DNA: Structure and Replication
|
|
|
- Ernest Lawrence
- 9 years ago
- Views:
Transcription
1 7 DNA: Structure and Replication WORKING WITH THE FIGURES 1. In Table 7-1, why are there no entries for the first four tissue sources? For the last three entries, what is the most likely explanation for the slight differences in the composition of human DNA from the three tissue sources? Answer: The first four are single-celled organisms; therefore, a tissue category does not apply. The differences in the values are most likely attributable to experimental error. 2. In Figure 7-7, do you recognize any of the components used to make Watson and Crick s DNA model? Where have you seen them before? Answer: Watson and Crick made use of molecular models, ring stands, and clamps, typically found in a chemistry lab. The vertically oriented pentagons are the deoxyribose components of DNA. These are components of the two sugarphosphate backbones of the DNA structure, one behind James Watson and the other just to the left of Francis Crick. Nitrogenous bases oriented horizontally are held in place in between the two backbones by clamps. 3. Referring to Figure 7-20, answer the following questions: a. What is the DNA polymerase I enzyme doing? b. What other proteins are required for the DNA polymerase III on the left to continue synthesizing DNA? c. What other proteins are required for the DNA polymerase III on the right to continue synthesizing DNA? Answer: a. PolI is removing ribonucleotide primers and filling gaps between Okazaki fragments. b. -clamp and helicase c. -clamp, helicase, primase, and ssb
2 Chapter Seven What is different about the reaction catalyzed by the green helicase in Figure 7-20 and the yellow gyrase in Figure 7-21? Answer: Gyrase breaks the phosphodiester linkages in the DNA backbone, while helicase disrupts the hydrogen bonds between the paired bases of antiparallel strands. 5. In Figure 7-24(a), label all the leading and lagging strands. Answer: Each fork has both a leading and a lagging strand, as labeled below: BASIC PROBLEMS 6. Describe the types of chemical bonds in the DNA double helix. Answer: The DNA double helix is held together by two types of bonds, covalent and hydrogen. Covalent bonds occur within each linear strand and strongly bond the bases, sugars, and phosphate groups (both within each component and between components). Hydrogen bonds occur between the two strands and involve a base from one strand with a base from the second in complementary pairing. These hydrogen bonds are individually weak but collectively quite strong. 7. Explain what is meant by the terms conservative and semiconservative replication. Answer: Conservative replication is a hypothetical form of DNA synthesis in which the two template strands remain together but dictate the synthesis of two new DNA strands, which then form a second DNA helix. The end point is two double helices, one containing only old DNA and one containing only new DNA. This hypothesis was found to be not correct. Semiconservative replication is a form of DNA synthesis in which the two template strands separate and each dictates the synthesis of a new strand. The end point is two double helices, both containing one new and one old strand of DNA. This hypothesis was found to be correct.
3 262 Chapter Seven 8. What is meant by a primer, and why are primers necessary for DNA replication? Answer: A primer is a short segment of RNA that is synthesized by primase using DNA as a template during DNA replication. Once the primer is synthesized, DNA polymerase then adds DNA to the 3 end of the RNA. Primers are required because the major DNA polymerase involved with DNA replication is unable to initiate DNA synthesis and, rather, requires a 3 end. (It is the 3 -OH group that is required to create the next phosphodiester bond.) The RNA is subsequently removed and replaced with DNA so that no gaps exist in the final product. 9. What are helicases and topoisomerases? Answer: Helicases are enzymes that disrupt the hydrogen bonds that hold the two DNA strands together in a double helix. This breakage is required for both RNA and DNA synthesis. Topoisomerases are enzymes that create and relax supercoiling in the DNA double helix. The supercoiling itself is a result of the twisting of the DNA helix that occurs when the two strands separate. 10. Why is DNA synthesis continuous on one strand and discontinuous on the opposite strand? Answer: Because the DNA polymerase is capable of adding new nucleotides only at the 3 end of a DNA strand, and because the two strands are antiparallel, at least two molecules of DNA polymerase must be involved in the replication of any specific region of DNA. When a region becomes single-stranded, the two strands have an opposite orientation. Imagine a single-stranded region that runs from right to left. The 5 end is at the right, with the 3 end pointing to the left; synthesis can initiate and continue uninterrupted toward the right end of this strand. Remember: new nucleotides are added in a 5 3 direction, so the template must be copied from its 3 end. The other strand has a 5 end at the left with the 3 end pointing right. Thus, the two strands are oriented in opposite directions (antiparallel), and synthesis (which is 5 3 ) must proceed in opposite directions. For the leading strand (say, the top strand), replication is to the right, following the replication fork. It is continuous and may be thought of as moving downstream. Replication on the bottom strand cannot move in the direction of the fork (to the right) because, for this strand, that would mean adding nucleotides to its 5 end. Therefore, this strand must replicate discontinuously: as the fork creates a new single-stranded stretch of DNA, this is replicated to the left (away from the direction of fork movement). For this lagging strand, the replication fork is always opening new single-stranded DNA for replication upstream of the previously replicated stretch, and a new fragment of DNA is replicated back to the previously created fragment. Thus, one
4 Chapter Seven 263 (Okazaki) fragment follows the other in the direction of the replication fork, but each fragment is created in the opposite direction. 11. If the four deoxynucleotides showed nonspecific base pairing (A to C, A to G, T to G, and so on), would the unique information contained in a gene be maintained through round after round of replication? Explain. Answer: No. The information of DNA is dependent on a faithful copying mechanism. The strict rules of complementarity ensure that replication and transcription are reproducible. 12. If the helicases were missing during replication, what would happen to the replication process? Answer: Helicases are enzymes that disrupt the hydrogen bonds that hold the two DNA strands together in a double helix. This breakage exposes lengths of single-stranded DNA that will act as the template and are required for DNA replication. Therefore, the absence of helicases would prevent the replication process. 13. Both strands of a DNA molecule are replicated simultaneously in a continuous fashion on one strand and a discontinuous one on the other. Why can t one strand be replicated in its entirety (from end to end) before replication of the other is initiated? Answer: Theoretically, DNA could be replicated this way but not with the replisome, which is organized to replicate both stands simultaneously. Further, this would leave one strand of the DNA single-stranded where mutagenic events would be more likely, and it would certainly take longer. 14. What would happen if, in the course of replication, the topoisomerases were unable to reattach the DNA fragments of each strand after unwinding (relaxing) the DNA molecule? Answer: The chromosome would become hopelessly fragmented. 15. Which of the following would happen if DNA synthesis were discontinuous on both strands? a. The DNA fragments from the two new strands could become mixed, producing possible mutations. b. DNA synthesis would not take place, because the appropriate enzymes to carry out discontinuous replication on both strands would not be present.
5 264 Chapter Seven c. DNA synthesis might take longer, but otherwise there would be no noticeable difference. d. DNA synthesis would not take place, because the entire length of the chromosome would have to be unwound before both strands could be replicated in a discontinuous fashion. Answer: c. DNA synthesis might take longer. 16. Which of the following is not a key property of hereditary material? a. It must be capable of being copied accurately. b. It must encode the information necessary to form proteins and complex structures. c. It must occasionally mutate. d. It must be able to adapt itself to each of the body s tissues. Answer: d. It does not have to adapt to each of the body s tissues. 17. It is essential that RNA primers at the ends of Okazaki fragments be removed and replaced by DNA because otherwise which of the following events would result? a. The RNA might not be accurately read during transcription, thus interfering with protein synthesis. b. The RNA would be more likely to contain errors because primase lacks a proofreading function. c. The stretches of RNA would destabilize and begin to break up into ribonucleotides, thus creating gaps in the sequence. d. The RNA primers would be likely to hydrogen bond to each other, forming complex structures that might interfere with the proper formation of the DNA helix. Answer: b. The RNA would be more likely to contain errors. 18. Polymerases usually add only about 10 nucleotides to a DNA strand before dissociating. However, during replication, DNA pol III can add tens of thousands of nucleotides at a moving fork. How is this addition accomplished? Answer: Part of the replisome is the sliding clamp, which encircles the DNA and keeps pol III attached to the DNA molecule. Thus, pol III is transformed into a processive enzyme capable of adding tens of thousands of nucleotides. 19. At each origin of replication, DNA synthesis proceeds bidirectionally from two replication forks. Which of the following would happen if a mutant arose having only one functional fork per replication bubble? (See diagram.) a. No change at all in replication.
6 Chapter Seven 265 b. Replication would take place only on one half of the chromosome. c. Replication would be complete only on the leading strand. d. Replication would take twice as long. Answer: d. Replication would take twice as long. 20. In a diploid cell in which 2n = 14, how many telomeres are there in each of the following phases of the cell cycle? (a) G1 (c) mitotic prophase (b) G2 (d) mitotic telophase Answer: a. Prior to the S phase, each chromosome has two telomeres, so in the case of 2n = 14, there are 14 chromosomes and 28 telomeres. b. After S, each chromosome consists of two chromatids, each with two telomeres, for a total of four telomeres per chromosome. So, for 14 chromosomes, there would be 14 4 = 56 telomeres. c. At prophase, the chromosomes still consist of two chromatids each, so there would be 14 4 = 56 telomeres. d. At telophase, there would be 28 telomeres in each of the soon-to-be daughter cells. 21. If thymine makes up 15 percent of the bases in a specific DNA molecule, what percentage of the bases is cytosine? Answer: If the DNA is double stranded, A = T and G = C and A + T + C + G = 100%. If T = 15%, then C = [100 15(2)]/2 = 35%. 22. If the GC content of a DNA molecule is 48 percent, what are the percentages of the four bases (A, T, G, and C) in this molecule? Answer: If the DNA is double stranded, G = C = 24% and A = T = 26%. 23. Bacteria called extremophiles are able to grow in hot springs such as Old Faithful at Yellowstone National Park in Wyoming. Do you think that the DNA
7 266 Chapter Seven of extremophiles would have a higher content of GC or AT base pairs? Justify your answer. Answer: Higher GC content. The increased number of hydrogen bonds would help to counteract the destabilizing effect of increased heat. 24. Assume that a certain bacterial chromosome has one origin of replication. Under some conditions of rapid cell division, replication could start from the origin before the preceding replication cycle is complete. How many replication forks would be present under these conditions? Answer: Six. The first replication start would have two replication forks proceeding to completion, and the now replicated origins would each start replication again. Each would have two more replication forks, for a total of six. 25. A molecule of composition 5 -AAAAAAAAAAA-3 3 -TTTTTTTTTTTTT-5 is replicated in a solution of adenine nucleoside triphosphate with all its phosphorus atoms in the form of the radioactive isotope 32P. Will both daughter molecules be radioactive? Explain. Then repeat the question for the molecule 5 -ATATATATATATAT-3 3 -TATATATATATATA-5 Answer: Only the DNA molecule that used the poly-t strand as a template would be radioactive. The other daughter molecule would not be radioactive because it would not have required any datp for its replication. Because each strand of the second molecule contains T, both daughter molecules would require datp for replication, so each would be radioactive. 26. Would the Meselson and Stahl experiment have worked if diploid eukaryotic cells had been used instead? Answer: Yes. DNA replication is also semi-conservative in diploid eukaryotes. 27. Consider the following segment of DNA, which is part of a much longer molecule constituting a chromosome: 5. ATTCGTACGATCGACTGACTGACAGTC.3 3. TAAGCATGCTAGCTGACTGACTGTCAG.5 If the DNA polymerase starts replicating this segment from the right,
8 Chapter Seven 267 a. which will be the template for the leading strand? b. Draw the molecule when the DNA polymerase is halfway along this segment. c. Draw the two complete daughter molecules. d. Is your diagram in part b compatible with bidirectional replication from a single origin, the usual mode of replication? Answer: a. If replication is proceeding such that the DNA on the right is replicated first, then the top strand is the template for the leading strand. b. c ATTCGTACGATCGACTGACTGACAGTC TAAGCATGCTAGCTGACTGACTGTCAG ATTCGTACGATCGACTGACTGACAGTC TAAGCATGCTAGCTGA CTGACTGTCAG-5... d. Yes, it simply represents replication at one of the forks. 28. The DNA polymerases are positioned over the following DNA segment (which is part of a much larger molecule) and moving from right to left. If we assume that an Okazaki fragment is made from this segment, what will be the fragment s sequence? Label its 5 and 3 ends. 5. CCTTAAGACTAACTACTTACTGGGATC.3 3. GGAATTCTGATTGATGAATGACCCTAG.5 Answer: The bottom strand will serve as the template for the Okazaki fragment so its sequence will be: 5...CCTTAAGACTAACTACTTACTGGGATC E. coli chromosomes in which every nitrogen atom is labeled (that is, every nitrogen atom is the heavy isotope 15N instead of the normal isotope 14N) are allowed to replicate in an environment in which all the nitrogen is 14N. Using a
9 268 Chapter Seven solid line to represent a heavy polynucleotide chain and a dashed line for a light chain, sketch each of the following descriptions: a. The heavy parental chromosome and the products of the first replication after transfer to a 14N medium, assuming that the chromosome is one DNA double helix and that replication is semiconservative. b. Repeat part a, but now assume that replication is conservative. c. Repeat part a, but assume that the chromosome is in fact two side-by-side double helices, each of which replicates semiconservatively. d. Repeat part c, but assume that each side-by-side double helix replicates conservatively and that the overall chromosome replication is semiconservative. e. If the daughter chromosomes from the first division in 14N are spun in a cesium chloride density gradient and a single band is obtained, which of the possibilities in parts a through d can be ruled out? Reconsider the Meselson and Stahl experiment: What does it prove? Answer: Model (b) is ruled out by the experiment. The results are compatible with semiconservative replication, but the exact structure could not be predicted. The other models would all give one band of intermediate density.
10 Chapter Seven 269 CHALLENGING PROBLEMS 30. If a mutation that inactivated telomerase occurred in a cell (telomerase activity in the cell = zero), what do you expect the outcome to be? Answer: Without functional telomerase, the telomeres would shorten at each replication cycle, leading to eventual loss of essential coding information and death. In fact, there are some current observations that decline or loss of telomerase activity plays a role in the mechanism of aging in humans. 31. On the planet Rama, the DNA is of six nucleotide types: A, B, C, D, E, and F. Types A and B are called marzines, C and D are orsines, and E and F are pirines. The following rules are valid in all Raman DNAs: Total marzines = total orsines = total pirines A = C = E B = D = F a. Prepare a model for the structure of Raman DNA. b. On Rama, mitosis produces three daughter cells. Bearing this fact in mind, propose a replication pattern for your DNA model. c. Consider the process of meiosis on Rama. What comments or conclusions can you suggest? Answer: a. A very plausible model is of a triple helix, which would look like a braid, with each strand interacting by hydrogen bonding to the other two. b. Replication would have to be terti-conservative. The three strands would separate, and each strand would dictate the synthesis of the other two strands. c. The reductional division would have to result in three daughter cells, and the equational would have to result in two daughter cells, in either order. Thus, meiosis would yield six gametes 32. If you extract the DNA of the coliphage φx174, you will find that its composition is 25 percent A, 33 percent T, 24 percent G, and 18 percent C. Does this composition make sense in regard to Chargaff s rules? How would you interpret this result? How might such a phage replicate its DNA? Answer: Chargaff s rules are that A = T and G = C. Because this is not observed, the most likely interpretation is that the DNA is single-stranded. The phage would first have to synthesize a complementary strand before it could begin to make multiple copies of itself.
Appendix C DNA Replication & Mitosis
K.Muma Bio 6 Appendix C DNA Replication & Mitosis Study Objectives: Appendix C: DNA replication and Mitosis 1. Describe the structure of DNA and where it is found. 2. Explain complimentary base pairing:
DNA. Discovery of the DNA double helix
DNA Replication DNA Discovery of the DNA double helix A. 1950 s B. Rosalind Franklin - X-ray photo of DNA. C. Watson and Crick - described the DNA molecule from Franklin s X-ray. What is DNA? Question:
DNA Replication in Prokaryotes
OpenStax-CNX module: m44488 1 DNA Replication in Prokaryotes OpenStax College This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section,
Bio 102 Practice Problems Chromosomes and DNA Replication
Bio 102 Practice Problems Chromosomes and DNA Replication Multiple choice: Unless otherwise directed, circle the one best answer: 1. Which one of the following enzymes is NT a key player in the process
1.5 page 3 DNA Replication S. Preston 1
AS Unit 1: Basic Biochemistry and Cell Organisation Name: Date: Topic 1.5 Nucleic Acids and their functions Page 3 l. DNA Replication 1. Go through PowerPoint 2. Read notes p2 and then watch the animation
Chapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?
Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.
Sample Questions for Exam 3
Sample Questions for Exam 3 1. All of the following occur during prometaphase of mitosis in animal cells except a. the centrioles move toward opposite poles. b. the nucleolus can no longer be seen. c.
Chapter 11: Molecular Structure of DNA and RNA
Chapter 11: Molecular Structure of DNA and RNA Student Learning Objectives Upon completion of this chapter you should be able to: 1. Understand the major experiments that led to the discovery of DNA as
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
2. The number of different kinds of nucleotides present in any DNA molecule is A) four B) six C) two D) three
Chem 121 Chapter 22. Nucleic Acids 1. Any given nucleotide in a nucleic acid contains A) two bases and a sugar. B) one sugar, two bases and one phosphate. C) two sugars and one phosphate. D) one sugar,
The Structure, Replication, and Chromosomal Organization of DNA
Michael Cummings Chapter 8 The Structure, Replication, and Chromosomal Organization of DNA David Reisman University of South Carolina History of DNA Discoveries Friedrich Miescher Isolated nuclein from
Replication Study Guide
Replication Study Guide This study guide is a written version of the material you have seen presented in the replication unit. Self-reproduction is a function of life that human-engineered systems have
7. 3. replication. Unit 7: Molecular biology and genetics
7. 3 DN replication he fact that DN is a self-replicating molecule and can make copies of itself is the basis of all life forms. It is the essence of what life is. Indeed, according to Richard Dawkins
Answer: 2. Uracil. Answer: 2. hydrogen bonds. Adenine, Cytosine and Guanine are found in both RNA and DNA.
Answer: 2. Uracil Adenine, Cytosine and Guanine are found in both RNA and DNA. Thymine is found only in DNA; Uracil takes its (Thymine) place in RNA molecules. Answer: 2. hydrogen bonds The complementary
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
Name: Date: Period: DNA Unit: DNA Webquest
Name: Date: Period: DNA Unit: DNA Webquest Part 1 History, DNA Structure, DNA Replication DNA History http://www.dnaftb.org/dnaftb/1/concept/index.html Read the text and answer the following questions.
C A. How many high-energy phosphate bonds would be consumed during the replication of a 10-nucleotide DNA sequence (synthesis of a single-strand)?
1. (20 points) Provide a brief answer to the following questions. You may use diagrams or equations, as appropriate, but your answer should be largely a written response of two or three sentences. 4. The
K'NEX DNA Models. Developed by Dr. Gary Benson Department of Biomathematical Sciences Mount Sinai School of Medicine
KNEX DNA Models Introduction Page 1 of 11 All photos by Kevin Kelliher. To download an Acrobat pdf version of this website Click here. K'NEX DNA Models Developed by Dr. Gary Benson Department of Biomathematical
DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3
DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can
STRUCTURES OF NUCLEIC ACIDS
CHAPTER 2 STRUCTURES OF NUCLEIC ACIDS What is the chemical structure of a deoxyribonucleic acid (DNA) molecule? DNA is a polymer of deoxyribonucleotides. All nucleic acids consist of nucleotides as building
DNA Worksheet BIOL 1107L DNA
Worksheet BIOL 1107L Name Day/Time Refer to Chapter 5 and Chapter 16 (Figs. 16.5, 16.7, 16.8 and figure embedded in text on p. 310) in your textbook, Biology, 9th Ed, for information on and its structure
Every time a cell divides the genome must be duplicated and passed on to the offspring. That is:
DNA Every time a cell divides the genome must be duplicated and passed on to the offspring. That is: Original molecule yields 2 molecules following DNA replication. Our topic in this section is how is
Central Dogma. Lecture 10. Discussing DNA replication. DNA Replication. DNA mutation and repair. Transcription
Central Dogma transcription translation DNA RNA Protein replication Discussing DNA replication (Nucleus of eukaryote, cytoplasm of prokaryote) Recall Replication is semi-conservative and bidirectional
Nucleotides and Nucleic Acids
Nucleotides and Nucleic Acids Brief History 1 1869 - Miescher Isolated nuclein from soiled bandages 1902 - Garrod Studied rare genetic disorder: Alkaptonuria; concluded that specific gene is associated
2. True or False? The sequence of nucleotides in the human genome is 90.9% identical from one person to the next. False (it s 99.
1. True or False? A typical chromosome can contain several hundred to several thousand genes, arranged in linear order along the DNA molecule present in the chromosome. True 2. True or False? The sequence
From DNA to Protein
Nucleus Control center of the cell contains the genetic library encoded in the sequences of nucleotides in molecules of DNA code for the amino acid sequences of all proteins determines which specific proteins
Semiconservative DNA replication. Meselson and Stahl
DNA replication Semiconservative DNA replication Meselson and Stahl Hartl Replication of DNA New nucleotides are added to DNA only during replication in the 5-3 direction How double helix unwind DNA synthesis
Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure
Lecture 26: Overview of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) structure Nucleic acids play an important role in the storage and expression of genetic information. They are divided into
Genetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
Proteins and Nucleic Acids
Proteins and Nucleic Acids Chapter 5 Macromolecules: Proteins Proteins Most structurally & functionally diverse group of biomolecules. : o Involved in almost everything o Enzymes o Structure (keratin,
1. Molecular computation uses molecules to represent information and molecular processes to implement information processing.
Chapter IV Molecular Computation These lecture notes are exclusively for the use of students in Prof. MacLennan s Unconventional Computation course. c 2013, B. J. MacLennan, EECS, University of Tennessee,
2006 7.012 Problem Set 3 KEY
2006 7.012 Problem Set 3 KEY Due before 5 PM on FRIDAY, October 13, 2006. Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. Which reaction is catalyzed by each
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
DNA Replication and Repair
DNA Replication and Repair This lecture explores the mechanisms of DNA replication and also the ways in which DNA can repair any replication errors. It also looks at some of the causes of DNA damage and
Transcription and Translation of DNA
Transcription and Translation of DNA Genotype our genetic constitution ( makeup) is determined (controlled) by the sequence of bases in its genes Phenotype determined by the proteins synthesised when genes
Today you will extract DNA from some of your cells and learn more about DNA. Extracting DNA from Your Cells
DNA Based on and adapted from the Genetic Science Learning Center s How to Extract DNA from Any Living Thing (http://learn.genetics.utah.edu/units/activities/extraction/) and BioRad s Genes in a bottle
12.1 The Role of DNA in Heredity
12.1 The Role of DNA in Heredity Only in the last 50 years have scientists understood the role of DNA in heredity. That understanding began with the discovery of DNA s structure. In 1952, Rosalind Franklin
Cell Division CELL DIVISION. Mitosis. Designation of Number of Chromosomes. Homologous Chromosomes. Meiosis
Cell Division CELL DIVISION Anatomy and Physiology Text and Laboratory Workbook, Stephen G. Davenport, Copyright 2006, All Rights Reserved, no part of this publication can be used for any commercial purpose.
PRACTICE TEST QUESTIONS
PART A: MULTIPLE CHOICE QUESTIONS PRACTICE TEST QUESTIONS DNA & PROTEIN SYNTHESIS B 1. One of the functions of DNA is to A. secrete vacuoles. B. make copies of itself. C. join amino acids to each other.
DNA is found in all organisms from the smallest bacteria to humans. DNA has the same composition and structure in all organisms!
Biological Sciences Initiative HHMI DNA omponents and Structure Introduction Nucleic acids are molecules that are essential to, and characteristic of, life on Earth. There are two basic types of nucleic
Academic Nucleic Acids and Protein Synthesis Test
Academic Nucleic Acids and Protein Synthesis Test Multiple Choice Identify the letter of the choice that best completes the statement or answers the question. 1. Each organism has a unique combination
Lab # 12: DNA and RNA
115 116 Concepts to be explored: Structure of DNA Nucleotides Amino Acids Proteins Genetic Code Mutation RNA Transcription to RNA Translation to a Protein Figure 12. 1: DNA double helix Introduction Long
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) directionality along the backbone 5 (phosphate) to 3 (OH)
DNA, RNA, replication, translation, and transcription Overview Recall the central dogma of biology: DNA (genetic information in genes) RNA (copies of genes) proteins (functional molecules) DNA structure
Polar Covalent Bonds and Hydrogen Bonds
Lesson 6.1: Polar Covalent Bonds and Hydrogen Bonds The last section of code will add hydrogen bonding functionality between molecules. To do so, we have to understand the chemistry of polar covalent bonds
Copyright 1999 2003 by Mark Brandt, Ph.D.
Central dogma of molecular biology The term central dogma of molecular biology is patterned after religious terminology. owever, it refers to a process that is subject to the changes in understanding that
To be able to describe polypeptide synthesis including transcription and splicing
Thursday 8th March COPY LO: To be able to describe polypeptide synthesis including transcription and splicing Starter Explain the difference between transcription and translation BATS Describe and explain
Transcription in prokaryotes. Elongation and termination
Transcription in prokaryotes Elongation and termination After initiation the σ factor leaves the scene. Core polymerase is conducting the elongation of the chain. The core polymerase contains main nucleotide
The DNA Discovery Kit The Discovery Approach & Teacher Notes
...where molecules become real TM The DNA Discovery Kit & Teacher Notes www.3dmoleculardesigns.com All rights reserved on DNA Discovery Kit. US Patent 6,471,520 B1 Photos by Sean Ryan The DNA Discovery
Basic Concepts of DNA, Proteins, Genes and Genomes
Basic Concepts of DNA, Proteins, Genes and Genomes Kun-Mao Chao 1,2,3 1 Graduate Institute of Biomedical Electronics and Bioinformatics 2 Department of Computer Science and Information Engineering 3 Graduate
A disaccharide is formed when a dehydration reaction joins two monosaccharides. This covalent bond is called a glycosidic linkage.
CH 5 Structure & Function of Large Molecules: Macromolecules Molecules of Life All living things are made up of four classes of large biological molecules: carbohydrates, lipids, proteins, and nucleic
Chapter 5: The Structure and Function of Large Biological Molecules
Name Period Concept 5.1 Macromolecules are polymers, built from monomers 1. The large molecules of all living things fall into just four main classes. Name them. 2. Circle the three classes that are called
DNA Paper Model Activity Level: Grade 6-8
Karen Mayes DNA Paper Model Activity Level: Grade 6-8 Students will be able to: 1. Identify the component molecules of DNA. 2. Construct a model of the DNA double-helix. 3. Identify which bases are found
How Cancer Begins???????? Chithra Manikandan Nov 2009
Cancer Cancer is one of the most common diseases in the developed world: 1 in 4 deaths are due to cancer 1 in 17 deaths are due to lung cancer Lung cancer is the most common cancer in men Breast cancer
The DNA Discovery Kit The Guided Discovery Approach & Teacher Notes
...where molecules become real TM The DNA Discovery Kit & Teacher Notes www.3dmoleculardesigns.com All rights reserved on DNA Discovery Kit. US Patent 6,471,520 B1 Photos by Sean Ryan Teacher Notes Contents
3120-1 - Page 1. Name:
Name: 1) Which series is arranged in correct order according to decreasing size of structures? A) DNA, nucleus, chromosome, nucleotide, nitrogenous base B) chromosome, nucleus, nitrogenous base, nucleotide,
From DNA to Protein. Proteins. Chapter 13. Prokaryotes and Eukaryotes. The Path From Genes to Proteins. All proteins consist of polypeptide chains
Proteins From DNA to Protein Chapter 13 All proteins consist of polypeptide chains A linear sequence of amino acids Each chain corresponds to the nucleotide base sequence of a gene The Path From Genes
AS Biology Unit 2 Key Terms and Definitions. Make sure you use these terms when answering exam questions!
AS Biology Unit 2 Key Terms and Definitions Make sure you use these terms when answering exam questions! Chapter 7 Variation 7.1 Random Sampling Sampling a population to eliminate bias e.g. grid square
Molecular Genetics. RNA, Transcription, & Protein Synthesis
Molecular Genetics RNA, Transcription, & Protein Synthesis Section 1 RNA AND TRANSCRIPTION Objectives Describe the primary functions of RNA Identify how RNA differs from DNA Describe the structure and
Translation Study Guide
Translation Study Guide This study guide is a written version of the material you have seen presented in the replication unit. In translation, the cell uses the genetic information contained in mrna to
Forensic DNA Testing Terminology
Forensic DNA Testing Terminology ABI 310 Genetic Analyzer a capillary electrophoresis instrument used by forensic DNA laboratories to separate short tandem repeat (STR) loci on the basis of their size.
The Molecules of Cells
The Molecules of Cells I. Introduction A. Most of the world s population cannot digest milk-based foods. 1. These people are lactose intolerant because they lack the enzyme lactase. 2. This illustrates
Teacher Guide: Have Your DNA and Eat It Too ACTIVITY OVERVIEW. http://gslc.genetics.utah.edu
ACTIVITY OVERVIEW Abstract: Students build an edible model of DNA while learning basic DNA structure and the rules of base pairing. Module: The Basics and Beyond Prior Knowledge Needed: DNA contains heritable
PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY
Name PRESTWICK ACADEMY NATIONAL 5 BIOLOGY CELL BIOLOGY SUMMARY Cell Structure Identify animal, plant, fungal and bacterial cell ultrastructure and know the structures functions. Plant cell Animal cell
4. Which carbohydrate would you find as part of a molecule of RNA? a. Galactose b. Deoxyribose c. Ribose d. Glucose
1. How is a polymer formed from multiple monomers? a. From the growth of the chain of carbon atoms b. By the removal of an OH group and a hydrogen atom c. By the addition of an OH group and a hydrogen
Viral Infection: Receptors
Viral Infection: Receptors Receptors: Identification of receptors has come from expressing the gene for the receptor in a cell to which a virus does not normally bind -OR- By blocking virus attachment
Biochemistry of Cells
Biochemistry of Cells 1 Carbon-based Molecules Although a cell is mostly water, the rest of the cell consists mostly of carbon-based molecules Organic chemistry is the study of carbon compounds Carbon
Biology Final Exam Study Guide: Semester 2
Biology Final Exam Study Guide: Semester 2 Questions 1. Scientific method: What does each of these entail? Investigation and Experimentation Problem Hypothesis Methods Results/Data Discussion/Conclusion
Bob Jesberg. Boston, MA April 3, 2014
DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double
Lecture Overview. Hydrogen Bonds. Special Properties of Water Molecules. Universal Solvent. ph Scale Illustrated. special properties of water
Lecture Overview special properties of water > water as a solvent > ph molecules of the cell > properties of carbon > carbohydrates > lipids > proteins > nucleic acids Hydrogen Bonds polarity of water
CHAPTER 5 DNA REPLICATION I: Enzymes and mechanism. Basic Mechanisms of Replication
CHER 5 DN RELICION I: Enzymes and mechanism fundamental property of living organisms is their ability to reproduce. Bacteria and fungi can divide to produce daughter cells that are identical to the parental
Name Class Date. Summarize the events of DNA replication. Compare DNA replication in prokaryotes with that of eukaryotes.
12.3 DNA Replication Lesson Objectives Summarize the events of DNA replication. Compare DNA replication in prokaryotes with that of eukaryotes. Lesson Summary Copying the Code Each strand of the double
DNA, REPLICATION AND TRANSCRIPTION
D N A, R E P L I C AT I O N A N D T R A N S C R I P T I O N Teacher s Guide KNX 96080-V2 2007 K'NEX Limited Partnership Group and its licensors. DNA, REPLICATION AND TRANSCRIPTION K NEX Limited Partnership
How many of you have checked out the web site on protein-dna interactions?
How many of you have checked out the web site on protein-dna interactions? Example of an approximately 40,000 probe spotted oligo microarray with enlarged inset to show detail. Find and be ready to discuss
Q: How are proteins (amino acid chains) made from the information in mrna? A: Translation Ribosomes translate mrna into protein
ranslation (written lesson) Q: How are proteins (amino acid chains) made from the information in mrn? : ranslation Ribosomes translate mrn into protein ranslation has 3 steps also! 1. ranslation Initiation:
AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET
NAME: AP Biology TEST #5 - Chapters 11-14, 16 - REVIEW SHEET 1. Griffith's experiments showing the transformation of R strain pneumococcus bacteria to S strain pneumococcus bacteria in the presence of
The Biotechnology Education Company
EDVTEK P.. Box 1232 West Bethesda, MD 20827-1232 The Biotechnology 106 EDV-Kit # Principles of DNA Sequencing Experiment bjective: The objective of this experiment is to develop an understanding of DNA
GENE REGULATION. Teacher Packet
AP * BIOLOGY GENE REGULATION Teacher Packet AP* is a trademark of the College Entrance Examination Board. The College Entrance Examination Board was not involved in the production of this material. Pictures
Genetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled
Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino
Provincial Exam Questions. 9. Give one role of each of the following nucleic acids in the production of an enzyme.
Provincial Exam Questions Unit: Cell Biology: Protein Synthesis (B7 & B8) 2010 Jan 3. Describe the process of translation. (4 marks) 2009 Sample 8. What is the role of ribosomes in protein synthesis? A.
1. When new cells are formed through the process of mitosis, the number of chromosomes in the new cells
Cell Growth and Reproduction 1. When new cells are formed through the process of mitosis, the number of chromosomes in the new cells A. is half of that of the parent cell. B. remains the same as in the
BIOMOLECULES. reflect
reflect A child s building blocks are relatively simple structures. When they come together, however, they can form magnifi cent structures. The elaborate city scene to the right is made of small, simple
The Nucleus: DNA, Chromatin And Chromosomes
The Nucleus: DNA, Chromatin And Chromosomes Professor Alfred Cuschieri Department of Anatomy, University of Malta. Objectives By the end of this unit the student should be able to: 1. List the major structural
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
What is the Structure of DNA?
ER 1 D: he ereditary Molecule uanine ytosine denine hymine EI What is the tructure of D? hapter 1 Modern enetics for ll tudents 19 hapter 1: ection Background E BILIY F D to act as a reservoir of hereditary
DNA and Forensic Science
DNA and Forensic Science Micah A. Luftig * Stephen Richey ** I. INTRODUCTION This paper represents a discussion of the fundamental principles of DNA technology as it applies to forensic testing. A brief
Module 3 Questions. 7. Chemotaxis is an example of signal transduction. Explain, with the use of diagrams.
Module 3 Questions Section 1. Essay and Short Answers. Use diagrams wherever possible 1. With the use of a diagram, provide an overview of the general regulation strategies available to a bacterial cell.
RNA & Protein Synthesis
RNA & Protein Synthesis Genes send messages to cellular machinery RNA Plays a major role in process Process has three phases (Genetic) Transcription (Genetic) Translation Protein Synthesis RNA Synthesis
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA
CHAPTER 6: RECOMBINANT DNA TECHNOLOGY YEAR III PHARM.D DR. V. CHITRA INTRODUCTION DNA : DNA is deoxyribose nucleic acid. It is made up of a base consisting of sugar, phosphate and one nitrogen base.the
Meiosis is a special form of cell division.
Page 1 of 6 KEY CONCEPT Meiosis is a special form of cell division. BEFORE, you learned Mitosis produces two genetically identical cells In sexual reproduction, offspring inherit traits from both parents
Thymine = orange Adenine = dark green Guanine = purple Cytosine = yellow Uracil = brown
1 DNA Coloring - Transcription & Translation Transcription RNA, Ribonucleic Acid is very similar to DNA. RNA normally exists as a single strand (and not the double stranded double helix of DNA). It contains
Cellular Respiration Worksheet 1. 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain.
Cellular Respiration Worksheet 1 1. What are the 3 phases of the cellular respiration process? Glycolysis, Krebs Cycle, Electron Transport Chain. 2. Where in the cell does the glycolysis part of cellular
NO CALCULATORS OR CELL PHONES ALLOWED
Biol 205 Exam 1 TEST FORM A Spring 2008 NAME Fill out both sides of the Scantron Sheet. On Side 2 be sure to indicate that you have TEST FORM A The answers to Part I should be placed on the SCANTRON SHEET.
The Somatic Cell Cycle
The Somatic Cell Cycle Maternal chromosome Diploid Zygote Diploid Zygote Paternal chromosome MITOSIS MITOSIS Maternal chromosome Diploid organism Diploid organism Paternal chromosome Int terpha ase The
The E. coli Insulin Factory
The E. coli Insulin Factory BACKGROUND Bacteria have not only their normal DNA, they also have pieces of circular DNA called plasmids. Plasmids are a wonderfully ally for biologists who desire to get bacteria
MCAS Biology. Review Packet
MCAS Biology Review Packet 1 Name Class Date 1. Define organic. THE CHEMISTRY OF LIFE 2. All living things are made up of 6 essential elements: SPONCH. Name the six elements of life. S N P C O H 3. Elements
Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA
Page 1 of 5 Biology Behind the Crime Scene Week 4: Lab #4 Genetics Exercise (Meiosis) and RFLP Analysis of DNA Genetics Exercise: Understanding how meiosis affects genetic inheritance and DNA patterns
