Chapter 17. From Gene to Protein Translation How does mrna code for proteins? What was the coding puzzle? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? How can an alphabet of 4 letters translate into an alphabet of 20 letters? DNA mrna protein TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC Met Arg Val Asn Ala Cys Ala 1
Breaking the code Nirenberg & Matthaei determined 1 st codon amino acid match UUU coded for phenylalanine created artificial poly(u) mrna added mrna to test tube of ribosomes & nucleotides mrna synthesized single amino acid polypeptide chain phe phe phe phe phe phe 1960 1968 What did this show us? What didn t this show us? Heinrich Matthaei Marshall Nirenberg 2
Translation Codons blocks of 3 nucleotides decoded into sequence of amino acids How does mrna code for proteins? Breaking the code! DNA mrna TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC protein Met Arg Val Asn Ala Cys Ala 3
The code For ALL life! strongest support for a common origin for all life Code is redundant several codons for each amino acid Why is this a good thing? Start codon AUG methionine Stop codons UGA, UAA, UAG How are the codons read? DNA TACGCACATTTACGTACGCGG 3 5 mrna trna protein AUGCGUGUAAAUGCAUGCGCC 5 3 3 5 UAC Met GCA Arg CAU Val codon anti-codon 4
Translation Ribosome reads mrna in codons start codon = AUG trna brings in correct amino acid trna matches codon of mrna = anticodon Amino acids assembled into polypeptide chain trna structure clover leaf structure anticodon on clover leaf end amino acid on 3 end 5
trna structure anticodon written 3 5 to match 5 3 codons Aminoacyl trna synthetase Enzyme which bonds amino acid to trna endergonic reaction ATP AMP energy stored in trna-amino acid bond unstable 6
Ribosomes Facilitate coupling of trna anticodon to mrna codon organelle or enzyme? Structure ribosomal RNA & proteins 2 subunits large small Ribosomes P site (peptidyl-trna site) holds trna carrying growing polypeptide chain A site (aminoacyl-trna site) holds trna carrying next amino acid to be added to chain E site (exit site) discharged trna leaves ribosome from exit site 7
Building a polypeptide 3 stages initiation brings together mrna, ribosome subunits, proteins & initiator trna elongation termination Elongation: growing a polypeptide 8
Termination: release polypeptide Release factor release protein bonds to A site bonds water molecule to polypeptide chain Now what happens to the protein? Put it all together 9
Polyribosomes Many ribosomes read single mrna simultaneously making many copies of protein simultaneous transcription & translation in prokaryotes 10
Protein targeting Signal peptide address label start of a secretory pathway Destinations: secretion nucleus mitochondria chloroplasts cell membrane cytoplasm Mutations Point mutations 1 base pair change base-pair substitution silent mutation no amino acid change redundancy in code missense change amino acid nonsense change to stop codon How can mutations affect the next generation? 11
Mutations Insertions adding base(s) Deletions losing base(s) both cause frameshift How can mutations affect the next generation? Sickle cell anemia 12
Sickle cell anemia 13