Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College. Eastern Campus



Similar documents
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!

Structure and Function of DNA

Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure enzymes control cell chemistry ( metabolism )

a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled

Transcription and Translation of DNA

DNA, RNA, Protein synthesis, and Mutations. Chapters

Genetics Module B, Anchor 3

Molecular Genetics. RNA, Transcription, & Protein Synthesis

From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains

RNA and Protein Synthesis

1 Mutation and Genetic Change

Protein Synthesis How Genes Become Constituent Molecules

Coding sequence the sequence of nucleotide bases on the DNA that are transcribed into RNA which are in turn translated into protein

The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:

Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in

2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three

Biotechnology and Recombinant DNA (Chapter 9) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College

From DNA to Protein

4. DNA replication Pages: Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?

Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.

Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription

PRACTICE TEST QUESTIONS

Name Class Date. Figure Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.

MUTATION, DNA REPAIR AND CANCER

Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary

Translation Study Guide

13.2 Ribosomes & Protein Synthesis

GENE REGULATION. Teacher Packet

Chapter 6 DNA Replication

Sample Questions for Exam 3

BCH401G Lecture 39 Andres

Lecture Series 7. From DNA to Protein. Genotype to Phenotype. Reading Assignments. A. Genes and the Synthesis of Polypeptides

Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown

Appendix C DNA Replication & Mitosis

Problem Set 3 KEY

Milestones of bacterial genetic research:

Gene mutation and molecular medicine Chapter 15

Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.

Academic Nucleic Acids and Protein Synthesis Test

RNA & Protein Synthesis

DNA Replication in Prokaryotes

ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes

AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET

Bio 102 Practice Problems Genetic Code and Mutation

BioBoot Camp Genetics

Specific problems. The genetic code. The genetic code. Adaptor molecules match amino acids to mrna codons

Basic Concepts of DNA, Proteins, Genes and Genomes

CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA

CCR Biology - Chapter 8 Practice Test - Summer 2012

DNA. Discovery of the DNA double helix

The Steps. 1. Transcription. 2. Transferal. 3. Translation

Complex multicellular organisms are produced by cells that switch genes on and off during development.

DNA: Structure and Replication

Transcription: RNA Synthesis, Processing & Modification

12.1 The Role of DNA in Heredity

Gene Regulation -- The Lac Operon

Genetics 301 Sample Final Examination Spring 2003

Control of Gene Expression

Chapter 17: From Gene to Protein

Lecture 1 MODULE 3 GENE EXPRESSION AND REGULATION OF GENE EXPRESSION. Professor Bharat Patel Office: Science 2, b.patel@griffith.edu.

Mutation. Mutation provides raw material to evolution. Different kinds of mutations have different effects

1.5 page 3 DNA Replication S. Preston 1

Lecture 6. Regulation of Protein Synthesis at the Translational Level

Chapter 11: Molecular Structure of DNA and RNA

Translation. Translation: Assembly of polypeptides on a ribosome

Chapter 18 Regulation of Gene Expression

Replication Study Guide

BCOR101 Midterm II Wednesday, October 26, 2005

Lab # 12: DNA and RNA

DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)

Viral Infection: Receptors

Multiple Choice Write the letter that best answers the question or completes the statement on the line provided.

Algorithms in Computational Biology (236522) spring 2007 Lecture #1

13.4 Gene Regulation and Expression

Genetics Lecture Notes Lectures 1 2

Given these characteristics of life, which of the following objects is considered a living organism? W. X. Y. Z.

somatic cell egg genotype gamete polar body phenotype homologous chromosome trait dominant autosome genetics recessive

Answer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA.

Ms. Campbell Protein Synthesis Practice Questions Regents L.E.

Basic attributes of genetic processes (replication, transcription, translation)

Cellular Respiration Worksheet What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain.

Control of Gene Expression

Viruses. Viral components: Capsid. Chapter 10: Viruses. Viral components: Nucleic Acid. Viral components: Envelope

MCAS Biology. Review Packet

To be able to describe polypeptide synthesis including transcription and splicing

VIRUSES. Basic virus structure. Obligate intracellular parasites. Enveloped Viruses. Classification of Viruses. Viruses. Heyer 1

Biology Final Exam Study Guide: Semester 2

How Cancer Begins???????? Chithra Manikandan Nov 2009

Kaustubha Qanungo Ph.D Biological Sciences Trident Technical College 7000 Rivers Avenue Charleston SC 29464

Gene Finding CMSC 423

BACTERIAL GENETICS. Sridhar Rao P.N

LECTURE 6 Gene Mutation (Chapter )

Bob Jesberg. Boston, MA April 3, 2014

Basic Principles of Transcription and Translation

Bio 102 Practice Problems Recombinant DNA and Biotechnology

Lecture 3: Mutations

The Nucleus: DNA, Chromatin And Chromosomes

Page 1. Name:

Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure

Transcription:

Microbial Genetics (Chapter 8) Lecture Materials for Amy Warenda Czura, Ph.D. Suffolk County Community College Primary Source for figures and content: Eastern Campus Tortora, G.J. Microbiology An Introduction 8th, 9th, 10th ed. San Francisco: Pearson Benjamin Cummings, 2004, 2007, 2010. Genetics = science of heredity study of what genes are, how they carry info, how they are replicated, passed along, and how expression of the info determines characteristics of the organism Genome = all genetic info in a cell Chromosome = organized unit of genome; bundle of DNA bacteria have 1, humans have 46 Genes = segments of DNA that code for functional products (rrna, trna or protein) Genomics = field of genetics involved in sequencing and molecular characterization of genomes Many organisms sequences known: e.g. E.coli = 4 million bp (~3-4 thousand genes) Yeast= 12 million bp (~5-6 thousand genes) Human= 3 billion bp (~30 thousand genes) DNA = macromolecule, strands of nucleotides nucleotide = nitrogenous base + deoxyribose + phosphate -deoxyribose and phosphate form linear strand, backbone -nitrogenous bases hang off side -two strands held together by H-bonding between bases, forms a double helix, two strands wound around each other -base pairing: A-T, G-C -bases on one strand determine bases on the other: the strands are complementary -sequence contains genetic info Features of biological info storage: 1. linear sequence of bases provides actual genetic info: only four bases but in chain of X length there are 4 X possibilities of different orders e.g. chain 2 bases long, using 4 possible bases, 4 2 = 16 possible configurations: AA TA CA GA AT TT CT GT AC TC CC GC AG TG CG GG 2. complementary structure of DNA allows precise duplication: one strand determines sequence of other: A-T, G-C Amy Warenda Czura, Ph.D. 1 SCCC BIO244 Chapter 8 Lecture Notes

Genotype = DNA, genetic makeup all the genes that can encode characteristics of an organism, potential properties Phenotype = protein the observed outcome of gene expression the appearance or metabolic capabilities of an organism Gene expression = turning the info from the gene in DNA into the molecule it encodes, usually a protein Not all genes are expressed: if not expressed the gene cannot contribute to the phenotype DNA and Chromosomes -bacteria: usually one chromosome (yeast -7 humans -46) -bacterial chromosome is circular DNA with associated proteins, attached to plasma membrane (eukaryotes = linear chromosomes, in nucleus) -the DNA is ~1000x longer than cell but chromosome structure is organized to occupy only 10% of cell volume DNA Replication -must replicate DNA to pass genetic info to progeny cells -process converts one parental molecule into two identical daughter molecules -process is semi-conservative: each strand of parental molecule is template for new strand, and new molecules contain half parental and half new DNA complementary base paired -DNA is a directional molecule -two strands in double helix are anti-parallel: run in opposite directions -directionality dictated by the sugar-phosphate bonds of the backbone: P on 5 carbon of nucleotide gets bound to OH on 3 carbon of next nucleotide -DNA polymerase (enzyme for DNA synthesis) can add nucleotides only to the 3 end of a growing molecule Amy Warenda Czura, Ph.D. 2 SCCC BIO244 Chapter 8 Lecture Notes

-new strands synthesized in opposite directions -energy for bond making comes from free nucleotides in tri-phosphate forms: ATP, TTP, GTP, CTP -two phosphates are removed and energy is used to create the sugar-phosphate (OH to P) bond between nucleotides DNA Replication DNA Replication Events (on handout) 1. Enzymes, gyrase and helicase, unwind the parental double helix at a site called the origin of replication. 2. Proteins stabilize the unwound parental DNA creating the replication fork. 3. Beginning with an RNA primer complementarily base paired to the single stranded parental DNA, the leading strand is synthesized continuously by the enzyme DNA polymerase in the direction of the replication fork. New tri-phosphate nucleotides from the cytoplasm/nucleoplasm are complementarily base paired with the parental strand and chemically bonded to the 3 end of the RNA primer and subsequently to each other at the 3 ends (via removal of two phosphates) to create a new DNA strand. 4. The lagging strand is synthesized discontinuously: At the replication fork an RNA primer complementarily pairs with the single stranded parental DNA. Nucleotides are complementarily base paired to the single stranded DNA molecule and bonded to the 3 end of the RNA primer and growing chain by DNA polymerase, working away from the replication fork for ~1000bases. The resulting segment is called an Okazaki fragment. 5. As the replication fork moves forward, the leading strand continues to have nucleotides added to the 3 end. The lagging strand begins another Okazaki fragment. DNA polymerase digests the RNA primers on completed Okazaki fragments on the lagging strand and replaces them with DNA nucleotides. 6. As each Okazaki fragment ends at the beginning of the previous one, the enzyme DNA ligase bonds the neighboring fragments into a single continuous molecule. 7. Replication continues down the full length of the chromosome until both parental strands are completely separated and each is base paired to a newly synthesized strand. Bacterial chromosomes can replicate bidirectionally: one origin of replication with two replication forks moving in opposite directions -origin of replication is associated with the plasma membrane to insure separation of duplicated chromosomes to each daughter cell during binary fission DNA replication accurate: DNA polymerase has proofreading ability to insure proper base pairing before backbone is chemically bonded Error rate = ~1 in 10 9 bases error = mutation Gene Expression: RNA and protein synthesis -DNA replication only occurs in cells that are dividing -gene expression occurs in all cells all the time: cells are constructed of protein and require enzymes to function DNA --------------> RNA --------------> Protein transcription translation Amy Warenda Czura, Ph.D. 3 SCCC BIO244 Chapter 8 Lecture Notes

Transcription = synthesis of complementary strand of RNA from DNA template Translation = synthesis of protein from info on mrna template Gene Structure (on handout) Promoter Start codon Open Reading Frame (ORF) (codons for amino acids) Stop codon Terminator The Promoter and Terminator are directions for RNA polymerase to indicate the location of the gene to be transcribed The start and stop codons are directions for the ribosome to indicate where the amino acid information for translation begins and ends The ORF is the coding region of the gene: it begins at the start codon and contains in order all the codons for all the amino acids in the resulting protein. (3 bases of DNA = 1 codon, each codon indicates one of the 20 amino acids) The ORF ends at the stop codon. Transcription making RNA from DNA 3 types of RNA: 1. Ribosomal RNA (rrna) - integral part of ribosomes, which carry out protein synthesis 2. Transfer RNA (trna) - bring amino acids to ribosome for use in protein synthesis 3. Messenger RNA (mrna) - carries coded info for synthesis of specific proteins from DNA gene to ribosome for use RNA is synthesized as complementary copy of a DNA gene except that T is replaced by U The complement is produced from the template or sense strand of the DNA gene Coding/Antisense strand of the DNA: ATGGTATTCTCCTATCGTTAA Template/Sense of the DNA gene: TACCATAAGAGGATAGCAATT RNA: AUGGUAUUCUCCUAUCGUUAA Transcription Events (on handout) Translation -protein synthesis at the ribosome DNA: 4 different bases in a particular order make up the gene sequence RNA: 4 bases complementary to the DNA gene make up the RNA sequence Nucleotide bases are like letters in the alphabet: used in groups of three to make words ; each word indicates a particular amino acid 3 nucleotides = 1 codon Each codon = one amino acid of the 20 possible Translation involves reading the codons on the mrna to build the polypeptide using the correct amino acids in the order specified by the gene The Genetic Code -all organisms use the same codons to specify the particular amino acids Amy Warenda Czura, Ph.D. 4 SCCC BIO244 Chapter 8 Lecture Notes

64 possible codons (4 3 ) but only 20 amino acids: some are redundant 61 codons code for amino acids = sense codons 3 nonsense codons serve as the STOP signal to terminate protein synthesis For each sense codon there is a trna with a complementary antisense codon: this trna carries the amino acid specified by the codon There are no trna molecules with anticodons to the 3 nonsense codons (stop codons): UAA, UAG, UGA, and thus no amino acids The start codon is AUG and codes for the amino acid methionine The start codon establishes the reading frame of the mrna: all other codons (each three nucleotides) can be read once the start has been identified Use the genetic code chart to decode the amino acid sequence of any mrna: AUG /GUA /UUC /UCC /UAU /CGU /UAA on handout AUG /GUA /UUC /UCC /UAU /CGU /UAA Met - Val -Phe -Ser -Tyr -Arg -STOP Translation Events (on handout) Translation begins at the AUG codon Amy Warenda Czura, Ph.D. 5 SCCC BIO244 Chapter 8 Lecture Notes

Translation ends at the stop codon because: -no trna with a complementary anticodon exists to pair with a stop codon -no amino acid arrives to be peptide bonded to the chain Once the ribosome begins moving along the mrna molecule the start codon is exposed and another ribosome can assemble and begin translation In prokaryotes there is no nuclear separation so translation can begin before transcription is complete Amy Warenda Czura, Ph.D. 6 SCCC BIO244 Chapter 8 Lecture Notes

In eukaryotes, transcription occurs in the nucleus: mrna must exit to the cytoplasm before translation can begin Also eukaryotic RNA must be processed before a functional mrna is generated Eukaryotic genes contain introns and exons exons = coding portion (codons) introns = junk RNA generated by complementary base pairing to the template DNA contains both introns and exons. Small nuclear ribonucleoproteins (snrnps) cut out the introns and splice together the exons to form mrna that can be used for translation Exons can provide variability: many mrna configurations can be formed from a single gene with multiple exons e.g. use all or only some of the exons: 3 exons = 7+ different mrnas (and thus proteins) 1-2-3, 1-2, 1-3, 2-3, 1, 2, 3 Regulation of Bacterial Gene Expression -protein synthesis metabolically expensive: cells only make what is needed -60-80% of genes constitutively expressed: housekeeping genes -genes not involved in normal or continuous processes have expression regulated -feedback inhibition regulates enzymes that have already been synthesized -genetic control mechanism control the synthesis of new enzymes Genetic Control Mechanisms: -regulate transcription of mrna, thus control enzyme synthesis Two Mechanisms: 1. Induction 2. Repression 1. Induction = mechanism that turns on the transcription of a gene and thus translation of its enzyme product -tends to control catabolic pathway enzymes -gene expression induced by substrate for pathway -default position of gene expression is off Mode of Action: -Gene expression is off because active repressor protein blocks RNA polymerase -Inducer (substrate) binds to repressor thus inactivating it -RNA polymerase now free to transcribe gene (gene expression on) -mrna synthesized -protein synthesized Inducible gene system! inducible enzyme Amy Warenda Czura, Ph.D. 7 SCCC BIO244 Chapter 8 Lecture Notes

2. Repression = mechanism that inhibits gene expression thus decreasing synthesis of corresponding enzyme -tends to control anabolic pathway enzymes -gene expression repressed by final product produced in pathway -default position of gene expression is on Mode of Action: -Gene expression is on -Repressor (regulatory protein) is activated by corepressor (product) -repressor + corepressor block RNA polymerase -no mrna synthesis (gene expression off) -no protein synthesis All genes involved in one pathway are often organized together on the chromosome under control of one promoter in a unit called an operon Terminator Operon consists of: 1. Promoter: region of DNA where RNA polymerase initiates transcription 2. Operator: region of DNA that serves as stop/go signal for transcription 3. Genes: all the ORFs for all the enzymes in the pathway linked end to end; each has its own start and stop codon 4. Terminator: region of DNA where RNA polymerase ends transcription An operon has only one promoter and one operator that control all the genes at once: all are expressed or none are. Each gene has its own start & stop codon: all will be transcribed on one mrna but during translation each ORF will form its own separate protein. Examples of genetic control of gene expression: 1. Lac Operon (on handout) O Terminator Transcription E C D B Translation A Amy Warenda Czura, Ph.D. 8 SCCC BIO244 Chapter 8 Lecture Notes

2. Tryptophan Synthesis Operon (on handout) Genetic Mutations Mutation = change in base sequence of DNA Silent mutation = no change in the activity of the gene product -no change in amino acid (often third base in codon ) e.g. G-C-anything = alanine -change in amino acid did not affect function of the protein Some mutations harmful: decreased activity, loss of activity Some mutations beneficial: new or enhanced activity (this drives evolution) Types of mutations: 1. Base substitution / point mutation single base at one point in DNA replaced by another base A. Silent point mutation: does not change the amino acid B. Missense point mutation: causes insertion of the wrong amino acid e.g. Sickle cell anemia: A! T, GAG! GTG in hemoglobin glutamic acid (+ charge)! valine (neutral) folded hemoglobin globular! fibrous RBCs round! elongated (block capillaries, don t carry O 2 well C. Nonsense point mutation: creates a stop codon in the middle of a gene - protein will be incomplete template Amy Warenda Czura, Ph.D. 9 SCCC BIO244 Chapter 8 Lecture Notes

2. Frameshift mutation one or a few nucleotides are deleted or inserted - this can alter the translational reading frame e.g. AUG GCU ACC GUC... Met - Ala - Thr - Val insert A at 4th position: AUG AGC UAC CGU C Met - Ser - Tyr - Arg- template Spontaneous mutations: occur in absence of any mutation causing agent, represent the error rate of DNA polymerase (1 in 10 9 ) Mutagen = agent in environment that brings about DNA mutation. Usually chemically or physically interact with DNA to cause change. Once mistake is fixed into the DNA the change is permanent. 1. Chemical mutagens (examples) A. Nitrous acid: converts A so it pairs with C instead of T Frameshift mutations almost always cause long stretch of altered amino acids resulting in inactive protein. Nonsense mutations (stop codons) can also be created B. Nucleoside analogs: have chemical structure similar to a base but do not base pair correctly e.g. 5-bromouracil incorporated in place of T but base pairs with G not A C. Benzopyrene (cigarette smoke): causes frameshift mutations: binds between bases and offsets the double helix strands, repair mechanisms add a base to the other strand to re-set alignment 2. Radiation A. x-rays and "-rays: create ions and free radicals that break molecular bonds B. UV: causes crosslinking of T bases (Thymine dimer) which can prevent unwinding for replication or transcription Cells have light repair enzymes called photolyases which cut out damaged Ts and replace them Amy Warenda Czura, Ph.D. 10 SCCC BIO244 Chapter 8 Lecture Notes

Nucleotide excision repair = enzymes that function to cut out and replace DNA damage 1. damaged parts are removed leaving gap in strand 2. gap is filled by complementary base pairing from other strand -often repair restores correct sequence -sometimes errors are made during repair: once nucleotide excision repair mechanisms seal the DNA, mutation is permanent Damage on one strand Damage on both strands ATGCTAGGCTATTATCG TACGATCCGATAATAGC ATGCTAGGCTATTATCG TACGATCCGATAATAGC ATGCT TACGAT GCTATTATCG GATAATAGC ATGCTA?GCTATTATCG TACGAT?CGATAATAGC Mutation rate = probability that gene will mutate when cell divides Spontaneous mutation rate ~10-9 (1 in a billion) Average gene ~10 3 bp long, so approximately 1 in 10 6 genes mutated each replication Mutations are random If harmful, organism dies If beneficial, organism thrives and passes mutation to offspring (drives adaptation and evolution) Genetic Transfer and Recombination genetic recombination = exchange of genes between two DNA molecules to form new combinations of genes on chromosome -involves crossing over Mutagens change rate 10-1000 fold: up to 1:1000 genes mutated each replication Amy Warenda Czura, Ph.D. 11 SCCC BIO244 Chapter 8 Lecture Notes

Genetic recombination contributes to population diversity: recombinations more likely than mutations to provide beneficial change since it tends not to destroy gene function Eukaryotes: recombination during meiosis for sexual reproduction -creates diversity in offspring but parent remains unchanged -vertical gene transfer = genes passed from organism to offspring Prokaryotes: recombination via gene transfer between cells or within cell by transformation, conjugation, or transduction -original cell is altered -horizontal gene transfer = genes passed to neighboring microbes of same generation -transfer involves donor cell that gives portion of DNA to recipient cell -when donor DNA incorporated into recipient, recipient now called recombinant cell -if recombinant cell acquired new function/characteristic as result of new DNA, cell has been transformed Generation of recombinant cells is very low frequency event (less than 1%): very few cells in population are capable of exchanging and incorporating DNA Three methods of prokaryotic gene transfer: 1. Bacterial Transformation -genes transferred as naked DNA -can occur between unrelated genus/species -discovered by F. Griffith 1928 who studied Streptococcus pneumoniae -virulent strain had capsule -non-virulent stain did not -in mouse, dead virulent strain could pass virulence factor to live nonvirulent strain -competent cells can pick up DNA from dead cells and incorporate it into genome by recombination (e.g. antibiotic resistance) -transformed cell than passes genetic recombination to progeny competent = permeable to DNA: alterations in cell wall that allow large molecule like DNA to get through (in lab we use chemical agents to poke holes) -transformation works best when donor and recipient are related but they do not have to be Amy Warenda Czura, Ph.D. 12 SCCC BIO244 Chapter 8 Lecture Notes

2. Conjugation -genes transferred between two live cells via sex pilus (Gram -) or surface adhesion molecules (Gram +) -transfer mediated by a plasmid: small circle of DNA separate from genome that is self replicating but contains no essential genes -plasmid has genes for its own transfer -Gram negative plasmids have genes for pilus -Gram positive plasmids have genes for surface adhesion molecules Conjugation requires cell to cell contact between two cells of opposite mating type, usually the same species, must be same genus During conjugation plasmid is replicated and single stranded copy is transferred to recipient. Recipient synthesizes complementary strand to complete plasmid -plasmid can remain as separate circle or -plasmid can be integrated into host cell genome resulting in permanent chromosomal changes 3. Transduction -DNA from a donor is carried by a virus to a recipient cell Bacteriophage / Phage = virus that infects bacterial cells -each phage is species specific (donor and recipient are the same species) Transduction mechanism: 1. Phage attaches to donor cell and injects phage DNA 2. Phage DNA directs donor cell to synthesize phage proteins and DNA, phage enzymes digest the bacterial chromosome 3. New phages are assembled: phage DNA is packaged into capsids Occasionally bacterial DNA is packaged by mistake 4. Capsid containing bacterial DNA infects new host recipient cell by injecting the DNA 5. Donor DNA does not direct viral replication (not viral DNA): instead integrates into recipient genome Amy Warenda Czura, Ph.D. 13 SCCC BIO244 Chapter 8 Lecture Notes

DNA entities used for genetic change: (in both prokaryotes and eukaryotes) 1. Plasmids = self-replicating circle of DNA containing extra genes A. conjugative plasmids: used in bacterial conjugation, at minimum contain genes for pili or adhesion molecules B. dissimilation plasmids: carry genes that code for enzymes to trigger catabolism of unusual carbs or hydrocarbons C. pathogenicity plasmids: carry genes that code for virulence traits! capsules, toxins, adhesion molecules, bacteriocins D. resistance factor plasmids: carry genes for resistance to antibiotic and toxins -plasmids can be transferred between species: -allows spread of antibiotic resistance between different pathogens -wide use of antibiotics has put selective pressure on microbes to develop and share resistance genes 2. Transposons = small segments of DNA that can move independently from one region of DNA to another -discovered 1950s by McClintock: mosaic pattern in indian corn (Nobel Prize 1983) -transposons pop out and randomly insert at rate of 10-5 to 10-7 per generation -integration is random: can disrupt genes -at minimum transposons carry genetic info to carry out own transposition, may also carry other genes Simplest transposon = insertion sequence -gene for transposase (enzyme that cuts DNA at recognition sites and religates it elsewhere in genome) -two recognition sites called inverted repeats, mark ends of transposon, recognized by transposase -complex transposons have inverted repeats outside other genes -genes will get carried with transposon when it moves -transposons can be carried between cells on plasmids or by viruses, even between species -depending on where it inserts and what genes it carries it can mediate good or bad genetic changes Amy Warenda Czura, Ph.D. 14 SCCC BIO244 Chapter 8 Lecture Notes