. Raymond, S. Vimont, E. Bille, E. Carbonnelle, H. Guet-Revillet, H. Lecuyer, J. L. Beretti, C. Vay, P. Berche, A. Ferroni, X. Nassif, and O. Join-Lambert. Evaluation of the Andromas MALDI-TOF MS system for identification of aerobically growing Gram-positive Bacilli. J Clin Microbiol. 50:

3 Roussel S., Leclercq A., Santolini J., Agbessi A., Chenal-Francisque V., Lailler R., Lecuit M., Pihier N., and A. Brisabois. Surveillance des Listeria monocytogenes dans les aliments. BEH Hors série. 9 mai p Goulet V., Leclercq A., Laurent E., King L.A., Chenal-Francisque V., Vaillant V., Letort M.J., Lecuit M., and H. de Valk. Surveillance de la listériose humaine en France, BEH Hors série. 9 mai p Respaud R, Grayo S, Singlas E, Dubouch S, Le Monnier A, Lott MC. High-performance liquid chromatography assay for moxifloxacin in brain tissue and plasma: validation in a pharmacokinetic study in a murine model of cerebral listeriosis. J Anal Methods Chem. 2012;2012: Epub 2012 Mar 14. Charlier, C., A. Leclercq, B. Cazenave, N. Desplaces, L. Travier, T. Cantinelli, O. Lortholary, V. Goulet, A. Le Monnier, and M. Lecuit. Listeria monocytogenes-associated Joint and Bone Infections: A Study of 43 Consecutive Cases. Clin Infect Dis 54: Mailles, A., M. Lecuit, V. Goulet, A. Leclercq, and J. P. Stahl Listeria monocytogenes encephalitis in France. Med Mal Infect 41: Chaussade, H., D. Garot, F. Bastides, C. De Gialluly, E. Mercier, G. Gras, A. Leclercq, and D. Perrotin [A Touraine cluster of central nervous system listeriosis]. Med Mal Infect 41: Coste, J. F., V. Duval, Y. Nguyen, T. Guillard, L. Brasme, C. David, C. Strady, M. Lecuit, and C. de Champs Unusual location of a brain abscess due to Listeria monocytogenes. Pathol Biol (Paris). Charlier-Woerther, C., et Lecuit M Infections de la mère et de l enfant. La lettre de l Internat. Chenal-Francisque, V. J. Lopez, T. Cantinelli, V. Caro, C. Tran, A. Leclercq, M. Lecuit, and S. Brisse Worldwide distribution of major clones of Listeria monocytogenes. Emerg Infect Dis 17: Hein, I., S. Klinger, M. Dooms, G. Flekna, B. Stessl, A. Leclercq, C. Hill, F. Allerberger, and M. Wagner Stress survival islet 1 (SSI-1) survey in Listeria monocytogenes reveals an insert common to Listeria innocua in sequence type 121 L. monocytogenes strains. Appl Environ Microbiol 77: Lombard B, and A. Leclercq Validation of innovative food microbiological methods according to the EN ISO standard. Food Analytical Methods. 4(2):

4 Laciar, A. L., M. L. Vaca Ruiz, and A. Le Monnier. Neonatal Listeria-meningitis in San Luis, Argentina: a three-case report. Rev Argent Microbiol 43:45-7. Leclercq, A., V. Chenal-Francisque, H. Dieye, T. Cantinelli, R. Drali, S. Brisse, and M. Lecuit Characterization of the novel Listeria monocytogenes PCR serogrouping profile IVb-v1. Int J Food Microbiol 147:74-7. Le Monnier, A., S. Blanot, E. Abachin, J. L. Beretti, P. Berche, and S. Kayal. Listeria monocytogenes: a rare complication of ventriculoperitoneal shunt in children. J Clin Microbiol 49: Le Monnier, A., E. Abachin, J. L. Beretti, P. Berche, and S. Kayal. Diagnosis of Listeria monocytogenes meningoencephalitis by real-time PCR for the hly gene. J Clin Microbiol 49: Nikitas G, Deschamps C, Disson O, Niault T, Cossart P, Lecuit M Transcytosis of Listeria monocytogenes across the intestinal barrier upon specific targeting of goblet cell accessible E-cadherin. J. Exp. Med. 208(11): Breurec S, Poueme R, Fall C, Tall A, Diawara A, Bada-Alambedji R, Broutin C, Leclercq A, Garin B. Microbiological quality of milk from small processing units in Senegal. Foodborne Pathog Dis. 2010; 7(5): Morvan A, Moubareck C, Leclercq A, Hervé-Bazin M, Bremont S, Lecuit M, Courvalin P, LeMonnier A. Antimicrobial resistance of Listeria monocytogenes human strains isolated in France. Antimicrob Agents Chemother. 2010; 54(6): Guillet C, Join-Lambert O, Le Monnier A, Leclercq A, Mechaï F, Mamzer-Bruneel MF, Bielecka MK, Scortti M, Disson O, Berche P, Vazquez-Boland JA, Lortholary O, Lecuit M. Human listeriosis due to Listeria ivanovii. Emerg Infect Dis. 2010;16(1): Almeida G, Morvan A, Magakhaes R, Santos I, Hogg T, Leclercq A, Teixeira P, Research Team. Distribution and characterization of Listeria monocytogenes clinical isolates in Portugal, Eur J Clin Microbiol Infect Dis. 2010; 29(10): Leclercq A, Clermont D, Bizet C, Grimont PAD, Le Flèche-Matéos A, Roche SM, Buchrieser C, Cadet-Daniel V, Le Monnier A, Lecuit M, Allerberger F. Listeria rocourtiae sp. nov. Int J Syst Evol Microbiol. 2010; 60(9): Disson O, Nikitas G, Grayo S, Dussurget O, Cossart P, Lecuit M. Modeling human listeriosis in natural and genetically engineered animals. Nat Protoc.2009; 4(6):

5 Cordano AM, Jacquet C. Listeria monocytogenes isolated from vegetable salads sold at supermarkets in Santiago, Chile: prevalence and strain characterization. Int J Food Microbiol. 2009; 132(2-3): Roche SM, Kerouanton A, Minet J, Le Monnier A, Brisabois A, Velge P. Prevalence of lowvirulence Listeria monocytogenes strains from different foods and environments. Int J Food Microbiol. 2009; 130(2): Fayol L, Beizig S, Le Monnier A, Lacroze V, Simeoni U. Neonatal meningitis due to Listeria monocytogenes after 3 weeks of maternal treatment during pregnancy. Arch Pediatr. 2009; 16(4): Lecuit M. Traversée de la barrière placentaire par Listeria monocytogenes. Arch. Pediatr. 2009; 16: Charlier-Woerther C, Leclercq A, Lortholary O, Lecuit M. Listeriosis, a rare but severe foodborne infection. Rev Prat. 2009; 59(7): Parihar VS, Lopez-Valladares G, Danielsson-Tham ML, Peiris I, Helmersson S,Unemo M, Andersson B, Arneborn M, Bannerman E, Barbuddhe S, Bille J, Hajdu L,Jacquet C, Johansson C, Löfdahl M, Möllerberg G, Ringberg H, Rocourt J, TjernbergI, Ursing J, Henriques-Normark B, Tham W. Characterization of human invasive isolates of Listeria monocytogenes in Sweden Foodborne Pathog Dis.2008; 5(6): Le Monnier A, Leclercq A. Listeria and listeriosis: from farm to fork. Pathol Biol (Paris). 2009; 57(1): Disson O, Grayo S, Huillet E, Nikitas G, Langa-Vives F, Dussurget O, Ragon M, Le Monnier A, Babinet C, Cossart P, Lecuit M. Conjugated action of two species-specific invasion proteins for fetoplacental listeriosis. Nature. 2008; 455(7216): Ragon M, Wirth T, Hollandt F, Lavenir R, Lecuit M, Le Monnier A, Brisse S. A new perspective on Listeria monocytogenes evolution. PLoS Pathog. 2008; 4(9):e Goulet V, Leclercq A, Vaillant V, Le Monnier A, Laurent E, Thierry-Bled F, Pihier N, de Valk H. Augmentation récente de la listériose en France. BEH 2009; 31: Cabanes D, Lecuit M, Cossart P. Animal models of Listeria infection. Curr Protoc Microbiol. 2008; Chapter 9:Unit9B.1. Grayo S, Lott-Desroches MC, Dussurget O, Respaud R, Fontanet A, Join-Lambert O, Singlas E, Le Monnier A. Rapid eradication of Listeria monocytogenes by moxifloxacin in a murine model of central nervous system listeriosis. Antimicrob Agents Chemother. 2008; 52(9):

6 Goulet V, Hedberg C, Le Monnier A, de Valk H. Increasing incidence of listeriosis in France and other European countries. Emerg Infect Dis. 2008; 14(5): Grayo S, Join-Lambert O, Desroches MC, Le Monnier A. Comparison of the in vitro efficacies of moxifloxacin and amoxicillin against Listeria monocytogenes. Antimicrob Agents Chemother. 2008; 52(5): Sabet C, Toledo-Arana A, Personnic N, Lecuit M, Dubrac S, Poupel O, Gouin E, Nahori MA, Cossart P, Bierne H. The Listeria monocytogenes virulence factor InlJ is specifically expressed in vivo and behaves as an adhesin. Infect Immun. 2008; 76(4): Bou-m'handi N, Jacquet C, El Marrakchi A, Martin P. Phenotypic and molecular characterization of Listeria monocytogenes strains isolated from a marine environment in Morocco. Foodborne Pathog Dis. 2007; 4(4): Hain T, Chatterjee SS, Ghai R, Kuenne CT, Billion A, Steinweg C, Domann E, Kärst U, Jänsch L, Wehland J, Eisenreich W, Bacher A, Joseph B, Schär J, Kreft J, Klumpp J, Loessner MJ, Dorscht J, Neuhaus K, Fuchs TM, Scherer S, Doumith M, Jacquet C, Martin P, Cossart P, Rusniock C, Glaser P, Buchrieser C, Goebel W,Chakraborty T. Pathogenomics of Listeria spp. Int J Med Microbiol. 2007; 297(7-8): Hamdi TM, Naïm M, Martin P, Jacquet C. Identification and molecular characterization of Listeria monocytogenes isolated in raw milk in the region of Algiers (Algeria). Int J Food Microbiol. 2007; 116(1): Le Monnier A, Autret N, Join-Lambert OF, Jaubert F, Charbit A, Berche P, Kayal S. ActA is required for crossing of the placental barrier by Listeria monocytogenes. Infect Immun 2007; 116:190-3 Hong E, Doumith M, Duperrier S, Giovannacci I, Morvan A, Glaser P, Buchrieser C, Jacquet C, Martin P. Genetic diversity of Listeria monocytogenes recovered from infected persons and pork, seafood and dairy products on retail sale in France during 2000 and Int J Food Microbiol. 2007; 114(2): Doumith M, Jacquet C, Goulet V, Oggioni C, Van Loock F, Buchrieser C, Martin P. Use of DNA arrays for the analysis of outbreak-related strains of Listeria monocytogenes. Int J Med Microbiol. 2006; 296(8): Martin P, Jacquet C, Goulet V, Vaillant V, De Valk H; Participants in the PulseNet Europe Feasibility Study. Pulsed-field gel electrophoresis of Listeria monocytogenes strains: the PulseNet Europe Feasibility Study. Foodborne Pathog Dis. 2006; 3(3): Paciorek J, Jacquet C, Salcedo C, Doumith M, Vázquez JA, Martin P. Genotypes of Listeria monocytogenes strains isolated from 2000 to 2002 in Poland. Pol J Microbiol. 2006; 55(1):31-

7 5. Goulet V, Jacquet C, Martin P, Vaillant V, Laurent E, de Valk H. Surveillance of human listeriosis in France, Euro Surveill. 2006; 11(6): Le Monnier A, Join-Lambert O.F., Jaubert F., Berche P. And Kayal S. Invasion of the placenta during murine listeriosis. Infect Immun 2006; 74(1): Leite P, Rodrigues R, Ferreira M, Ribeiro G, Jacquet C, Martin P, Brito L. Comparative characterization of Listeria monocytogenes isolated from Portuguese farmhouse ewe's cheese and from humans. Int J Food Microbiol. 2006; 106(2): Roche SM, Gracieux P, Milohanic E, Albert I, Virlogeux-Payant I, Témoin S, Grépinet O, Kerouanton A, Jacquet C, Cossart P, Velge P. Investigation of specific substitutions in virulence genes characterizing phenotypic groups of low-virulence field strains of Listeria monocytogenes. Appl Environ Microbiol. 2005; 71(10): Bigot A, Pagniez H, Botton E, Fréhel C, Dubail I, Jacquet C, Charbit A, Raynaud C. Role of FliF and FliI of Listeria monocytogenes in flagellar assembly and pathogenicity. Infect Immun. 2005; 73(9): Erratum in: Infect Immun.2007; 75(2): Doumith M, Buchrieser C, Glaser P, Jacquet C, Martin P. Differentiation of the major Listeria monocytogenes serovars by multiplex PCR. J Clin Microbiol. 2004; 42(8): Jacquet C, Doumith M, Gordon JI, Martin PM, Cossart P, Lecuit M. A molecular marker for evaluating the pathogenic potential of foodborne Listeria monocytogenes. J Infect Dis. 2004; 189(11): Leclercq A. Atypical colonial morphology and low recoveries of Listeria monocytogenes strains on Oxford, PALCAM, Rapid'L.mono and ALOA solid media.j Microbiol Methods. 2004; 57(2): Doumith M, Cazalet C, Simoes N, Frangeul L, Jacquet C, Kunst F, Martin P, Cossart P, Glaser P, Buchrieser C. New aspects regarding evolution and virulence of Listeria monocytogenes revealed by comparative genomics and DNA arrays. Infect Immun. 2004; 72(2): Roche SM, Gracieux P, Albert I, Gouali M, Jacquet C, Martin PM, Velge P. Experimental validation of low virulence in field strains of Listeria monocytogenes. Infect Immun. 2003; 71(6): Rocourt J, BenEmbarek P, Toyofuku H, Schlundt J. Quantitative risk assessment of Listeria

8 monocytogenes in ready-to-eat foods: the FAO/WHO approach. FEMS Immunol Med Microbiol. 2003; 35(3): Review. Godreuil S, Galimand M, Gerbaud G, Jacquet C, Courvalin P. Efflux pump Lde is associated with fluoroquinolone resistance in Listeria monocytogenes. Antimicrob Agents Chemother. 2003; 47(2): Jacquet C, Gouin E, Jeannel D, Cossart P, Rocourt J. Expression of ActA, Ami,InlB, and listeriolysin O in Listeria monocytogenes of human and food origin. Appl Environ Microbiol. 2002;68(2): Buncic, S. ; Avery, S.M. ; Rocourt, J. and Dimitrijevic, M. Can food-related environmental factors induce different behaviour in two key serovars, 4b and 1/2a, of Listeria monocytogenes? Intern. J. Food Microbiol. 2001; 65: De Valk, H.; Vaillant, V.; Jacquet, Ch.; Rocourt, J.; Le Querrec, F.; Stainer, F.; Quelquejeu, N.; Pierre, O.; Pierre, V.; Desenclos, J.-C., and Goulet, V. Two consecutive nationwide outbreaks of listeriosis in France, October 1999-February Amer. J. Epidemiol. 2001; 154: Goulet, V. ; Jacquet, Ch. ; Laurent, E. ; Rocourt, J. ; Vaillant, V. and de Valk, H. La surveillance de la listériose humaine en France en Bull. Epidemiol. Hebdo ;34 : De Valk, H. ; Rocourt, J.; Lequerrec, F. ; Jacquet, Ch. ; Vaillant, V. ; Portal, H. ; Pierre, O. ; Pierre, V. ; Stainer, F ; Salvat, G. and Goulet, V. Bouffée épidémique de listériose liée à la consommation de rillettes. Bull. Epidemiol. Hebdom ;4 :15-17 Rocourt, J. ; Jacquet, Ch. Listeria et listériose. ESKA ; 46 : Rocourt, J. ; Jacquet, Ch. Listériose. Option/Bio ;243/244 : Rocourt, J. ; Jacquet, Ch. and Reilly, A. Epidemiology of human listeriosis and seafoods. Intern. J. Food Microbiol. 2000; 62: Jacquet, Ch.; Brouillé, F.; Saint-Cloment, C.; Catimel, B., and Rocourt, J. La listériose humaine en France en Bull. Epidém. Hebdo. 1999; 37: Tham, W.; Bannerman, E.; Bille, J.; DanielssonTham, M. L.; Eld, K.; Ericsson, H.; GavierWiden, D.; Rocourt, J., and Morner, T. Listeria monocytogenes subtypes associated with mortality among fallow deer (Dama dama). J. Zoo Wildlife Med. 1999; 30:

9 1998 De Valk, H.; Vaillant, V.; Pierre, V.; Rocourt, J.; Jacquet, Ch.; Lequerrec, F.; Thomas, J.-C., and Goulet, V. Risk factors for sporadic listeriosis in France. In : abstracts of th XII International symposium on problems of listeriosis. Halifax, Canada Goulet, V.; Rocourt, J.; Rebiere, I.; Jacquet, C.; Moyse, C.; Dehaumont, P.; Salvat, G., and Veit, P. Listeriosis outbreak associated with the consumption of rillettes in France in J. Infect. Dis. 1998; 177: Jacquet, Ch.; Saint-Cloment, C.; Brouille, F.; Catimel, B., and Rocourt, J. La listériose humaine en France en Données du Centre National de Référence des Listeria. Bull. Epidémiol. Hebdo. 1998; 33:142:143. Rocourt, J.; Jacquet, Ch.; Brouillé, F.; Saint-Cloment, C., and Catimel, B. La listériose humaine en France en 1995 et Feuillets De Biol. 1998; 224: Danielsson-Tham, M. L.; Prag, M.; Rocourt, J.; Seeliger, H.; Tham, W., and Vikerfors, T. A fatal case of Listeria endocarditis in a man following his tending of goats suggests an epidemiological link which is not supported by the results. J. Vet. Med. 1997; 44: Jacquet, Ch.; Catimel, B.; Veit, P., and Rocourt, J. Evaluation du RAPD (Random amplification of polymorphic DNA) comme outil pour l'épidémiosurveillance de la listériose effectuée par le Centre National de Référence des Listeria. Epidémiol. Santé Anim. 1997: Rocourt, J. and Bille, J. Foodborne listeriosis. Wld Hlth Statist. Quart. 1997; 50: Rocourt, J. and Cossart, P. Listeria monocytogenes. In : food microbiology - fundamentals and frontiers (M.P. Doyle, L.R. Beuchat, T.J. MOntville, eds). ASM Press. 1997: Rocourt, J.; Jacquet, Ch., and Bille, J. Human listeriosis, Food Safety Unit - WHOFNU/FOS/ Rocourt, J.; Jacquet, Ch.; Brouillé, F.; Saint-Cloment, C., and Catimel, B. La listériose humaine en France en 1995 et Données du Centre National de Référence des Listeria. Bull. Epidem. Hebdo. 1997; 41: Rocourt, J. and McLauchlin, J. International committee on systematic bacteriology subcommittee on the taxonomy of Listeria, Brochothrix, and Erysipelothrix. Intern. J. System. Bacteriol. 1997; 47:1273. Rocourt, J.; Weise-Prinzo, Z., and Kaferstein, F. K. Nepal : food safety profile and health education in food safety. Dairy, Food Environ. Sanit. 1997; 17:

10 1996 Bille, J. and Rocourt, J. WHO International Multicenter Listeria monocytogenes Subtyping Study - Rationale and set-up of the study. Intern. J. Food Microbiol. 1996; 32(3): Brosch, R.; Brett, M.; Catimel, B.; Luchansky, J. B.; Ojeniyi, B., and Rocourt, J. Genomic fingerprinting of 80 strains from the WHO multicenter international typing study of Listeria monocytogenes via pulsed-field gel electrophoresis (PFGE). Inter. J. Food Microbiol. 1996; 32: Ericsson, H.; Stalhandske, P.; Danielssontham, M. L.; Bannerman, E.; Bille, J.; Jacquet, C.; Rocourt, J.; Ursing, J., and Tham, W. Division into five groups by REA of the most frequently isolated phagovar of Listeria monocytogenes in Sweden Med. Microbiol. Lett. 1996; 5: McLaughlin, J.; Audurier, A.; Frommelt, A.; Gerner-Smidt, P.; Jacquet, Ch.; Loessner, M. J.; Van der Mee-Marquet, N.; Rocourt, J.; Shah, S., and Wilhelms, D. WHO study on subtyping Listeria monocytogenes: Results of phage-typing. Int. J. Food Microbiol. 1996; 32: Rocourt, J. Risk factors for listeriosis. Food Control. 1996; 7: Rocourt, J. Taxonomy of the Listeria genus and typing of L. monocytogenes. Pathologie Biologie. 1996; 44: Swaminathan, B.; Hunter, S. B.; Desmarchelier, P. M.; Gerner-Smidt, P.; Graves, L. M.; Harlander, S.; Hubner, R.; Jacquet, Ch.; Pedersen, B.; Reineccius, K.; Ridley, A.; Saudners, N. A., and Webster, J. A. WHO-sponsored international collaborative study to evaluate methods for subtyping Listeria monocytogenes: restriction fragment length polymorphism (RFLP) analysis using ribotyping and Southern hybridization with two probes derived from L. monocytogenes chromosome. Int. J. Food Microbiol. 1996; 32:

The National Antimicrobial Resistance Monitoring System (NARMS)

The National Antimicrobial Resistance Monitoring System (NARMS) The National Antimicrobial Resistance Monitoring System (NARMS) Strategic Plan 2012-2016 Table of Contents Background... 2 Mission... 3 Overview of Accomplishments, 1996-2011... 4 Strategic Goals and Objectives...

More information

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità

EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità EU Reference Laboratory for E. coli Department of Veterinary Public Health and Food Safety Unit of Foodborne Zoonoses Istituto Superiore di Sanità Inventory of the expertise on molecular typing of Verocytotoxin-producing

More information

Food Safety Issues Arising at Food Production in a Global Market

Food Safety Issues Arising at Food Production in a Global Market Journal of Agribusiness 18(1), Special Issue (March 2000):129S133 2000 Agricultural Economics Association of Georgia Food Safety Issues Arising at Food Production in a Global Market Michael P. Doyle Foodborne

More information



More information

Updated ECDC Public Health Microbiology Strategy and Work Plan 2012-2016

Updated ECDC Public Health Microbiology Strategy and Work Plan 2012-2016 Updated ECDC Public Health Microbiology Strategy and Work Plan 2012-2016 Marc Struelens Microbiology Coordination Section, Resource Management and Coordination Unit Ole Heuer Surveillance Section, Surveillance

More information

Does Big Data offer Better Solutions for Microbial Food Safety and Quality?

Does Big Data offer Better Solutions for Microbial Food Safety and Quality? Does Big Data offer Better Solutions for Microbial Food Safety and Quality? Martin Wiedmann Department of Food Science Cornell University, Ithaca, NY E-mail: Acknowledgments Helpful discussions

More information

The Role of Whole Genome Sequencing in Outbreak Detection and Investigation

The Role of Whole Genome Sequencing in Outbreak Detection and Investigation The Role of Whole Genome Sequencing in Outbreak Detection and Investigation Peter Evans FDA-CFSAN College Park, MD Pathogen Control and Regulatory Compliance in Beef Processing Conference September 9-10,

More information

Workshop on Methods for Isolation and Identification of Campylobacter spp. June 13-17, 2005

Workshop on Methods for Isolation and Identification of Campylobacter spp. June 13-17, 2005 Workshop on Methods for Isolation and Identification of Campylobacter spp June 13-17, 2005 Goal: build capacity within the state public health laboratories to effectively identify Campylobacter species

More information

Use of Whole Genome Sequencing (WGS) of food-borne pathogens for public health protection

Use of Whole Genome Sequencing (WGS) of food-borne pathogens for public health protection EFSA Scientific Colloquium n 20 Use of Whole Genome Sequencing (WGS) of food-borne pathogens for public health protection Parma, Italy, 16-17 June 2014 Why WGS based approach Infectious diseases are responsible

More information

D Candotti. Institut National de la Transfusion Sanguine Dept. Agents Transmissibles par le Sang Paris, France

D Candotti. Institut National de la Transfusion Sanguine Dept. Agents Transmissibles par le Sang Paris, France Molecular characterization of hepatitis B virus strains infecting blood donors with high HBsAg and undetectable HBV DNA levels: implications for blood safety and screening policy D Candotti Institut National

More information

Table S1. Primers used in arbitrary PCR reaction as described by Cao et al. (1).

Table S1. Primers used in arbitrary PCR reaction as described by Cao et al. (1). Table S1. Primers used in arbitrary PCR reaction as described by Cao et al. (1). Primers Sequence (5 to 3 ) Tm ( C) Round I PCR Arbitrary 207 GGCCACGCGTCGACTAGTACNNNNNNNNNNGTAAT 74 Left 255 CAGTACAATCTGCTCTGATGCCGCATAGTT

More information

Antibiotic susceptibility

Antibiotic susceptibility Antibiotic susceptibility Antibiotic: natural chemicals produced by bacteria, fungi, actinomycetes, plants or animals, and either inhibits or kills other microbes and/or cells Chemotherapeutic agent: A

More information

Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes

Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes Identification of the VTEC serogroups mainly associated with human infections by conventional PCR amplification of O-associated genes 1. Aim and field of application The present method concerns the identification

More information

Rational Design of DNA Sequence-Based Strategies for Subtyping Listeria monocytogenes

Rational Design of DNA Sequence-Based Strategies for Subtyping Listeria monocytogenes JOURNAL OF CLINICAL MICROBIOLOGY, Sept. 2002, p. 3319 3325 Vol. 40, No. 9 0095-1137/02/$04.00 0 DOI: 10.1128/JCM.40.9.3319 3325.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved.

More information

19th Swiss TB Symposium Münchenwiler, 25.03.2010

19th Swiss TB Symposium Münchenwiler, 25.03.2010 19 th SWISS TUBERCULOSIS SYMPOSIUM Update on culture and identification Münchenwiler, 25.03.2010 Dr. Thomas Bodmer, M.D. Institute for Infectious Diseases Culture of mycobacteria Cultivation of MTB in

More information

Canadian Public Health Laboratory Network. Core Functions of Canadian Public Health Laboratories

Canadian Public Health Laboratory Network. Core Functions of Canadian Public Health Laboratories Canadian Public Health Laboratory Network Core Functions of Canadian Public Health Laboratories Canadian Public Health Laboratory Network The CPHLN Core Functions of Canadian Public Health Laboratories

More information

107, %, P < 01001

107, %, P < 01001 2002 1 40 1 Chin J Pediatr January 2002 Vol 40 No. 1 45 2 294 1 906 (PCR) (MP) ;307 ;81 (NPS) (RSV) (ADV) 1 906 28 1147 % ;544 107 19167 % P < 01001 A ( GAS) 1816 % 615 % 213 % 210 % 210 % ;34 GAS 26 7615

More information

Cystic Fibrosis Webquest Sarah Follenweider, The English High School 2009 Summer Research Internship Program

Cystic Fibrosis Webquest Sarah Follenweider, The English High School 2009 Summer Research Internship Program Cystic Fibrosis Webquest Sarah Follenweider, The English High School 2009 Summer Research Internship Program Introduction: Cystic fibrosis (CF) is an inherited chronic disease that affects the lungs and

More information

Multi-locus sequence typing (MLST) of C. jejuni infections in the United States Patrick Kwan, PhD

Multi-locus sequence typing (MLST) of C. jejuni infections in the United States Patrick Kwan, PhD Multi-locus sequence typing (MLST) of C. jejuni infections in the United States Patrick Kwan, PhD National Campylobacter and Helicobacter Reference Laboratory Enteric Diseases Laboratory Branch Centers

More information

Identification and Characterization of Foodborne Pathogens by Whole Genome Sequencing: A Shift in Paradigm

Identification and Characterization of Foodborne Pathogens by Whole Genome Sequencing: A Shift in Paradigm Identification and Characterization of Foodborne Pathogens by Whole Genome Sequencing: A Shift in Paradigm Peter Gerner-Smidt, MD, ScD Enteric Diseases Laboratory Branch EFSA Scientific Colloquium N o

More information

Chapter 10 Manipulating Genes

Chapter 10 Manipulating Genes How DNA Molecules Are Analyzed Chapter 10 Manipulating Genes Until the development of recombinant DNA techniques, crucial clues for understanding how cell works remained lock in the genome. Important advances

More information

Core Functions and Capabilities. Laboratory Services

Core Functions and Capabilities. Laboratory Services Core Functions and Capabilities British Columbia Centre for Disease Control Laboratory Services Understanding the role and value of British Columbia s public health laboratory in protecting our community

More information

Biotechnology and Recombinant DNA

Biotechnology and Recombinant DNA Biotechnology and Recombinant DNA Recombinant DNA procedures - an overview Biotechnology: The use of microorganisms, cells, or cell components to make a product. Foods, antibiotics, vitamins, enzymes Recombinant

More information


QUALITY AND SAFETY TESTING QUALITY AND SAFETY TESTING Large scale of solutions for the identification and rapid detection of micro-organisms. Easier investment in molecular techniques Frédéric BAR, Key Account Manager b2 b3b4 Quality

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Genetic engineering: humans Gene replacement therapy or gene therapy Many technical and ethical issues implications for gene pool for germ-line gene therapy what traits constitute disease rather than just

More information



More information

TURIN. Historical capital of Italy. City of Art, Nature, Food and Sport. Turin is crossed by the Po river, the Italy s longest river

TURIN. Historical capital of Italy. City of Art, Nature, Food and Sport. Turin is crossed by the Po river, the Italy s longest river TURIN Historical capital of Italy City of Art, Nature, Food and Sport Turin is crossed by the Po river, the Italy s longest river The Mole Antonelliana (1863-1889), 167.5 Meters tall is the symbol of the

More information


TUBERCULOSIS COURSE. Academic Year TUBERCULOSIS COURSE Academic Year 2015-2016 PROGRAMME OF THE TUBERCULOSIS COURSE 2015-2016 May 23 to June 3, 2016! The Course on Tuberculosis will be at The Institut Pasteur Pavillon Louis Martin (Building

More information

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot

11/19/2008. Gene analysis. Sequencing PCR. Northern-blot RT PCR. Western-blot Sequencing. in situ hybridization. Southern-blot Recombinant technology Gene analysis Sequencing PCR RNA Northern-blot RT PCR Protein Western-blot Sequencing Southern-blot in situ hybridization in situ hybridization Function analysis Histochemical analysis

More information

Targeted Therapy What the Surgeon Needs to Know

Targeted Therapy What the Surgeon Needs to Know Targeted Therapy What the Surgeon Needs to Know AATS Focus in Thoracic Surgery 2014 David R. Jones, M.D. Professor & Chief, Thoracic Surgery Memorial Sloan Kettering Cancer Center I have no disclosures

More information

Molecular typing of VTEC: from PFGE to NGS-based phylogeny

Molecular typing of VTEC: from PFGE to NGS-based phylogeny Molecular typing of VTEC: from PFGE to NGS-based phylogeny Valeria Michelacci 10th Annual Workshop of the National Reference Laboratories for E. coli in the EU Rome, November 5 th 2015 Molecular typing

More information


GLYKOPEPTID- RESISTENS HOS ENTEROKOKKER GLYKOPEPTID- RESISTENS HOS ENTEROKOKKER KRISTIN HEGSTAD Wirth 1994 Eur J Biochem 222:235-46 ENTEROCOCCI (1) Gram+, normal inhabitants of the gastrointestinal tract (GIT) Arias 2012 Nat Rev Microbiol 16:266-78

More information

Chikungunya: An emerging outbreak from East Africa to Indian Ocean, 2004-2007

Chikungunya: An emerging outbreak from East Africa to Indian Ocean, 2004-2007 Chikungunya: An emerging outbreak from East Africa to Indian Ocean, 2004-2007 A. Flahault, G. Aumont, V Boisson, X de Lamballerie, F. Favier, B.A. Gaüzère, D. Fontenille, S. Journeaux, V. Lotteau, C. Paupy,

More information

E. coli in Sweden from

E. coli in Sweden from A comprehensive study on ESBLproducing E coli in Sweden from food producing animals, food, and humans Sara Byfors Public Health Agency of Sweden Unit for Parasitology, Food- and waterborne diseases Project

More information

General Services Administration Federal Supply Service Authorized Federal Supply Schedule Price List

General Services Administration Federal Supply Service Authorized Federal Supply Schedule Price List General Services Administration Federal Supply Service Authorized Federal Supply Schedule Price List GSA Schedule 66 Scientific Equipment and Services SIN 66-1000 Professional Scientific Services IHRC,

More information

Gene mutation and molecular medicine Chapter 15

Gene mutation and molecular medicine Chapter 15 Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to

More information


FACULTY OF MEDICAL SCIENCE Doctor of Philosophy Program in Microbiology FACULTY OF MEDICAL SCIENCE Naresuan University 171 Doctor of Philosophy Program in Microbiology The time is critical now for graduate education and research

More information

2013-Annual Report. Name of the Structure: Integrated Mycobacterial Pathogenomics Unit

2013-Annual Report. Name of the Structure: Integrated Mycobacterial Pathogenomics Unit 2013-Annual Report Head of the structure: Dr. Roland BROSCH, Name of the Structure: Integrated Mycobacterial Pathogenomics Unit Secondary Affiliation: Name of the Institut Pasteur

More information

Innovations in Molecular Epidemiology

Innovations in Molecular Epidemiology Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether

More information


PRIORITY RESEARCH TOPICS PRIORITY RESEARCH TOPICS Understanding all the issues associated with antimicrobial resistance is probably impossible, but it is clear that there are a number of key issues about which we need more information.

More information

Le métier d'infectiologue en Europe. Bruno Hoen Université de Franche Comté CHU de Besançon EGI 14 janvier 2011

Le métier d'infectiologue en Europe. Bruno Hoen Université de Franche Comté CHU de Besançon EGI 14 janvier 2011 Le métier d'infectiologue en Europe Bruno Hoen Université de Franche Comté CHU de Besançon EGI 14 janvier 2011 Une définition européenne de l'infectiologie? Les infectiologues en Europe? Pas dans tous

More information

Department of Biology Sample

Department of Biology Sample Syllabus BIOTECHNOLOGY Spring 2013 Instructor: Atanu Duttaroy, Professor Tel: 202-806-5362 Email: Office: Room 336, Just Hall Teaching Assistant: Mr. Subhas Mukherjee Lecture: Room

More information

Custom Antibody Services

Custom Antibody Services Custom Antibody Services High Performance Antibodies and More Broad Antibody Catalog Extensive Antibody Services CUSTOM ANTIBODY SERVICES Established in 1998, ProSci Incorporated is a leading

More information

Biology 2230 Microbiology Lecture Learning Objectives and Assessment Measures

Biology 2230 Microbiology Lecture Learning Objectives and Assessment Measures Biology 2230 Microbiology Lecture Learning Objectives and Assessment Measures A student who successfully completes the Lecture component of Biology 2230 (Microbiology) will have mastered the learning objectives

More information

Salmonella and Other Pathogens of Importance in Beef Processing

Salmonella and Other Pathogens of Importance in Beef Processing Salmonella and Other Pathogens of Importance in Beef Processing Mindy Brashears, PhD Director-International Center for Food Industry Excellence Department of Animal and Food Sciences Texas Tech University

More information


THE NEW ZEALAND MEDICAL JOURNAL THE NEW ZEALAND MEDICAL JOURNAL Journal of the New Zealand Medical Association Unanswered questions, the epidemiology of a community outbreak: meningococcal C disease in Northland, New Zealand, 2011 Clair

More information

Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action

Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action Les Rencontres de L INRA Metagenomics revisits the one pathogen/one disease postulates and translate the One Health concept into action E Albina (CIRAD) / S Guyomard(Institut Pasteur) Guadeloupe The era

More information

Bactériophages et Mucoviscidose

Bactériophages et Mucoviscidose Bactériophages et Mucoviscidose Laurent DEBARBIEUX Département de Microbiologie Interactions Bactériophages-Bactéries chez l'animal Bacteriophages belong to viruses infecting microbes DNA capside tail

More information

Foot and mouth disease virus (FMDV): the disease and diagnosis

Foot and mouth disease virus (FMDV): the disease and diagnosis Foot and mouth disease virus (FMDV): the disease and diagnosis Peter Nettleton Important characteristics of FMDV Unbelievably tiny- Within one millimetre there are one million

More information

Whole genome sequencing of foodborne pathogens: experiences from the Reference Laboratory. Kathie Grant Gastrointestinal Bacteria Reference Unit

Whole genome sequencing of foodborne pathogens: experiences from the Reference Laboratory. Kathie Grant Gastrointestinal Bacteria Reference Unit Whole genome sequencing of foodborne pathogens: experiences from the Reference Laboratory Kathie Grant Gastrointestinal Bacteria Reference Unit 16 th June 2014 Planning for Implementation of WGS 2011-2014

More information

Raw Milk Quality Tests Do They Predict Fluid Milk Shelf-life or Is it time for new tests?

Raw Milk Quality Tests Do They Predict Fluid Milk Shelf-life or Is it time for new tests? Raw Milk Quality Tests Do They Predict Fluid Milk Shelf-life or Is it time for new tests? Martin Wiedmann Milk Quality Improvement Program November 3, 2011 Fluid milk shelf life What defines shelf life

More information

Culture-Independent Diagnostics Forum: Charting a Path for Public Health

Culture-Independent Diagnostics Forum: Charting a Path for Public Health Culture-Independent Diagnostics Forum: Charting a Path for Public Health The Consumer Perspective Dr. Barbara Kowalcyk April 25, 2012 A Basic Human Right Food is strength, and food is peace and food is

More information

Listeria spp. and Listeria monocytogenes in Foods. Kristi McCallum Rocky Mountain Food Safety Conference May 24 & 25, 2016

Listeria spp. and Listeria monocytogenes in Foods. Kristi McCallum Rocky Mountain Food Safety Conference May 24 & 25, 2016 Listeria spp. and Listeria monocytogenes in Foods Kristi McCallum Rocky Mountain Food Safety Conference May 24 & 25, 2016 Genus Listeria Gram-positive, non-spore forming bacilli Demonstrate a tumbling

More information

Sur les traces du Campylobacter au Luxembourg

Sur les traces du Campylobacter au Luxembourg Environmental sources of Campylobacter infections in Luxembourg Priorité Nationale C09/BM/09 Sur les traces du Campylobacter au Luxembourg Catherine Ragimbeau What sort of germ is Campylobacter? A fragile

More information

Rapid tests for MRSA detection at the hospital admission

Rapid tests for MRSA detection at the hospital admission Rapid tests for MRSA detection at the hospital admission Olivier Denis Reference Laboratory for Staphylococci and MRSA ULB-Hôpital Erasme SYMPOSIUM 12th vember 2009 Prevention strategies for MRSA control

More information

The Need for a PARP in vivo Pharmacodynamic Assay

The Need for a PARP in vivo Pharmacodynamic Assay The Need for a PARP in vivo Pharmacodynamic Assay Jay George, Ph.D., Chief Scientific Officer, Trevigen, Inc., Gaithersburg, MD For further infomation, please contact: William Booth, Ph.D. Tel: +44 (0)1235

More information

Course Descriptions. I. Professional Courses: MSEG 7216: Introduction to Infectious Diseases (Medical Students)

Course Descriptions. I. Professional Courses: MSEG 7216: Introduction to Infectious Diseases (Medical Students) Course Descriptions I. Professional Courses: MSEG 7216: Introduction to Infectious Diseases (Medical Students) This course is offered during the first semester of the second year of the MD Program. It

More information

Hepatitis C Vaccines: Are we making progress?

Hepatitis C Vaccines: Are we making progress? Hepatitis C Vaccines: Are we making progress? Second International Hepatitis Cure and Eradication Meeting. Vancouver November, 2015 Objectives: Review the need for a preventive vaccine in 2015. Identify

More information

P Colson1,2,3, F Gouriet1,2,3, S Badiaga2,4, C Tamalet1,2, A Stein2,5, D Raoult1,2 (

P Colson1,2,3, F Gouriet1,2,3, S Badiaga2,4, C Tamalet1,2, A Stein2,5, D Raoult1,2 ( Rapid communication Real-time laboratory surveillance of sexually-transmissible infections in Marseille University hospitals reveals rise of gonorrhoea, syphilis and human immunodeficiency virus seroconversions

More information

A.H. Sabra 2 R. Abi-Rached 2 M.M. Kattar 2 M-Th. Khairallah 1 G. F. Araj 2 G.M. Matar 1

A.H. Sabra 2 R. Abi-Rached 2 M.M. Kattar 2 M-Th. Khairallah 1 G. F. Araj 2 G.M. Matar 1 Expression Levels of Four pil Genes Encoding Type 4 Fimbrial Biogenesis Proteins in Pseudomonas aeruginosa Strains Prevalent in Nosocomial Infections at a Tertiary Care Center A.H. Sabra 2 R. Abi-Rached

More information

National Antimicrobial Resistance Monitoring System - Enteric Bacteria. A program to monitor antimicrobial resistance in humans and animals

National Antimicrobial Resistance Monitoring System - Enteric Bacteria. A program to monitor antimicrobial resistance in humans and animals National Antimicrobial Resistance Monitoring System - Enteric Bacteria A program to monitor antimicrobial resistance in humans and animals Antimicrobial resistance in foodborne pathogens is an important

More information

Course- Based Research Grant Proposal - Best

Course- Based Research Grant Proposal - Best Abstract The course proposed is a full redesign of an existing general microbiology laboratory for undergraduate biology majors, the laboratory component of BIOL 301 General Microbiology. Typically, junior

More information

Plasmid Isolation. Prepared by Latifa Aljebali Office: Building 5, 3 rd floor, 5T250

Plasmid Isolation. Prepared by Latifa Aljebali Office: Building 5, 3 rd floor, 5T250 Plasmid Isolation Prepared by Latifa Aljebali Office: Building 5, 3 rd floor, 5T250 Plasmid Plasmids are small, double strand, closed circular DNA molecules. Isolated from bacterial cells. Replicate independently

More information

Biotechnology: DNA Technology & Genomics

Biotechnology: DNA Technology & Genomics Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What

More information

SARS SARS. Phone : ; Fax :

SARS SARS. Phone : ; Fax : A number of viruses isolated from bats have been believed to be causative agents of the emerging infectious diseases in humans. This idea is supported by the facts that SARS coronavirus (SARS-CoV)-like

More information

Guidelines for Animal Disease Control

Guidelines for Animal Disease Control Guidelines for Animal Disease Control 1. Introduction and objectives The guidelines are intended to help countries identify priorities, objectives and the desired goal of disease control programmes. Disease

More information

7.013 Spring 2005 Problem Set 7 FRIDAY May 6th, 2005

7.013 Spring 2005 Problem Set 7 FRIDAY May 6th, 2005 MI Department of Biology 7.013: Introductory Biology - Spring 2005 Instructors: Professor Hazel Sive, Professor yler Jacks, Dr. Claudette Gardel Question 1 7.013 Spring 2005 Problem Set 7 RIDAY May 6th,

More information

Introduction. Introduction. Why do we need microbiological diagnostics of udder infections? Microbiological diagnostics How is it done?

Introduction. Introduction. Why do we need microbiological diagnostics of udder infections? Microbiological diagnostics How is it done? Introduction Microbiological diagnostics of udder infections Karin Persson Waller National Veterinary Institute (SVA) Swedish University of Agricultural Sciences Uppsala, Sweden Mastitis = in most cases

More information

Originally published as:

Originally published as: Originally published as: Weiss, B., Rabsch, W., Prager, R., Tietze, E., Koch, J., Mutschmann, F., Roggentin, P., Frank, C. Babies and bearded dragons: Sudden increase in reptile-associated Salmonella enterica

More information

Nasal Antiseptic Swabs

Nasal Antiseptic Swabs Nasal Antiseptic Swabs Decolonize the nose without the risk and complexity of antibiotics* Shown to safely and efficiently reduce S. aureus. Can be used as part of a bundled intervention for patient decolonization.

More information

Mycobacterium bovis infection in a young Dutch adult: transmission from an elderly human source?

Mycobacterium bovis infection in a young Dutch adult: transmission from an elderly human source? 3B Mycobacterium bovis infection in a young Dutch adult: transmission from an elderly human source? OW Akkerman K van der Loo D Nijmeijer T van der Werf B Mulder K Kremer D van Soolingen AGM van der Zanden

More information

American Society of Cytopathology Core Curriculum in Molecular Biology

American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology American Society of Cytopathology Core Curriculum in Molecular Biology Chapter 5 Applications of Molecular Testing Hybrid Capture

More information

How molecular biology is changing the diagnosis of respiratory infections in critically ill patients

How molecular biology is changing the diagnosis of respiratory infections in critically ill patients How molecular biology is changing the diagnosis of respiratory infections in critically ill patients Ricardo Serrano PhD. MD Department of Intensive Care Medicine General University Hospital of Alicante

More information

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes.

Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology (genetic engineering) involves combining genes from different sources into new cells that can express the genes. Recombinant DNA technology has had-and will havemany important

More information

The role of IBV proteins in protection: cellular immune responses. COST meeting WG2 + WG3 Budapest, Hungary, 2015

The role of IBV proteins in protection: cellular immune responses. COST meeting WG2 + WG3 Budapest, Hungary, 2015 The role of IBV proteins in protection: cellular immune responses COST meeting WG2 + WG3 Budapest, Hungary, 2015 1 Presentation include: Laboratory results Literature summary Role of T cells in response

More information

WHO Regional Office for Europe update on avian influenza A (H7N9) virus

WHO Regional Office for Europe update on avian influenza A (H7N9) virus WHO Regional Office for Europe update on avian influenza A (H7N9) virus Situation update 2: 30 April 2013 Address requests about publications of the WHO Regional Office for Europe to: Publications WHO

More information

Today-applications: Medicine-better health Pharmaceutical-production of antibiotics Foods-wine, cheese, beer Agriculture-selective breeding

Today-applications: Medicine-better health Pharmaceutical-production of antibiotics Foods-wine, cheese, beer Agriculture-selective breeding I. Genetic Engineering modification of DNA of organisms to produce new genes with new characteristics -genes are small compared to chromosomes -need methods to get gene-sized pieces of DNA -direct manipulation

More information

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA

DNA Fingerprinting. Unless they are identical twins, individuals have unique DNA DNA Fingerprinting Unless they are identical twins, individuals have unique DNA DNA fingerprinting The name used for the unambiguous identifying technique that takes advantage of differences in DNA sequence

More information

Principles of Disease and Epidemiology. Copyright 2010 Pearson Education, Inc.

Principles of Disease and Epidemiology. Copyright 2010 Pearson Education, Inc. Principles of Disease and Epidemiology Pathology, Infection, and Disease Disease: An abnormal state in which the body is not functioning normally Pathology: The study of disease Etiology: The study of

More information

The CVN Development Programme a 4-month update

The CVN Development Programme a 4-month update The CVN Development Programme a 4-month update Peter Simmonds Centre for Infectious Diseases University of Edinburgh Edinburgh CVN Development Programme Initiative announced in 2009 to focus development

More information

What is Cancer? Cancer is a genetic disease: Cancer typically involves a change in gene expression/function:

What is Cancer? Cancer is a genetic disease: Cancer typically involves a change in gene expression/function: Cancer is a genetic disease: Inherited cancer Sporadic cancer What is Cancer? Cancer typically involves a change in gene expression/function: Qualitative change Quantitative change Any cancer causing genetic

More information

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company

Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Chapter 8: Recombinant DNA 2002 by W. H. Freeman and Company Biotechnology and reporter genes Here, a lentivirus is used to carry foreign DNA into chickens. A reporter gene (GFP)indicates that foreign DNA has been successfully transferred. Recombinant DNA continued

More information

CCR Biology - Chapter 9 Practice Test - Summer 2012

CCR Biology - Chapter 9 Practice Test - Summer 2012 Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible

More information



More information



More information

USE OF BACTERIOPHAGES AS NOVEL FOOD ADDITIVES. Kathy Walker. FS06 ANR 490/811 Food Regulation in the United States. Michigan State University

USE OF BACTERIOPHAGES AS NOVEL FOOD ADDITIVES. Kathy Walker. FS06 ANR 490/811 Food Regulation in the United States. Michigan State University USE OF BACTERIOPHAGES AS NOVEL FOOD ADDITIVES Kathy Walker FS06 ANR 490/811 Food Regulation in the United States Michigan State University October 29, 2006 USE OF BACTERIOPHAGES AS NOVEL FOOD ADDITIVES

More information

CONTENT. Chapter 1 Review of Literature. List of figures. List of tables

CONTENT. Chapter 1 Review of Literature. List of figures. List of tables Abstract Abbreviations List of figures CONTENT I-VI VII-VIII IX-XII List of tables XIII Chapter 1 Review of Literature 1. Vaccination against intracellular pathogens 1-34 1.1 Role of different immune responses

More information

Pacemaker and ICD infections

Pacemaker and ICD infections BVIKM 2007 Pacemaker and ICD infections Recent insights BJ Rijnders, MD, PhD Internal Medicine Section Infectious Dis. Erasmus MC Rotterdam The Netherlands Clinical presentation

More information

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology

More information

excerpted from Reducing Pandemic Risk, Promoting Global Health For the full report go to

excerpted from Reducing Pandemic Risk, Promoting Global Health For the full report go to excerpted from Reducing Pandemic Risk, Promoting Global Health For the full report go to FUTURE DIRECTIONS Historically, attempts to control deadly viruses, such as SARS and

More information

7- Master s Degree in Public Health and Public Health Sciences (Majoring Microbiology)

7- Master s Degree in Public Health and Public Health Sciences (Majoring Microbiology) 7- Master s Degree in Public Health and Public Health Sciences (Majoring Microbiology) Students should fulfill a total of 38 credit hours: 1- Basic requirements: 10 credit hours. 150701, 150702, 150703,

More information

Epi procolon The Blood Test for Colorectal Cancer Screening

Epi procolon The Blood Test for Colorectal Cancer Screening Epi procolon The Blood Test for Colorectal Cancer Screening Epi procolon is an approved blood test for colorectal cancer screening. The US Preventive Services Task Force, the American Cancer Society and

More information

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites.

The correct answer is c B. Answer b is incorrect. Type II enzymes recognize and cut a specific site, not at random sites. 1. A recombinant DNA molecules is one that is a. produced through the process of crossing over that occurs in meiosis b. constructed from DNA from different sources c. constructed from novel combinations

More information

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs)

Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Lecture 6: Single nucleotide polymorphisms (SNPs) and Restriction Fragment Length Polymorphisms (RFLPs) Single nucleotide polymorphisms or SNPs (pronounced "snips") are DNA sequence variations that occur

More information

Big Data for Population Health and Personalised Medicine through EMR Linkages

Big Data for Population Health and Personalised Medicine through EMR Linkages Big Data for Population Health and Personalised Medicine through EMR Linkages Zheng-Ming CHEN Professor of Epidemiology Nuffield Dept. of Population Health, University of Oxford Big Data for Health Policy

More information

Cytomegalovirus in the immunocompent: Prevent, Treat, or Ignore?

Cytomegalovirus in the immunocompent: Prevent, Treat, or Ignore? Cytomegalovirus in the immunocompent: Prevent, Treat, or Ignore? Gordon D. Rubenfeld, MD MSc Professor of Medicine, University of Toronto Chief, Program in Trauma, Emergency, and Critical Care Sunnybrook

More information

Metagenomics: : DNA Sequencing of Environmental Samples

Metagenomics: : DNA Sequencing of Environmental Samples Metagenomics: : DNA Sequencing of Environmental Samples Susannah Green Tringe and Edward M. Rubin Department of Energy Joint Genome Institute What is Metagenomics? Metagenomics is the study of genomes

More information



More information



More information

Recombinant allergens provide new opportunities. The diagnostic tools of tomorrow are already here

Recombinant allergens provide new opportunities. The diagnostic tools of tomorrow are already here Recombinant allergens provide new opportunities The diagnostic tools of tomorrow are already here Recombinant allergens provide new opportunities The diagnostic tools of tomorrow are already here Today

More information