The Ins and Outs of DNA Transfer in Thermus thermophilus
|
|
- Timothy Hamilton
- 8 years ago
- Views:
Transcription
1 Zur Anzeige wird der QuickTime Dekompressor benötigt. Campus Riedberg, Biocenter Molecular Microbiology & Bioenergetics The Ins and Outs of DNA Transfer in Thermus thermophilus Beate Averhoff Institute of Molecular Biosciences Goethe University Frankfurt Germany
2 Fractions of candidate interdomain horizontal gene transfer Archaea: Archaeoglobus fulgidus Methanococcus janaschii Thermoplasma acidophilum Halobacterium sp. 5.8 % 11.1 % 8.8 % 15.6 % Bacteria: Aquifex aeolicus Thermotoga maritima Escherichia coli Bacillus subtilis Haemophilus influenzae Mycoplasma pneumoniae Chlamydophyla pneumoniae Rickettsia prowazekii 8.5 % 14.0 % 0.4 % 0.1 % 3.0 % 3.6 % 2.4 % 0.9 % Koonin et al. (Annu. Rev. Microbiol. 2001) Protein coding sequence (Mbps)
3 Transformable Bacteria Photolithotrophic bacteria Anacystis nidulans Chlorobium limicola Synechocystis sp. strain 6803 Chemolithotrophic bacteria Thiobacillus thioparus Thiobacillus sp. strain Y Heterotrophic bacteria Acinetobacter sp. BD413 Bacillus subtilis Pseudomonas stutzeri Streptomyces spp. Methylotrophic bacteria Methylobacterium organophilum Clinical isolates Haemophilus influenzae Helicobacter pylori Neisseria gonorrhoeae Neisseria meningitidis Streptococcus pneumoniae Phytopathogens Ralstonia solanacearum Thermophilic bacteria Thermus thermophilus HB27 Thermus flavus Thermus caldophilus Thermus aquaticus
4 Naturally transformable model strain Thermus thermophilus HB27 Thermus thermophilus HB27 thermophilic (45-80 C) aerob, heterotroph gram-negative highly transformable Henne et al., Nature Biotechnol. (2004)
5 Zur Anzeige wird der QuickTime Dekompressor benötigt. Kinetics of the DNA transporter
6 uptake system ds DNA chromosome chromosome chromosome non-competent cell competent cell DNA binding acid soluble nucleotides ss DNA chromosome chromosome DNA uptake DNA integration or plasmid reconstitution Steps in natural transformation
7 DNA binding and uptake T. thermophilus cell suspension P 32 -labeled DNA cells +DNA silicone oil centrifugation DNA cells with bound and imported DNA cells +DNA silicone oil DNase DNasesensitive DNA cells with DNase-resistant DNA
8 v [µg DNA / mg protein min] /v [µg DNA/mg protein ml ] /v max /K M 1/S [µg DNA/ml] -1 V max = 1.5 µg DNA/mg protein min (40 kb/sec cell) K m = 50 µg DNA/ml DNA [µg / ml] Kinetics of DNA binding and uptake Schwarzenlander et al. (2006) FEBS J. 273,
9 DNA transport velocities T. thermophilus HB27 40 kb x s -1 x cell -1 B. subtilis 8 kb x s -1 x cell -1 H. influenzae 16 kb x s -1 x cell -1 S. pneumoniae 4 kb x s -1 x cell -1 Thermus exhibits a very high DNA transport velocity
10 µg DNA / mg protein time [min] DCCD 50 µm 100 µm 250 µm 500 µm 20 µm TCS DNA uptake by T. thermophilus is energy dependent DCCD, Dicyclohexylcarbodiimid; TCS, Tetrachlorosalicylanilid
11 Zur Anzeige wird der QuickTime Dekompressor benötigt. Function of acquired DNA? Carbon source? Nitrogen source? Phosphor source? Precurser for DNA-Synthesis?
12 Zur Anzeige wird der QuickTime Dekompressor benötigt. Specificity of DNA binding and transport
13 Transport of different DNA types? accumulation factor linear plasmid circular plasmid chromosomal DNA The DNA translocator does not discriminate between different DNA types
14 accumulation factor binding uptake The DNA translocator of Thermus binds and transports DNA from different domains Donor DNAs: 1, Thermus thermophilus HB27, 2, Acetobacterium woodii, 3, Escherichia coli DH5α, 4, Saccharomyces cerevisiae, 5, Nicotiana tabacum BY2, 6, Methanocaldococus jannaschii, 7, Methanosarcina mazei Gö1, 8, Pyrococcus furiosus, 9, Sulfolobus solfataricus P2. The total amount of accumulated Thermus-DNA (DNase-sensitive + DNAse-resistant) was set to 1. Schwarzenlander and Averhoff (2008), submitted
15 Zur Anzeige wird der QuickTime Dekompressor benötigt. Subunits of the DNA translocator?
16 Pili pilm piln pilo pilw pilq Pili n.d. n.d. - - Zur Anzeige wird der QuickTime Dekompressor TIFF (LZW) benötigt. comea comec pild pilc Pili n.d. pila1 A2 A3 comz A4 pilf dpra 1kb Organization of the Thermus thermophilus HB27 competence genes Averhoff (2004), J. Bioenerg. Biomembr. 36; Rumszauer et al., (2006), FEBS J. 273, Bettermann et al., in prep.; Rose et al., in prep.
17 SECRETIN outer layer assembly/ disassembly PREPILIN- PEPTIDASE PILINS periplasm inner membrane INNER MEMBRANE TRANSLOCATOR TRAFFIC NTPase ATP ADP + Pi ssdna The competence proteins belong to five distinct protein families
18 Zur Anzeige wird der QuickTime Dekompressor benötigt. Function of the competence proteins? Identification and subcellular localization
19 C CM OM WT PilQ - WT PilQ - WT PilQ - PilQ (82 kd) Subcellular localization of PilQ Rumzsauer et al., FEBS J. 2006
20 Subcellular localization of DNA translocator subunits S-layer outer layer PilA4, PilQ, PilW hydrophilic matrix peptidoglycan inner membrane 40 nm PilA4, PilQ PilF and ComEC PilM, PilN, PilO, PilW, PilC Thin section of Thermus cells in collaboration with W. Haase and W. Kühlbrandt, Max Planck Institut für Biophysik, Frankfurt
21 Zur Anzeige wird der QuickTime Dekompressor benötigt. Function of the competence proteins? Role of single subunits in DNA binding and transport?
22 transport The role of competence proteins in DNA binding and transport accumulation factor binding 0.0 wildtype pilq::kat pila1-3::kat pila4::kat pild::kat comea::kat pilf::kat comec::kat Schwarzenlander and Averhoff (2008), submitted
23 Conclusions 1. PilQ is essential for binding (and transport) of DNA. 2. PilA4 and PilF are important for the transport of DNA through the OM into a DNase-resistant state. 3. PilA1-3 are not essential for transport of DNA into a DNase-resistant state. 4. ComEC is essential for transport of DNA through the inner membrane. Thin section of a T. thermophilus cell
24 dsdna S-layer OM PilQ PilQ SCWPs PilW PilA4 PilW PG CM PilC PilA1-3 ssdna ComEC (channel protein) ComEA (putative DNA binding protein) PilN PilO PilM PilF (AAA + -ATPase) PilD (prepilin peptidase) Model of DNA transport in Thermus thermophilus Topologies, conserved motifs and cellular localization of DNA translocator proteins
25 Alexandra Friedrich Judit Rumszauer Cornelia Schwarzenlander Katrin Bettermann Janin Burghardt Ilona Rose Katharina Baatz Collaborations: J. Berenguer, Madrid W. Egge-Jacobsen, Oslo G. Grüber, Singapur W. Haase and W. Kühlbrandt, Frankfurt M. Karas, Frankfurt V. Müller, Frankfurt Funding: DFG CMP (Center of Membrane Proteomics)
Milestones of bacterial genetic research:
Milestones of bacterial genetic research: 1944 Avery's pneumococcal transformation experiment shows that DNA is the hereditary material 1946 Lederberg & Tatum describes bacterial conjugation using biochemical
More informationTransmission of genetic variation: conjugation. Transmission of genetic variation: conjugation
Transmission of genetic variation: conjugation Transmission of genetic variation: conjugation Bacterial Conjugation is genetic recombination in which there is a transfer of DNA from a living donor bacterium
More informationStatistical modeling of non-coding DNA
Statistical modeling of non-coding DNA 25/06/03 Infmeeting, Genova 23-25 June 2003 Overview Investigation of Inverted Repeats (IRs) in complete genomes of bacteria; IReD a web server of Inverted Repeats
More informationDNA UPTAKE DURING BACTERIAL TRANSFORMATION
DNA UPTAKE DURING BACTERIAL TRANSFORMATION Inês Chen and David Dubnau Naturally competent bacteria are able to take up exogenous DNA and undergo genetic transformation. The transport of DNA from the extracellular
More informationFigure 1: Genome sizes of different organisms.
How big are genomes? Genomes are now being sequenced at such a rapid rate that it is fair to say that it is becoming routine. As a result, there is a growing interest in trying to understand the meaning
More informationRestriction Endonucleases
Nucleic Acids and Molecular Biology 14 Restriction Endonucleases Bearbeitet von Alfred Pingoud 1. Auflage 2004. Buch. xxvi, 443 S. Hardcover ISBN 978 3 540 20502 9 Format (B x L): 15,5 x 23,5 cm Gewicht:
More informationEcologic Genomics of DNA: Upstream Bending in Prokaryotic Promoters
Letter Ecologic Genomics of DNA: Upstream Bending in Prokaryotic Promoters Alexander Bolshoy 1,2 and Eviatar Nevo 1 1 Institute of Evolution, University of Haifa, Haifa, 31905 Israel After our analysis
More informationCongruent evolution of different classes of non-coding DNA in prokaryotic genomes
4264±4271 Nucleic Acids Research, 2002, Vol. 30 No. 19 Congruent evolution of different classes of non-coding DNA in prokaryotic genomes Igor B. Rogozin, Kira S. Makarova, Darren A. Natale, Alexey N. Spiridonov,
More informationInferred thermophily of the last universal ancestor based on estimated
1 Inferred thermophily of the last universal ancestor based on estimated amino acid composition Dawn J. Brooks and Eric A. Gaucher Address: Foundation for Applied Molecular Evolution, Gainesville, Florida
More informationThe general structure of bacteria
The general structure of bacteria The uni-cellular organisms Viruses Herpes virus, HIV, influenza virus The procaryotic organisms Escherichia, Salmonella, Pseudomonas Streptococcus, Staphylococcus, Neisseria
More information*Corresponding author: Yoshitaka Nishiyama, E-mail: nishiyama@molbiol.saitama-u.ac.jp
SUPPLEMENTAL DATA Elongation Factor G Is a Critical Target during Oxidative Damage to the Translation System of Escherichia coli Takanori Nagano 1, Kouji Kojima 1,7, Toru Hisabori 2, Hidenori Hayashi 3,
More informationAdapted from Biology 15 Laboratory Supplemental Manual: Wrightsman, Ininns and Cannon- Moloznic.
Biology 3B Laboratory Cultural Characteristics of Bacteria Objectives: Describe bacterial structure: colony morphology, cell shape, growth patterns. To distinguish how various growth media will affect
More informationExpression and Purification of Recombinant Protein in bacteria and Yeast. Presented By: Puspa pandey, Mohit sachdeva & Ming yu
Expression and Purification of Recombinant Protein in bacteria and Yeast Presented By: Puspa pandey, Mohit sachdeva & Ming yu DNA Vectors Molecular carriers which carry fragments of DNA into host cell.
More informationStudent name ID # 2. (4 pts) What is the terminal electron acceptor in respiration? In photosynthesis? O2, NADP+
1. Membrane transport. A. (4 pts) What ion couples primary and secondary active transport in animal cells? What ion serves the same function in plant cells? Na+, H+ 2. (4 pts) What is the terminal electron
More informationModeling and Simulation of Gene Regulatory Networks
Modeling and Simulation of Gene Regulatory Networks Hidde de Jong INRIA Grenoble - Rhône-Alpes Hidde.de-Jong@inria.fr http://ibis.inrialpes.fr INRIA Grenoble - Rhône-Alpes and IBIS IBIS: systems biology
More informationrestriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
More informationOxidative Phosphorylation
Oxidative Phosphorylation NADH from Glycolysis must be transported into the mitochondrion to be oxidized by the respiratory electron transport chain. Only the electrons from NADH are transported, these
More information1. The diagram below represents a biological process
1. The diagram below represents a biological process 5. The chart below indicates the elements contained in four different molecules and the number of atoms of each element in those molecules. Which set
More informationCloning and Expression of Recombinant Proteins
Cloning and Expression of Recombinant Proteins Dr. Günther Woehlke Dept. Physics E22 (Biophysics) Technical University Munich James-Franck-Str. D-85748 Garching Germany guenther.woehlke@mytum.de 1 Created
More informationGenetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
More informationReadyPrep Protein Extraction Kit (Soluble/Insoluble) Instruction Manual. Catalog #163-2085
ReadyPrep Protein Extraction Kit (Soluble/Insoluble) Instruction Manual Catalog #163-2085 For technical service, call your local Bio-Rad office, or in the US, call 1-800-4BIORAD (1-800-424-6723) Table
More informationCHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the
More informationLab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity
Lab 10: Bacterial Transformation, part 2, DNA plasmid preps, Determining DNA Concentration and Purity Today you analyze the results of your bacterial transformation from last week and determine the efficiency
More information* Is chemical energy potential or kinetic energy? The position of what is storing energy?
Biology 1406 Exam 2 - Metabolism Chs. 5, 6 and 7 energy - capacity to do work 5.10 kinetic energy - energy of motion : light, electrical, thermal, mechanical potential energy - energy of position or stored
More information2007 7.013 Problem Set 1 KEY
2007 7.013 Problem Set 1 KEY Due before 5 PM on FRIDAY, February 16, 2007. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Where in a eukaryotic cell do you
More informationEffects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual
Effects of Antibiotics on Bacterial Growth and Protein Synthesis: Student Laboratory Manual I. Purpose...1 II. Introduction...1 III. Inhibition of Bacterial Growth Protocol...2 IV. Inhibition of in vitro
More informationChapter 9 Cellular Respiration
Chapter 9 Cellular Respiration Electrons carried in NADH Mitochondrion Glucose Glycolysis Pyruvic acid Krebs Cycle Electrons carried in NADH and FADH 2 Electron Transport Chain Cytoplasm Mitochondrion
More informationUnit 5 Photosynthesis and Cellular Respiration
Unit 5 Photosynthesis and Cellular Respiration Advanced Concepts What is the abbreviated name of this molecule? What is its purpose? What are the three parts of this molecule? Label each part with the
More informationChapter 11: Molecular Structure of DNA and RNA
Chapter 11: Molecular Structure of DNA and RNA Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand the major experiments that led to the discovery of DNA as
More informationViruses. Viral components: Capsid. Chapter 10: Viruses. Viral components: Nucleic Acid. Viral components: Envelope
Viruses Chapter 10: Viruses Lecture Exam #3 Wednesday, November 22 nd (This lecture WILL be on Exam #3) Dr. Amy Rogers Office Hours: MW 9-10 AM Too small to see with a light microscope Visible with electron
More informationGrids & Life Sciences
Grids & Life Sciences Dr Richard Sinnott Technical Director National e-science Centre Deputy Director Technical Bioinformatics Research Centre University of Glasgow 26 th March 2004 Outline What is e-science?
More informationLecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides
Lecture Series 7 From DNA to Protein: Genotype to Phenotype Reading Assignments Read Chapter 7 From DNA to Protein A. Genes and the Synthesis of Polypeptides Genes are made up of DNA and are expressed
More informationRESPIRATION AND FERMENTATION: AEROBIC AND ANAEROBIC OXIDATION OF ORGANIC MOLECULES. Bio 171 Week 6
RESPIRATION AND FERMENTATION: AEROBIC AND ANAEROBIC OXIDATION OF ORGANIC MOLECULES Bio 171 Week 6 Procedure Label test tubes well, including group name 1) Add solutions listed to small test tubes 2) For
More informationViral Infection: Receptors
Viral Infection: Receptors Receptors: Identification of receptors has come from expressing the gene for the receptor in a cell to which a virus does not normally bind -OR- By blocking virus attachment
More informationBME 42-620 Engineering Molecular Cell Biology. Lecture 02: Structural and Functional Organization of
BME 42-620 Engineering Molecular Cell Biology Lecture 02: Structural and Functional Organization of Eukaryotic Cells BME42-620 Lecture 02, September 01, 2011 1 Outline A brief review of the previous lecture
More informationMIBIE Summer School 2014. Molecular diagnostics of UTI & STI by using PCR, DHPLC and NGS
MIBIE Summer School 2014 Molecular diagnostics of UTI & STI by using PCR, DHPLC and NGS Eugen Domann Institute for Medical Microbiology Justus-Liebig University Gießen Human microbiome 14 Superorganism
More informationBIOLOGICAL MEMBRANES: FUNCTIONS, STRUCTURES & TRANSPORT
BIOLOGICAL MEMBRANES: FUNCTIONS, STRUCTURES & TRANSPORT UNIVERSITY OF PNG SCHOOL OF MEDICINE AND HEALTH SCIENCES DISCIPLINE OF BIOCHEMISTRY AND MOLECULAR BIOLOGY BMLS II / B Pharm II / BDS II VJ Temple
More informationBacterial Transformation with Green Fluorescent Protein. Table of Contents Fall 2012
Bacterial Transformation with Green Fluorescent Protein pglo Version Table of Contents Bacterial Transformation Introduction..1 Laboratory Exercise...3 Important Laboratory Practices 3 Protocol...... 4
More informationTranscription in prokaryotes. Elongation and termination
Transcription in prokaryotes Elongation and termination After initiation the σ factor leaves the scene. Core polymerase is conducting the elongation of the chain. The core polymerase contains main nucleotide
More informationEukaryotes have organelles
Energy-transducing Eukaryotes have organelles membrane systems An organelle is a discrete membrane bound cellular structure specialized functions. An organelle is to the cell what an organ is to the body
More informationMetabolism Dr.kareema Amine Al-Khafaji Assistant professor in microbiology, and dermatologist Babylon University, College of Medicine, Department of
Metabolism Dr.kareema Amine Al-Khafaji Assistant professor in microbiology, and dermatologist Babylon University, College of Medicine, Department of Microbiology. Metabolism sum of all chemical processes
More informationPRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY
Name PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY Cell Structure Identify animal, plant, fungal and bacterial cell ultrastructure and know the structures functions. Plant cell Animal cell
More informationThe Nucleus: DNA, Chromatin And Chromosomes
The Nucleus: DNA, Chromatin And Chromosomes Professor Alfred Cuschieri Department of Anatomy, University of Malta. Objectives By the end of this unit the student should be able to: 1. List the major structural
More informationWide range of high-quality enzymes and proteins for molecular biology
Enzymes & Proteins Wide range of high-quality enzymes and proteins for molecular biology ENZYMES & PROTEINS We offer a wide range of high-quality enzymes and proteins for molecular biology including proteases,
More informationThe correct answer is d C. Answer c is incorrect. Reliance on the energy produced by others is a characteristic of heterotrophs.
1. An autotroph is an organism that a. extracts energy from organic sources b. converts energy from sunlight into chemical energy c. relies on the energy produced by other organisms as an energy source
More informationCHAPTER 6 GRIFFITH/HERSHEY/CHASE: DNA IS THE GENETIC MATERIAL IDENTIFICATION OF DNA DNA AND HEREDITY DNA CAN GENETICALLY TRANSFORM CELLS
CHAPTER 6 GRIFFITH/HERSHEY/CHASE: DNA IS THE GENETIC MATERIAL In 1928, Frederick Griffith was able to transform harmless bacteria into virulent pathogens with an extract that Oswald Avery proved, in 1944,
More informationChemotaxonomische Identifikation einzelner Bakterienzellen mit Hilfe der Mikro-Raman- Spektroskopie Online-Monitoring von Bioaerosolen (OMIB)
1. Jenaer Workshop Spektralsensorik 0. September 00 Chemotaxonomische Identifikation einzelner Bakterienzellen mit Hilfe der Mikro-Raman- Spektroskopie Online-Monitoring von Bioaerosolen (OMIB) P. Rösch
More informationUtilization of protein-rich animal waste materials to produce biohydrogen
Utilization of protein-rich animal waste materials to produce biohydrogen Ph.D. Thesis Written by: Balázs Bálint Supervisors: Prof. Kornél L. Kovács Dr. Gábor Rákhely Ph.D. School in Biology Institute
More informationNotch 1 -dependent regulation of cell fate in colorectal cancer
Notch 1 -dependent regulation of cell fate in colorectal cancer Referees: PD Dr. Tobias Dick Prof. Dr. Wilfried Roth http://d-nb.info/1057851272 CONTENTS Summary 1 Zusammenfassung 2 1 INTRODUCTION 3 1.1
More informationName: Hour: Elements & Macromolecules in Organisms
Name: Hour: Elements & Macromolecules in Organisms Most common elements in living things are carbon, hydrogen, nitrogen, and oxygen. These four elements constitute about 95% of your body weight. All compounds
More informationWorking with Molecular Genetics Chapter 4: Genomes and Chromosomes CHAPTER 4 GENOMES AND CHROMOSOMES
CHAPTER 4 GENOMES AND CHROMOSOMES This chapter will cover: Distinct components of genomes Abundance and complexity of mrna Normalized cdna libraries and ESTs Genome sequences: gene numbers Comparative
More informationNontypeable Haemophilus influenzae type IV pili: biological roles of the products encoded by the pil and com operons
JB Accepts, published online ahead of print on 10 February 2012 J. Bacteriol. doi:10.1128/jb.06540-11 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Nontypeable Haemophilus
More informationProtein Expression. A Practical Approach J. HIGGIN S
Protein Expression A Practical Approach S. J. HIGGIN S B. D. HAMES List of contributors Abbreviations xv Xvi i 1. Protein expression in mammalian cell s Marlies Otter-Nilsson and Tommy Nilsso n 1. Introduction
More informationGenetic Technology. Name: Class: Date: Multiple Choice Identify the choice that best completes the statement or answers the question.
Name: Class: Date: Genetic Technology Multiple Choice Identify the choice that best completes the statement or answers the question. 1. An application of using DNA technology to help environmental scientists
More informationModule 10: Bioinformatics
Module 10: Bioinformatics 1.) Goal: To understand the general approaches for basic in silico (computer) analysis of DNA- and protein sequences. We are going to discuss sequence formatting required prior
More informationStructure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
More informationMicrobial Nutrition And bacterial Classification Microbiology Unit-I. Muhammad Iqbal Lecturer KMU
Microbial Nutrition And bacterial Classification Microbiology Unit-I Muhammad Iqbal Lecturer KMU Objectives At the end of this lecture the students will be able to: Define key terms. Identify the basic
More informationBacReady TM Multiplex PCR System
BacReady TM Multiplex PCR System Technical Manual No. 0191 Version 10112010 I Description.. 1 II Applications 2 III Key Features.. 2 IV Shipping and Storage. 2 V Simplified Procedures. 2 VI Detailed Experimental
More information2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
More informationTwincore - Zentrum für Experimentelle und Klinische Infektionsforschung Institut für Molekulare Bakteriologie
Twincore - Zentrum für Experimentelle und Klinische Infektionsforschung Institut für Molekulare Bakteriologie 0 HELMHOLTZ I ZENTRUM FÜR INFEKTIONSFORSCHUNG Technische Universität Braunschweig Institut
More informationFirst Strand cdna Synthesis
380PR 01 G-Biosciences 1-800-628-7730 1-314-991-6034 technical@gbiosciences.com A Geno Technology, Inc. (USA) brand name First Strand cdna Synthesis (Cat. # 786 812) think proteins! think G-Biosciences
More informationMake your own bacteria!
Make your own bacteria! Bacteria: a single-celled microorganism with no membrane-bound nucleus. Bacteria are found everywhere from soil to acidic hot springs. You can make your own bacteria to take home
More informationTopic 2: Energy in Biological Systems
Topic 2: Energy in Biological Systems Outline: Types of energy inside cells Heat & Free Energy Energy and Equilibrium An Introduction to Entropy Types of energy in cells and the cost to build the parts
More informationPhotosynthesis and Cellular Respiration. Stored Energy
Photosynthesis and Cellular Respiration Stored Energy What is Photosynthesis? plants convert the energy of sunlight into the energy in the chemical bonds of carbohydrates sugars and starches. SUMMARY EQUATION:
More informationMicroarray analysis of viral infections
Microarray analysis of viral infections Dipl. Biol. Department of Virology Bernhard Nocht Institute for Tropical Medicine Berhard Nocht Institut für Tropenmedizin Possible investigations of viral infections
More informationTitle: Surveying Genome to Identify Origins of DNA Replication In Silico
Title: Surveying Genome to Identify Origins of DNA Replication In Silico Abstract: DNA replication origins are the bases to realize the process of chromosome replication and analyze the progress of cell
More informationWizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280.
Technical Bulletin Wizard DNA Clean-Up System INSTRUCTIONS FOR USE OF PRODUCT A7280. PRINTED IN USA. Revised 4/06 AF9TB141 0406TB141 Wizard DNA Clean-Up System All technical literature is available on
More informationChapter 3. Protein Structure and Function
Chapter 3 Protein Structure and Function Broad functional classes So Proteins have structure and function... Fine! -Why do we care to know more???? Understanding functional architechture gives us POWER
More informationVLLM0421c Medical Microbiology I, practical sessions. Protocol to topic J10
Topic J10+11: Molecular-biological methods + Clinical virology I (hepatitis A, B & C, HIV) To study: PCR, ELISA, your own notes from serology reactions Task J10/1: DNA isolation of the etiological agent
More information4. Why are common names not good to use when classifying organisms? Give an example.
1. Define taxonomy. Classification of organisms 2. Who was first to classify organisms? Aristotle 3. Explain Aristotle s taxonomy of organisms. Patterns of nature: looked like 4. Why are common names not
More informationIsolation and Purification of Total Genomic DNA from Gram-Negative Bacteria
Isolation and Purification of Total Genomic DNA from Gram-Negative Bacteria INTRODUCTION The isolation and purification of DNA from cells is one of the most common procedures in contemporary molecular
More informationGENETIC TRANSFORMATION OF BACTERIA WITH THE GENE FOR GREEN FLUORESCENT PROTEIN (GFP)
GENETIC TRANSFORMATION OF BACTERIA WITH THE GENE FOR GREEN FLUORESCENT PROTEIN (GFP) LAB BAC3 Adapted from "Biotechnology Explorer pglo Bacterial Transformation Kit Instruction Manual". (Catalog No. 166-0003-EDU)
More informationIntroduction to Genome Annotation
Introduction to Genome Annotation AGCGTGGTAGCGCGAGTTTGCGAGCTAGCTAGGCTCCGGATGCGA CCAGCTTTGATAGATGAATATAGTGTGCGCGACTAGCTGTGTGTT GAATATATAGTGTGTCTCTCGATATGTAGTCTGGATCTAGTGTTG GTGTAGATGGAGATCGCGTAGCGTGGTAGCGCGAGTTTGCGAGCT
More informationTIANquick Mini Purification Kit
TIANquick Mini Purification Kit For purification of PCR products, 100 bp to 20 kb www.tiangen.com TIANquick Mini Purification Kit (Spin column) Cat no. DP203 Kit Contents Contents Buffer BL Buffer PB Buffer
More informationCytology. Living organisms are made up of cells. Either PROKARYOTIC or EUKARYOTIC cells.
CYTOLOGY Cytology Living organisms are made up of cells. Either PROKARYOTIC or EUKARYOTIC cells. A. two major cell types B. distinguished by structural organization See table on handout for differences.
More informationInteraktionen von Nukleinsäuren und Proteinen
Sonja Prohaska Computational EvoDevo Universitaet Leipzig June 9, 2015 DNA is never naked in a cell DNA is usually in association with proteins. In all domains of life there are small, basic chromosomal
More informationBiological cell membranes
Unit 14: Cell biology. 14 2 Biological cell membranes The cell surface membrane surrounds the cell and acts as a barrier between the cell s contents and the environment. The cell membrane has multiple
More informationThe Cell: Organelle Diagrams
The Cell: Organelle Diagrams Fig 7-4. A prokaryotic cell. Lacking a true nucleus and the other membrane-enclosed organelles of the eukaryotic cell, the prokaryotic cell is much simpler in structure. Only
More informationHow To Understand The Chemistry Of Organic Molecules
CHAPTER 3 THE CHEMISTRY OF ORGANIC MOLECULES 3.1 Organic Molecules The chemistry of carbon accounts for the diversity of organic molecules found in living things. Carbon has six electrons, four of which
More informationSpecific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons
Tutorial II Gene expression: mrna translation and protein synthesis Piergiorgio Percipalle, PhD Program Control of gene transcription and RNA processing mrna translation and protein synthesis KAROLINSKA
More informationBY2012 Microbiology Bacterial Fimbriae & Adherence
BY2012 Microbiology Bacterial Fimbriae & Adherence Bacterial Fimbriae Fimbriae Flagella Colourised electron micrograph of an Escherichia coli cell bearing type 1 fimbriae Escherichia coli with Type 1 Fimbriae
More information1. When you come to a station, attempt to answer each question for that station.
Name: Block: Steps for completing this study guide 1. When you come to a station, attempt to answer each question for that station. 2. Once you are done answering the questions, or if you can t answer
More informationElectron Transport Generates a Proton Gradient Across the Membrane
Electron Transport Generates a Proton Gradient Across the Membrane Each of respiratory enzyme complexes couples the energy released by electron transfer across it to an uptake of protons from water in
More informationAP BIOLOGY 2008 SCORING GUIDELINES (Form B)
AP BIOLOGY 2008 SCORING GUIDELINES (Form B) Question 2 2. Many biological structures are composed of smaller units assembled into more complex structures having functions based on their structural organization.
More informationTranslation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
More informationGymnázium, Brno, Slovanské nám. 7, WORKBOOK - Biology WORKBOOK. http://agb.gymnaslo.cz
WORKBOOK http://agb.gymnaslo.cz Biology Subject: Teacher: Iva Kubištová Student:.. School year:../ This material was prepared with using http://biologygmh.com/ Topics: 1. 2. 3. 4. 5. 6. Viruses and Bacteria
More informationNUTRITION AND GROWTH OF BACTERIA
3 NUTRITION AND GROWTH OF BACTERIA 3.1 INTRODUCTION Bacteria are prokaryotic organisms that do not contain chlorophyll. They are unicellular and do not show true branching. They differ from eukaryotes
More informationChapter 9 Mitochondrial Structure and Function
Chapter 9 Mitochondrial Structure and Function 1 2 3 Structure and function Oxidative phosphorylation and ATP Synthesis Peroxisome Overview 2 Mitochondria have characteristic morphologies despite variable
More informationMicrobial Metabolism. Biochemical diversity
Microbial Metabolism Biochemical diversity Metabolism Define Requirements Energy Enzymes Rate Limiting step Reaction time Types Anabolic Endergonic Dehydration Catabolic Exergonic Hydrolytic Metabolism
More informationTransformation in Streptococcus pneumoniae: formation of eclipse complex in a coia mutant implicates CoiA in genetic recombination
Molecular Microbiology (2007) doi:10.1111/j.1365-2958.2006.05558.x Transformation in Streptococcus pneumoniae: formation of eclipse complex in a coia mutant implicates CoiA in genetic recombination Bhushan
More informationChapter 7 Cellular Respiration
Phases of aerobic cellular respiration 1. Glycolysis 2. Transition or Acetyl-CoA reaction 3. Krebs cycle 4. Electron transport system Chapter 7 Cellular Respiration These phases are nothing more than metabolic
More informationpcas-guide System Validation in Genome Editing
pcas-guide System Validation in Genome Editing Tagging HSP60 with HA tag genome editing The latest tool in genome editing CRISPR/Cas9 allows for specific genome disruption and replacement in a flexible
More informationCarbon Hydrogen Oxygen Nitrogen
Concept 1 - Thinking Practice 1. If the following molecules were to undergo a dehydration synthesis reaction, what molecules would result? Circle the parts of each amino acid that will interact and draw
More informationSupplemental Tables and Figure
A bacterial regulatory RNA attenuates virulence, spread and human host cell phagocytosis. Hélène Le Pabic, Noëlla Germain-Amiot, Valérie Bordeau and Brice Felden* Inserm U835-Upres EA2311, Biochimie Pharmaceutique,
More informationCourse Curriculum for Master Degree in Medical Laboratory Sciences/Clinical Microbiology, Immunology and Serology
Course Curriculum for Master Degree in Medical Laboratory Sciences/Clinical Microbiology, Immunology and Serology The Master Degree in Medical Laboratory Sciences / Clinical Microbiology, Immunology or
More informationBecker Muscular Dystrophy
Muscular Dystrophy A Case Study of Positional Cloning Described by Benjamin Duchenne (1868) X-linked recessive disease causing severe muscular degeneration. 100 % penetrance X d Y affected male Frequency
More informationNonchromosomal Antibiotic Resistance in Bacteria: Genetic Transformation of Escherichia coli by R-Factor DNA* (CaCI2/extrachromosomal DNA/plasmid)
Proc. Nat. Acad. Sci. USA Vol. 69, No. 8, pp. 211-2114, August 1972 Nonchromosomal Antibiotic Resistance in Bacteria: Genetic Transformation of Escherichia coli by R-Factor DNA* (CaCI2/extrachromosomal
More informationLAB 16 Rapid Colony Transformation of E. coli with Plasmid DNA
LAB 16 Rapid Colony Transformation of E. coli with Plasmid DNA Objective: In this laboratory investigation, plasmids containing fragments of foreign DNA will be used to transform Escherichia coli cells,
More informationMolecular Cell Biology
Harvey Lodish Arnold Berk Paul Matsudaira Chris A. Kaiser Monty Krieger Matthew P. Scott Lawrence Zipursky James Darnell Molecular Cell Biology Fifth Edition Chapter 2: Chemical Foundations Copyright 2004
More informationDNA Sequence Analysis
DNA Sequence Analysis Two general kinds of analysis Screen for one of a set of known sequences Determine the sequence even if it is novel Screening for a known sequence usually involves an oligonucleotide
More information